Molecular Marker of Wheat Crown Rot Resistance Locus Qfcr.cau-1B and Its Application
By developing the molecular marker and detection method of the wheat stem-based rot disease-resistant site Qfcr.cau-1B, and PCR amplification using the STARP primer set, the problem of difficulty in quickly and accurately screening wheat disease-resistant germplasm resources in the prior art is solved, and the effect of rapidly identifying the resistance of wheat stem-based rot is achieved.
Patent Information
- Application Number
- CN202411938633.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-26
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2044-12-26
AI Technical Summary
No materials that show high resistance to wheat stem-based rot have been found in the prior art, and the resistance to wheat stem-based rot is a quantitative trait controlled by multiple genes, making it difficult to quickly and accurately screen out disease-resistant germplasm resources.
Molecular marking and detection methods of the anti-disease site of wheat stem-based rot were developed, and the STARP primer set was used for PCR amplification, and the wheat resistance was judged by band differences of 144bp and 154bp. STARP primer set and kit were designed for rapid identification.
It has achieved rapid and accurate identification of wheat resistance to stem-based rot, providing valuable molecular tools for wheat resistant to FCR germplasm resource screening, and improving screening efficiency.
Smart Images

Figure CN119530441B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of molecular markers and plant genetic breeding, in particular to a molecular marker of wheat stem rot resistance site Qfcr.cau-1B and an application thereof. Background Art
[0002] Wheat crown rot (FCR) is a worldwide soil-borne wheat disease caused by the fungus Fusarium. The disease can occur throughout the wheat growth period. Infected wheat leaves and stems at the base of the stem turn brown, and some or all of the tissue necrotizes. This can cause seedling death or white ears in mature plants, severely reducing wheat yield.
[0003] Research on wheat stem rot, both domestically and internationally, has primarily focused on identifying resistance in various wheat varieties and preliminary mapping of resistance genes. However, to date, no highly resistant wheat varieties have been found internationally; only moderately resistant varieties, such as CSCR6, 2-49, and Sunco, have been identified. Using these moderately resistant varieties to construct recombinant inbred lines (RILs), multiple QTLs controlling wheat stem rot resistance have been identified through QTL mapping. For example, Ma et al. located a QTL for stem rot resistance on chromosome 3BL using the "CSCR6 / Lang" population, which explained up to 49% of the phenotypic variation. Martin et al. identified 13 distinct QTLs in Sunco, 2-49, IRN497, and CPI1338144. Among these, QTLs at 1AS, 1BS, 1DL, and 4BS, contributed by 2-49, and at 2BS, contributed by Sunco, were detected in multiple experiments.
[0004] Given that wheat stem rot resistance is a quantitative trait controlled by multiple genes, the development of molecular markers is of great significance for screening stem rot-resistant germplasm resources and promoting the improvement of stem rot resistance. Summary of the Invention
[0005] The present invention aims to provide a molecular marker for the wheat stem rot resistance locus Qfcr.cau-1B and its application to address the above-mentioned problems in the prior art. The molecular marker provided by the present invention can quickly and accurately identify wheat resistance to FCR, providing a very valuable molecular tool for screening wheat FCR-resistant germplasm resources.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a molecular marker for wheat stem rot resistance site Qfcr.cau-1B. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a T / A mutation exists at the 201st base of the sequence shown in SEQ ID NO.1.
[0008] The present invention also provides a STARP primer set for detecting the molecular marker, which comprises an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.4.
[0009] The present invention also provides use of the STARP primer set in preparing a kit for detecting wheat stem rot resistance.
[0010] The present invention also provides a kit for detecting wheat stem base rot resistance, comprising the STARP primer set.
[0011] The present invention also provides an application of the STARP primer set or the kit, for use in any of the following applications:
[0012] (1) Identify wheat resistance to stem rot;
[0013] (2) Screening of wheat varieties or lines that are resistant or susceptible to wheat stem rot.
[0014] The present invention also provides a method for identifying wheat resistance to stem base rot, comprising the following steps:
[0015] Using the genomic DNA of the wheat sample to be tested as a template, performing PCR amplification on the template using the STARP primer set or the kit, and using the amplification result to determine the resistance of the wheat to stem base rot;
[0016] If a 144 bp band is detected in the amplification result, it is determined that the wheat to be tested is resistant to the stem base rot;
[0017] If a 154 bp band is detected in the amplification result, it is determined that the wheat to be tested is susceptible to the stem base rot.
[0018] Optionally, the reaction system for PCR amplification is: 1.0 μL 100 ng / μL DNA, 5 μL 2×Taq PCR StarMix, 1 μL mixed primers and 3 μL ddH2O.
[0019] Optionally, in the primer mixture, the volume ratio of the upstream primer F1, the upstream primer F2 and the downstream primer R is 1:1:2.
[0020] Optionally, the reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 5 minutes; stage one: denaturation at 94°C for 30 seconds; annealing at 65°C for 30 seconds, decreasing by 1°C each cycle, and extension at 72°C for 30 seconds; a total of 10 cycles; stage two: denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 72°C for 30 seconds; a total of 25 cycles.
[0021] The present invention discloses the following technical effects:
[0022] This study used recombinant inbred line populations derived from 20828 and SY95-71, combined with 55K microarray data, to investigate genetic loci associated with FCR resistance in 20828. A stable QTL for stem rot resistance was discovered on the short arm of wheat chromosome 1B. STARP molecular markers were further developed targeting this locus, which can be used for large-scale material screening. The close association between the developed molecular marker and disease resistance was verified in a RIL population constructed from 20828 and BLS2 as parents. This STARP molecular marker can quickly and accurately identify wheat resistance to FCR, providing a valuable molecular tool for screening wheat germplasm resources for FCR resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0024] Figure 1 The severity of stem rot in wheat materials, the resistant parent is 20828, and the susceptible parent is SY95-71;
[0025] Figure 2 To map the FCR resistance distribution of populations for 20828 and SY95-71;
[0026] Figure 3 Figure 2: QTL conferring FCR resistance in the 20828 / SY95-71 population, where: a: QTL associated with FCR was located using a genetic map, with the LOD value from each cM (x-axis) plotted against the chromosome (y-axis), and the threshold LOD value used to indicate the presence of the QTL indicated by a dotted line; b: Genetic map of chromosome 1B with SNP markers, with the red region representing the genetic position of the QTL;
[0027] Figure 4 The STARP marker typing results in the 20828 and BLS2 recombinant inbred line populations;
[0028] Figure 5 Box plot showing the effect of QTL on FCR resistance in the recombinant populations of 20828 and BLS2, ** indicates a significant level of P < 0.01. DETAILED DESCRIPTION
[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0030] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.
[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0034] The wheat lines 20828, SY95-71, and BLS2 used in the examples of the present invention were all provided by the Wheat Department of Sichuan Agricultural University. Unless otherwise specified, other materials involved in the examples of this application can be purchased through conventional commercial channels, and the experimental methods involved are all conventional experimental methods in the art.
[0035] Example
[0036] The inventors used two recombinant inbred line (RIL) populations constructed from wheat lines 20828, SY95-71, and BLS2 to study and verify the genetic loci associated with wheat stem rot (FCR) resistance in 20828. The details are as follows:
[0037] 1. Phenotypic analysis of wheat stem rot
[0038] The wild-type strain WZ2-8A of F. graminearum was activated into a bacterial cake by PDA and inoculated into CMC liquid medium. The culture medium was shaken at 25°C and 180 rpm for 4 days, and filtered through 4 layers of gauze. The spore suspension concentration was adjusted to 1×10 6 / mL, and obtain a spore suspension. When the seed buds of the RIL population are about 0.5-1cm long, soak the seeds in a spore suspension (containing 0.1% by volume of Tween 20) for 1 minute. Transplant the seeds into 5×10 hole trays, 2 seeds per hole, and water from the bottom. The first soaking watering is used, and then watering is carried out when it is dry (about 6-7 days) or severely dehydrated. The greenhouse temperature is 25℃ / 15℃, day / night. At the same time, inoculate the disease-resistant control material Sunco and the disease-susceptible control Xinmai 26. When the control disease level is level 5 (about 42 days after transplanting), conduct a disease level survey on the base of the wheat stem according to Table 1. The disease index is calculated according to the formula disease index (%) = ∑ (disease level × number of plants at this level) / (total number of plants surveyed × highest disease level) × 100.
[0039] Table 1 Grading and evaluation criteria for wheat stem rot resistance
[0040]
[0041] The disease resistance levels of the F8 recombinant inbred lines of 20828 and SY95-71 were investigated. Figure 1 As shown, the susceptible parent SY95-71 had obvious brown lesions at the base of the stem. In contrast, the resistant parent 20828 had less brown lesions on the stem and the plant grew normally ( Figure 1 ), using Excel 2013 for statistical analysis, the results showed that the group disease index was continuously distributed, in line with the normal distribution, and was a typical quantitative trait ( Figure 2 The disease index ranged from 17.08 to 77.86. The broad-sense heritability was 0.84, indicating that the population contained sufficient genetic variation (Table 2).
[0042] Table 2 Severity of Fusarium crown rot in 20828 and SY95-71 populations
[0043]
[0044] 2. QTL analysis and verification
[0045] Using the QTL IciMapping software, phenotypic data and molecular markers were combined for QTL analysis, and a total of five QTLs were found to be significantly associated with FCR resistance, located on chromosomes 1B, 2B, 3A, 5A, and 7D. Among them, the QTL located on chromosome 1B (Qfcr.cau-1B, within a 7.6Mb segment between 7.1-14.7Mb, located on the short arm of chromosome 1B, gene version IWGSC 1.1) was detected in all three experiments, explaining 28.33% of the phenotypic variation ( Figure 3 ).
[0046] Based on the molecular marker STARP-0405 (SEQ ID NO. 1) located on the short arm of chromosome 1B and significantly associated with stem base rot resistance, STARP-0405 primers were designed as shown below:
[0047] Upstream primer F1: 5′-TAGCTCATGTGATTATTGTATTAAT-3′ (SEQ ID NO. 2);
[0048] Upstream primer F2: 5′-ACGACTCAATTAGCTCATGTGATTATTGTATCGAA-3′ (SEQ ID NO. 3);
[0049] Downstream primer R: 5′-ATCATGTCCATGTGTAATAGTGCTC-3′ (SEQ ID NO. 4).
[0050] The bold bases in the upstream primer are artificially designed SNP mutations, and the bases T (for SEQ ID NO. 2) and A (for SEQ ID NO. 3) at the 3' end are typing sites.
[0051] The sequence of the molecular marker STARP-0405 is as follows:
[0052] ATGGCTAGTGCAACATTAATAGATCAGAGAGTATATATGTATATAAATTATGCAACAA
[0053] AGAACTCTTATGAATCCAAGAATAAAACATGTACAAATCTGACCATAAAAGTGAAAATTCT
[0054] TCACATTGCAACAAACACATCAAAAAAATTACATCGGATGAAGCCTAAGCATGTAGGGT
[0055] AGCTCATGTGATTATTGTATTGATGAAAATGTAGACATTGCCACCTAGCTGCACCTATGG
[0056] AACCATATATGTGGTAGCTCCAAAGGATGAAGCCTAAGCATGTAGGGTAGCTCCAAAGG
[0057] AGCACTATTACACATGGACATGATTGCAGCAAGGTTGATGTAGATGGTCGTAATGAAGGA
[0058] TCTCCCCTCTTAAAGAGTATCGAGGAAAATCATCCAGACTGGATC (SEQ ID NO. 1). The bold mark is the SNP site, that is, the 201st base of the sequence shown in SEQ ID NO. 1 is the SNP site, and its base is T or A.
[0059] The base of the disease-resistant parent 20828 at the above SNP site is T, and a 144 bp band can be amplified; the base of the disease-susceptible parent BLS2 at the above SNP site is A, and a 154 bp band can be amplified.
[0060] The distribution of wheat stem rot resistance in the F5 generation RIL population of 20828 and BLS2 was detected by genotyping using molecular marker STARP-0405. The competitive primers F1, F2 and reverse primer R were prepared in a 1:1:2 (V / V / V) ratio. The PCR reaction system was 10 μL: template DNA (100 ng·μL -1 ) 1.0 μL, 2× Taq PCR Star Mix (Genstar, Beijing) 5 μL, primer mix 1 μL, and ddH2O 3 μL. The PCR amplification reaction program was as follows: Touch-down PCR amplification. Initial denaturation was at 94°C for 5 min. Stage 1: denaturation at 94°C for 30 s; annealing at 65°C for 30 s, decreasing 1°C each cycle; and extension at 72°C for 30 s; for a total of 10 cycles. Stage 2: denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s; for a total of 25 cycles. PCR products were further analyzed by polyacrylamide gel electrophoresis (PAGE).
[0061] STARP tagging is to artificially add fragments of different lengths to two competitive primers. Due to different genotypes, the competitive primers that can bind are different, so the lengths of the amplified fragments will be different. Genotyping can be completed based on the length difference. Figure 4As shown in the figure, if a 144bp band is detected, the wheat to be tested is judged to be resistant to stem base rot; if a 154bp band is detected, the wheat to be tested is judged to be susceptible to stem base rot. Therefore, the size of the band can be used to determine whether it is a disease-resistant genotype. In the F5 population of 20828 and BLS2, 38 of the above SNPs are homozygous for the 20828 allele (the average disease index is 38.09), and 45 are homozygous for the BLS2 allele (the average disease index is 44). The difference between the two groups' means is 13.42% ( Figure 5 ).
[0062] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. Use of a primer set for detecting the wheat stem rot resistance site Qfcr.cau-1B molecular marker in the preparation of a kit for detecting wheat stem rot resistance, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a T / A mutation at the 201st base of the sequence shown in SEQ ID NO.1; the primer set includes an upstream primer F1 with a nucleotide sequence shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence shown in SEQ ID NO.3, and a downstream primer R with a nucleotide sequence shown in SEQ ID NO.
4.
2. A primer set for detecting the Qfcr.cau-1B molecular marker of wheat stem rot resistance site or a kit comprising the primer set, characterized in that: Used in any of the following applications: (1) Identify wheat resistance to stem rot; (2) Screening for wheat varieties or lines that are resistant or susceptible to wheat stem rot; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a T / A mutation at the 201st base of the sequence shown in SEQ ID NO.1; The primer set includes an upstream primer F1 whose nucleotide sequence is shown as SEQ ID NO.2, an upstream primer F2 whose nucleotide sequence is shown as SEQ ID NO.3, and a downstream primer R whose nucleotide sequence is shown as SEQ ID NO.
4.
3. A method for identifying wheat resistance to stem rot, characterized in that: The steps include: Using the genomic DNA of the wheat sample to be tested as a template, performing PCR amplification on the template using a primer set or a kit containing the primer set, and using the amplification result to determine the resistance of the wheat to stem base rot; If a 144 bp band is detected in the amplification result, it is determined that the wheat to be tested is resistant to the stem base rot; If a 154 bp band is detected in the amplification result, it is determined that the wheat to be tested is susceptible to the stem base rot; The primer set includes an upstream primer F1 whose nucleotide sequence is shown as SEQ ID NO.2, an upstream primer F2 whose nucleotide sequence is shown as SEQ ID NO.3, and a downstream primer R whose nucleotide sequence is shown as SEQ ID NO.
4.
4. The method according to claim 3, characterized in that The PCR amplification reaction system was: 1.0 μL 100 ng / μL DNA, 5 μL 2×Taq PCR Star Mix, 1 μL mixed primers, and 3 μL ddH 2 O.
5. The method according to claim 4, characterized in that In the primer mixture, the volume ratio of the upstream primer F1, the upstream primer F2 and the downstream primer R is 1:1:
2.
6. The method according to claim 3, characterized in that The PCR amplification reaction procedure was as follows: pre-denaturation at 94°C for 5 min; stage one: denaturation at 94°C for 30 s; annealing at 65°C for 30 s, decreasing by 1°C per cycle, and extension at 72°C for 30 s; for a total of 10 cycles; stage two: denaturation at 94°C for 30 s; annealing at 55°C for 30 s; and extension at 72°C for 30 s; for a total of 25 cycles.
Citation Information
Patent Citations
Molecular marker for detecting leaf rust resistance gene LrN4B or LrN3B of wheat and application of molecular marker
CN116790789A