Mutants of the auto-cleavage site of Streptomyces trypsin and their application

Abstract

The present invention belongs to the field of biotechnology, and specifically discloses a self-cleavage site mutant of Streptomyces trypsin and its application. The trypsin amino acid sequence shown in SEQ ID NO.1 is used as a parent, and the lysine at the 81st position of the parent amino acid is mutated into serine, and the arginine at the 119th position is mutated into glutamic acid or threonine, thereby obtaining two strains of Streptomyces trypsin mutants K81S / R119E and K81S / R119T. The present invention performs mutation evolution on trypsin derived from Streptomyces in vitro, firstly scans the arginine and lysine sites in the amino acid sequence and mutates them to alanine at a specific site, determines the importance of arginine and lysine residues for maintaining trypsin activity, and then performs amino acid saturation mutation and combined mutation on the potential degradation sites where the trypsin activity is improved after mutation, thereby further improving the trypsin activity of the mutant.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a streptomyces trypsin self-cleavage site mutant and application thereof. Background Art

[0002] Trypsin is a serine protease originally extracted from the pancreas of vertebrates. Trypsin is secreted in the inactive form of trypsinogen. When it reaches the small intestine, it is activated by enterokinase in the intestinal fluid and converted into the active form of trypsin. In addition to natural sources, trypsin can also be heterologously expressed in microorganisms or other hosts through recombinant DNA technology, such as trypsin from Streptomyces. Especially in research or industrial production, it is expressed using Escherichia coli, yeast (Pichia pastoris), etc. Trypsin is a highly specific protease that mainly cuts the peptide bonds at the ends of lysine (Lys) and arginine (Arg) residues in the peptide chain. Trypsin plays an important role in many fields such as biomedicine, food industry, laboratory research and leather industry due to its specificity, stability and wide application scenarios.

[0003] The existing recombinant expression of trypsin has high production costs and low enzyme activity, which increases its application cost and limits the expansion of the application of recombinant trypsin. Therefore, it is imperative to find more active trypsin and reduce its use cost.

[0004] Since trypsin can specifically hydrolyze the peptide bonds at the carboxyl ends of lysine and arginine in the amino acid sequence, and it also has many lysine and arginine residues, which may lead to its self-degradation. Therefore, amino acid substitution of the arginine and lysine residues present in the enzyme may reduce the possibility of such self-degradation and improve its enzyme activity. Summary of the invention

[0005] Based on the above reasons, the purpose of the present invention is to provide a self-cleavage site mutant of Streptomyces trypsin and its application, perform alanine scanning on the arginine and lysine sites present in Streptomyces trypsin, screen the potential degradation sites with improved trypsin activity after mutation, perform amino acid saturation mutation and combination mutation, and finally obtain a trypsin mutant with significantly improved enzyme activity.

[0006] The present invention is achieved through the following technical solutions:

[0007] The Streptomyces trypsin self-cleavage site mutant takes the trypsin amino acid sequence shown in SEQ ID NO.1 as the parent, mutates the lysine at the 81st amino acid position of the parent into serine, and mutates the arginine at the 119th amino acid position into glutamic acid or threonine.

[0008] A gene encoding the streptomyces trypsin self-cleavage site mutant.

[0009] A recombinant plasmid carrying the gene.

[0010] Furthermore, the recombinant plasmid vector is puc980.

[0011] A host bacterium expressing the recombinant plasmid.

[0012] Furthermore, the host bacteria is Bacillus subtilis SCK6.

[0013] The present invention also provides a method for preparing the Streptomyces trypsin self-cleavage site mutant, which is characterized by comprising the following steps:

[0014] The arginine and lysine in the trypsin amino acid sequence shown in SEQ ID NO.1 were mutated into alanine, and mutants with improved enzyme activity were screened. The selected mutation sites were further subjected to saturation mutation, and mutants with further improved enzyme activity were screened. Finally, combined mutations between different sites were performed to screen mutants with high enzyme activity.

[0015] The present invention also provides the application of the streptomyces trypsin self-cleavage site mutant in the fields of food, leather, medicine, biochemistry and chemical industry.

[0016] Furthermore, the Streptomyces trypsin self-cleavage site mutant is used to cleave the carboxyl end of arginine or lysine in a peptide chain.

[0017] The invention also provides an enzyme preparation, comprising the streptomyces trypsin self-cleavage site mutant.

[0018] The present invention has the following beneficial effects:

[0019] The present invention performs mutation evolution on trypsin derived from Streptomyces in vitro, first scanning the arginine and lysine sites in the amino acid sequence and mutating them to alanine, determining the importance of arginine and lysine residues for maintaining trypsin activity, and then performing amino acid saturation mutation and combined mutation on the potential degradation sites with improved trypsin activity after mutation, further improving the trypsin activity of the mutant. After the transformation, the Kcat / Km of the two trypsin mutants were 2.67 times and 3.09 times that of the parent trypsin, respectively, and the enzyme activities of the two trypsin mutants were 83.28U / mL and 93.87U / mL, respectively. The trypsin mutants obtained by the present invention can be applied to the carboxyl end of arginine or lysine in cutting peptide chains in the fields of food, leather, medicine, biochemistry, and chemical industry, and have a wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is the relative trypsin activity of the 18 potential cleavage site mutants and the parent in Example 3;

[0021] Figure 2 The relative trypsin activity of each mutant after saturation mutation of the K81A alanine mutant strain in Example 4;

[0022] Figure 3 The relative trypsin activity of each mutant after saturation mutation of the R119A alanine mutant strain in Example 4. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments.It should be understood that these descriptions are exemplary only, and are not intended to limit the scope of the present invention.In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present invention.Unspecified conditions in the embodiment are carried out according to the conditions of normal conditions or manufacturer's recommendations.Reagents used or instruments that do not specify manufacturers are conventional products that can be purchased and obtained commercially.

[0024] The terms involved in the present invention are explained as follows:

[0025] 1. Parent trypsin: refers to the trypsin that can produce the mutant of the present invention after undergoing the mutation described in the present invention; Parent strain: refers to the original source Streptomyces of the present invention.

[0026] Protease mutant: refers to a mutated protease having one or more mutations in the sequence compared to the amino acid sequence of the parent protease. The mutant is expressed in a host cell by transferring the mutant gene into a plasmid.

[0027] Host bacteria: refers to any cell type susceptible to transformation, transfection, transduction, etc. with a vector containing a nucleic acid of the present invention; it covers any progeny of a parent cell that is not completely identical to the parent cell due to mutations that occur during replication.

[0028] Protease activity was defined as: at 37°C, an increase of 0.1 in ΔA410nm per minute was equivalent to one amidase hydrolysis unit of trypsin.

[0029] The identification of the trypsin mutant uses "amino acid replaced by the parent amino acid position" to indicate the mutated amino acid in the trypsin mutant. For example, R6A means that the amino acid at position 6 is replaced by A from R of the parent trypsin, and the position number corresponds to the number in SEQ ID NO:1 in the attached sequence table.

[0030] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0031] The first embodiment of the present invention provides a Streptomyces trypsin self-cleavage site mutant, taking the trypsin amino acid sequence shown in SEQ ID NO.1 as the parent, mutating the lysine at the 81st amino acid position of the parent into serine, and mutating the arginine at the 119th amino acid position into glutamic acid or threonine.

[0032] The second embodiment of the present invention provides a gene encoding the above-mentioned Streptomyces trypsin self-cleavage site mutant and a recombinant plasmid carrying the gene. The skeleton of the recombinant plasmid of the present invention can be selected by those skilled in the art according to the implementation needs, and can be any plasmid vector with expression ability disclosed or undisclosed in the art. Preferably, the recombinant plasmid vector is puc980, and the trypsin gene of the present invention is inserted into the appropriate site of the expression plasmid so that its nucleotide sequence can be operably connected to the expression control sequence.

[0033] The embodiments of the present invention further provide a host bacterium for expressing the above-mentioned recombinant plasmid. The basic cell of the host cell can be any cell type with expression ability disclosed or undisclosed in the art. The preferred host bacterium is Bacillus subtilis SCK6.

[0034] An embodiment of the present invention also provides a method for preparing the above-mentioned Streptomyces trypsin self-cleavage site mutant, comprising the following steps: mutating arginine and lysine in the trypsin amino acid sequence shown in SEQ ID NO.1 into alanine, screening mutants with improved enzyme activity, further performing saturation mutation on the selected mutation site, and then screening mutants with further improved enzyme activity, and finally performing combined mutations between different sites to screen mutants with high enzyme activity.

[0035] Specifically, the present invention adopts a gene total synthesis method to obtain a target gene fragment encoding trypsin, and the gene sequence is shown in SEQ ID NO.2. A recombinant plasmid is constructed by a plasmid polymer method. There are 18 potential arginine and lysine cleavage sites in Streptomyces trypsin. After alanine scanning of the 18 sites, nine mutants with improved enzyme activity, namely K66A, K79A, K81A, R90A, R119A, K130A, K178A, R199A and R218A, are screened. The four mutants with the best enzyme activity improvement, namely K81A, R119A, R199A and K79A, are selected as saturation mutation objects, and the remaining 17 amino acids are replaced. The mutants with improved enzyme activity of the saturation mutant strains relative to the alanine mutant strains are screened, and then combined mutations are performed to finally screen out two trypsin mutants with high enzyme activity (K81S / R119E, K81S / R119T), whose amino acid sequences are shown in SEQ ID NO.3 and SEQ ID NO.5, and the gene sequence is shown in SEQ ID NO.4 and SEQ ID NO.6.

[0036] The embodiment of the present invention also provides the application of the above-mentioned Streptomyces trypsin self-cleavage site mutant in the fields of food, leather, medicine, biochemistry, and chemical industry; the Streptomyces trypsin self-cleavage site mutant is used to cut the carboxyl end of arginine or lysine in the peptide chain. Trypsin can specifically hydrolyze the carboxyl end of arginine or lysine, and its application range includes but is not limited to: hydrolyzing animal or plant protein in the food field, which helps to form the characteristic flavor of food and is more conducive to human absorption; in the leather field, it is used for leather deashing and softening processes, etc.; in the pharmaceutical field, it reduces protein molecular weight, produces vaccines, reduces desensitization reactions, etc.; in the biochemical field, by observing the hydrolysis of different proteins by trypsin, it can be judged whether the protein sample contains specific protein components, or evaluate the purity and integrity of the protein, which is used to detect the purity of the protein, identify the type of protein, etc.; in the chemical field, as a catalyst, it specifically improves the efficiency of the reaction and increases the yield of the target product.

[0037] An embodiment of the present invention further provides an enzyme preparation comprising the above-mentioned Streptomyces trypsin self-cleavage site mutant.

[0038] The present invention will be described in more detail below through specific embodiments. Unless otherwise specified, in the following embodiments:

[0039] The culture medium and related determination methods used in the present invention are as follows:

[0040] 1. Preparation of culture medium

[0041] LB medium: 1% sodium chloride, 1% tryptone, 0.5% yeast extract;

[0042] Improved LB medium: 1% sodium chloride, 1% tryptone, 0.5% yeast extract, 1.5% xylose;

[0043] Seed medium: 1% sodium chloride, 1% tryptone, 2.0% starch, 0.503% potassium dihydrogen phosphate, 1.424% potassium hydrogen phosphate trihydrate, pH 7.0;

[0044] Fermentation medium: sodium chloride 1%, tryptone 1%, starch 2.0%, potassium dihydrogen phosphate 0.503%, dipotassium hydrogen phosphate trihydrate 1.424%, pH 7.0.

[0045] Trypsin activity detection method:

[0046] Weigh a certain amount of BAPNA and dissolve it in DMSO to a final concentration of 25 mM. Add 2 mL of preheated Tris-HCl (pH 8.0), 50 μL of substrate solution (BAPNA) and 200 μL of enzyme solution to a cuvette with a pathlength of 1 cm. Measure the absorbance change at a UV wavelength of 410 nm.

[0047] Example 1: Construction of target recombinant plasmid

[0048] The trypsin gene sequence from Streptomyces was obtained from Gen Bank, and the target gene fragment encoding trypsin was obtained by gene total synthesis. In order to improve the transformation efficiency of the plasmid, the recombinant plasmid was constructed by plasmid multimers. The specific steps are as follows:

[0049] The primers designed for amplifying plasmid polymers have the following specific sequences:

[0050] MK JF: GAGGCGCAACTCAAGCTTTTGCCGTAGTAGGTGGTACTCGTGC;

[0051] MK JR:GCAGGTCGACTCTAGAGGATCCTTATAAACCAGCAGCAGCACG;

[0052] MK JLF:CGTGCTGCTGCTGGTTTATAAGGATCCCTCTAGAGTCGACCTGC;

[0053] MK JLR: GCACGAGTACCACCTACTACGGCAAAAGCTTGAGTTGCGCCTC;

[0054] R6A JF:CTTTTGCCTTCGTTGAATTCCGTAGTAGGTGGTACTGCTGCTGCTCAAGG;

[0055] R6A JR:CCTTGAGCAGCAGCAGTACCACCTACTACGAATTCAACGAAGGCAAAAG;

[0056] R17A JF:CATTCATGGTTGCTCTTTCTATGGGCTGTGGTG:

[0057] R17A JR:CCACCACAGCCCATAGAAAGAGCAACCATGAATG;

[0058] K64A JF:ATCTTCTTCTGCTGTTGCTGTTAAATCTACTA;

[0059] K64A JR:TAGTAGATTTAACAGCAACAGCAGAAGAAGAT:

[0060] K66A JF:TCTGCTGTTAAAGTTGCTTCTACTAAAGTTTTA:

[0061] K66A JR:TAAAACTTTAGTAGAAGCAACTTTAACAGCAGA;

[0062] K69A JF:AGTTAAATCTACTGCTGTTTTACAAGCTCCAG;

[0063] K69A JR:CTGGAGCTTGTAAAACAGCAGTAGATTTAACT;

[0064] K79A JF:CAGGTTACAACGGTGCTGGTAAAGATTGGGCT;

[0065] K79A JR:AGCCCAATCTTTACCAGCACCGTTGTAACCTG;

[0066] K81A JF:ACAACGGTAAAGGTGCTGATTGGGCTTTAATT;

[0067] K81A JR:AATTAAAGCCCAATCAGCACCTTTTACCGTTGT;

[0068] K87A JF:ATTGGGCTTTAATTGCTCTTGCTCGTCCAATC;

[0069] K87A JR:GATTGGACGAGCAAGAGCAATTAAAGCCCAAT;

[0070] R90A JF:TAATTAAACTTGCTGCTCCAATCGCTTTACCT;

[0071] R90A JR:AGGTAAAGCGATTGGAGCAGCAAGTTTAATTA;

[0072] K98A JF:CTTTACCTACTCTTGCTATCGCTACTAACACTG;

[0073] K98A JR:CAGTGTTAGTAGCGATAGCAAGAGTAGGTAAAG;

[0074] R119A JF:GTTGGGGTGCTGCTGCTGAAGGTGGTGGACAA;

[0075] R119A JR:TTGTCCACCACCTTCAGCAGCAGCACCCCAAC;

[0076] R126A JF:GTGGTGGACAACAAGCTTACTTACTTAAAGCT;

[0077] R126A JR:AGCTTTAAGTAAGTAAGCTTGTTGTCCACCAC;

[0078] K130A JF:ACAACGTTACTTACTTGCTGCTACTGTTCCTT;

[0079] K130A JR: AAGGAACAGTAGCAGCAAGTAAGTAACGTTGT;

[0080] K142A JF:GATGACGCTACTTGTGCTCAGGCTTACGGATCT;

[0081] K142A JR:AGATCCGTAAGCCTGAGCACAAGTAGCGTCATC;

[0082] R178A JF:GGTGGTCCAATGTTCGCTAAAGATGATACTGG;

[0083] R178A JR: CCAGTATCATCTTTAGCGAACATTGGACCACC;

[0084] K179A JF: GTCCAATGTTCCGTGCTGATGATACTGGTGCT;

[0085] K179A JR:AGCACCAGTATCATCAGCACGGAACATTGGAC;

[0086] R199A JF: GTGAAGGATGTGCTGCTCCAGGTTACCCAG;

[0087] R199A JR: CTGGGTAACCTGGAGCAGCACATCCTTCAC;

[0088] R218A JF: CTGCTGATATCGCTGCTGCTGCTGGTT;

[0089] R218A JR:ACCAGCAGCAGCAGCAGCGATATCAGCAG.

[0090] According to the size of the target fragment to be amplified, the primers for amplifying the target fragment and the vector are flexibly combined. The amplification system and procedure are as follows:

[0091] Table 1 System and steps for target gene amplification and vector linearization

[0092] .

[0093] After amplification, the size of the amplified fragment was confirmed by electrophoresis, and the gel was cut and recovered. The plasmid multimer was constructed according to the following procedure:

[0094] Table 2 Construction system and steps of plasmid multimers

[0095] .

[0096] After amplification, electrophoresis was performed to confirm whether the plasmid multimer was successfully constructed.

[0097] Example 2: Construction of recombinant strains

[0098] Inoculate the Bacillus subtilis SCK6 from the glycerol stock into LB medium, and transfer it to the improved LB medium after it grows to the logarithmic growth phase. Continue to culture for 2 hours, and the resulting bacterial solution is the Bacillus subtilis SCK6 competent cells.

[0099] Pipette 1 μL of the plasmid polymer in Example 1 into the competent cells (100 μL) prepared above, mix gently, and culture the transformation solution in a 37°C shaker for 2 h. After the transformation is completed, pipette a little transformation solution onto a kanamycin-resistant solid LB culture plate, spread it, and culture it in a 37°C incubator for 16 h.

[0100] Pick the transformants with a single colony shape into a sterile EP tube and add 500 μL of LB liquid medium with kanamycin resistance. After culturing for a period of time, take a portion of the bacterial solution into a glycerol tube and store it in a -80℃ refrigerator. The remaining bacterial solution is used for PCR identification.

[0101] Example 3: Fermentation enzyme production and enzyme activity determination

[0102] The alanine mutant strain stored in the glycerol tube of Example 2 was inoculated into the seed culture medium and grown to the logarithmic phase. The mutant bacterial solution was transferred to the fermentation medium in a conical flask. After fermentation for a period of time, the enzyme activity of each mutant was detected, and the alanine mutant with improved enzyme activity was selected for subsequent saturation mutation. The relative enzyme activity of each mutant was calculated with the highest enzyme activity as 100%. The results are shown in FIG. Figure 1 shown.

[0103] Depend on Figure 1 It can be seen that there are 18 potential cleavage sites in Streptomyces trypsin. After alanine scanning of the 18 sites, the changes in the enzyme activities of different mutants are different. The enzyme activities of mutants K66A, K79A, K81A, R90A, R119A, K130A, K178A, R199A and R218A increased, while the enzyme activities of the remaining mutants decreased to varying degrees. Among them, the enzyme activities of mutants K81A and R119A increased most significantly, so the above-mentioned alanine mutants were used as subsequent saturation mutant objects.

[0104] Example 4: Single-site saturation mutation of some autodegradation sites

[0105] The K81A and R119A alanine mutant strains in Example 3 were subjected to saturation mutation, and the amino acids after replacement were the remaining 17 amino acids. The primer design method was the same as in Example 1. After the mutation was completed, the construction, transformation method and enzyme activity detection of the recombinant plasmid were the same as in Examples 1, 2 and 3. The trypsin activity of each mutant was detected, and the relative enzyme activity of each mutant was calculated with the parent protease activity as 100%. The results are shown in Figure 2 and Figure 3 .

[0106] Depend on Figure 2 and Figure 3It can be seen that the enzyme activities of the mutant strains K81Q, K81S, K81P, R119N, R119S, R119Q, R119V, R119H, R119E and R119T are all improved to a certain extent compared with the parent strain, but only the enzyme activities of the saturated mutant strains K81S, R119T and R119E are improved compared with the alanine mutant strain, among which the enzyme activity of one mutant strain K81S is increased by 79.63% compared with the parent strain.

[0107] Example 5: Combinatorial mutations of self-degradation sites

[0108] According to the experimental results of Example 4, mutants K81S, R119E and R119T with improved enzyme activity were selected for combined mutation in order to obtain mutant strains with better enzymatic properties. The mutation method was the same as that of Example 4.

[0109] After further combined mutation, two combined mutant strains with improved enzyme activity (K81S / R119E, K81S / R119T) were obtained. The results showed that compared with the single point mutation, the effect of the combined mutation was additive, and the enzyme activity of the mutants was further improved, reaching 83.28 U / mL and 93.87 U / mL, respectively. Compared with the parent strain, the enzyme activity of the combined mutation was increased by 2.40 times and 3.16 times, respectively; compared with the single point mutant K81S strain, the enzyme activity of the combined mutation was further increased by 55.85% and 75.7%, respectively.

[0110] Example 6: Fermentation and enzyme purification

[0111] The mutants with excellent properties obtained in Example 4 and Example 5 were inoculated into the seed culture medium, grown to the logarithmic phase, and then transferred to the fermentation medium for fermentation and enzyme production. After 36 hours of fermentation, the supernatant was collected by centrifugation, filtered through a 0.22 μm filter membrane, and then stored.

[0112] Cleaning the column: Use 6 M guanidine hydrochloride to clean the affinity column filled with anisole. After the UV signal stabilizes, rinse the guanidine hydrochloride with up water.

[0113] Equilibrate the column: Equilibrate the column with equilibration buffer (50 mM Tris-HCl, 0.5 M NaCl, pH 7.5) for at least 10 column volumes.

[0114] Loading: After the packing column is balanced, the crude fermentation enzyme liquid after filtration is loaded into the protein purification instrument. After loading, the column is rinsed with the balance solution to wash away the unbound protein.

[0115] Collect protein: After the column is flushed with the balance solution until the UV signal is stable, the column is flushed with the eluent (10 mM HCl, 0.5M NaCl, pH 2.0) to collect the target protein. When the UV signal of the UV detector begins to rise, the target protein is collected, which is the purified target protein.

[0116] Example 7: Determination of enzyme reaction kinetic parameters

[0117] A series of BAPNA substrate solutions of different concentrations were prepared. According to the aforementioned trypsin activity detection method, the enzyme purification solution of appropriate concentration was mixed with substrate solutions of different gradients, and then the increase in the absorbance of the enzyme within a certain period of time was measured to calculate the reaction rate of the enzyme under substrate solutions of different concentrations. Referring to the Michaelis–Menten curve model, nonlinear fitting was performed with different substrate concentrations as the horizontal axis and the reaction rate under different substrate concentrations as the vertical axis, and finally the kinetic parameters Kcat, Km and Kcat / Km value of the enzyme were obtained.

[0118] The specific enzymatic activities and kinetic parameters of a series of mutants were determined. From the perspective of specific enzymatic activities, the specific enzymatic activities of each mutant were 3.40 times, 2.53 times, 2.12 times, 2.66 times and 2.28 times that of the parent trypsin, respectively. From the perspective of kinetic parameters, the Kcat / Km of each mutant was 2.93 times, 1.60 times, 1.79 times, 2.67 times and 3.09 times that of the parent trypsin, respectively. It can be seen that the enzymatic properties of the mutations have been greatly improved. The specific results are shown in Table 3.

[0119] Table 3

[0120] .

[0121] Example 8: Optimization of fermentation enzyme production conditions

[0122] In order to better ferment and produce enzymes, a series of optimizations were carried out on the fermentation carbon source (glycerol, maltose, glucose, lactose, starch, fructose, malt extract powder, mannitol, yeast extract powder, oat and corn starch), carbon source concentration, nitrogen source (peptone, tryptone, soy peptone, corn steep liquor, cottonseed meal, soybean cake powder and casein peptone), nitrogen source concentration and pH (4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0).

[0123] The optimization results showed that the optimal carbon source and nitrogen source were starch and corn pulp, with the optimal concentrations of 3% and 2.5%, respectively. The optimal initial pH of the culture medium for fermentation was 7.0. After 72 hours of fermentation under the above optimized conditions, the amidase activity of the mutant strain K81S / R119T could reach 132.8 U / mL.

[0124] Although the present invention has been disclosed as above in terms of preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various changes, modifications, substitutions and variations in form and details to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. A Streptomyces trypsin autocleavage site mutant, characterized in that: The trypsin amino acid sequence shown in SEQ ID NO.1 is used as a parent, and the lysine at the 81st amino acid position of the parent is mutated into serine, and the arginine at the 119th amino acid position is mutated into glutamic acid or threonine.

2. A gene encoding the Streptomyces trypsin auto-cleavage site mutant according to claim 1.

3. A recombinant plasmid carrying the gene according to claim 2.

4. The recombinant plasmid according to claim 3, characterized in that The recombinant plasmid vector is puc980.

5. A host bacteria expressing the recombinant plasmid according to claim 3 or 4.

6. The host bacteria according to claim 5, characterized in that The host bacteria is Bacillus subtilis ( Bacillus subtilis )SCK6.

7. A method for preparing the Streptomyces trypsin auto-cleavage site mutant according to claim 1, characterized in that: The following steps are involved: The arginine and lysine in the trypsin amino acid sequence shown in SEQ ID NO.1 were mutated into alanine, and mutants with improved enzyme activity were screened. The selected mutation sites were further subjected to saturation mutation, and mutants with further improved enzyme activity were screened. Finally, combined mutations between different sites were performed to screen mutants with high enzyme activity.

8. Application of the Streptomyces trypsin auto-cleavage site mutant according to claim 1 in the fields of food, medicine, biochemistry and chemical industry. The application in the field of medicine is a non-disease diagnosis and treatment method.

9. The use according to claim 8, characterized in that The streptomyces trypsin self-cleavage site mutant is used for cutting the carboxyl end of arginine or lysine in the peptide chain.

10. An enzyme preparation, characterized in that The invention comprises the streptomyces trypsin self-cleavage site mutant according to claim 1.

Images