Use of the CCT5 gene or its encoded protein in regulating plant growth

Abstract

The present invention discloses CCT5 the use of a gene or its encoded protein in regulating plant growth. Through GWAS analysis, the present invention finds a gene SiCCT5 related to mesocotyl development from the core germplasm resources of foxtail millet, and overexpresses this gene in rice, demonstrating that the SiCCT5 gene of foxtail millet has the function of regulating mesocotyl development in rice. The present invention further determines SiCCT5 the homologous gene OsCCT5 of the gene in rice and overexpresses the OsCCT5 gene in rice. Overexpression of the OsCCT5 gene in Nipponbare rice shows phenotypes such as an increase in the length of the plant mesocotyl, the height of the seedlings during direct seeding of plant seeds, and the germination rate, demonstrating that the OsCCT5 gene of rice has the function of positively regulating the growth during direct seeding of plants. The present invention has application prospects in regulating plant growth and breeding plant varieties.

Description

Technical Field

[0001] The present invention relates to growth-related genes isolated from Gramineae plants and their uses, in particular to the uses of genes or their encoded proteins isolated from Gramineae plants in regulating plant growth, belonging to CCT5 the field of genes and their uses. CCT5 Background Art

[0002] Direct seeding of rice refers to a cultivation method in which rice seeds are directly sown in the field without seedling raising and transplanting. Compared with the traditional seedling raising and transplanting, direct seeding has significant advantages, that is, the direct seeding method can save a large amount of labor and time costs, reduce the spread of pests and diseases, and contribute to increasing the yield.

[0003] The mesocotyl is an important structure in the germ part of rice seeds, which is directly related to the germination and early growth of rice. During the direct seeding process of rice, the development status of the mesocotyl plays a crucial role in the germination of seeds and the growth of seedlings. Under direct seeding conditions, the germination of seeds requires good environmental conditions, and the normal development of the mesocotyl is one of the key factors to ensure germination. When the mesocotyl develops well, it can break through the soil faster and unfold the primary leaves, promoting the growth and development of the seedling stage. Therefore, optimizing the developmental characteristics of the mesocotyl, such as increasing the length of the mesocotyl, is one of the important ways to improve the production efficiency of direct-seeded rice. At the same time, studying the physiological characteristics of the mesocotyl can provide a theoretical basis for selecting rice varieties suitable for direct seeding, and promote the further application and popularization of rice direct seeding technology.

[0004] CCT5 The T-complex protein encoded by the gene, as a newly discovered regulatory protein, plays a key role in plant embryonic development, cell division and differentiation by regulating signal transduction pathways related to plant hormones. Exploring its functions in plant growth and development, as well as the molecular mechanism regulating mesocotyl elongation, has great potential application value in cultivating high-yield and economical direct-seeded rice. Summary of the Invention

[0005] The main object of the present invention is to apply CCT5 the gene, the CCT5 protein, the expression cassette containing CCT5 the gene or the recombinant plant expression vector containing CCT5 the gene to regulating plant growth.

[0006] To achieve the above object, the main technical solutions adopted by the present invention include:

[0007] One aspect of the present invention is to apply CCT5 the gene, the CCT5 protein, the expression cassette containing CCT5 the gene or the recombinant plant expression vector containing CCT5 ​The recombinant plant expression vector of the gene is applied to regulate plant growth.

[0008] In a preferred specific embodiment of the present invention, the plant is a gramineous plant.

[0009] In a preferred specific embodiment of the present invention, the regulation of plant growth is to promote the growth of rice; wherein, the promotion of rice growth includes increasing the length of the mesocotyl of rice, increasing the germination rate during direct seeding of rice seeds or the height of rice seedlings.

[0010] As a reference, the present invention provides an embodiment. That is, by overexpressing the coding gene of the CCT5 protein related to plant growth in the plant, the expression level or activity of the CCT5 protein related to plant growth is increased, thereby promoting plant growth, and further increasing the height of plant seedlings, increasing the length of the mesocotyl of the plant, and increasing the germination rate during direct seeding of plant seeds.

[0011] In a preferred specific embodiment of the present invention, a method for cultivating a direct-seeding tolerant rice variety includes: overexpressing CCT5 the gene in rice to CCT5 enhance the expression level of the gene or enhance the function or activity of the CCT5 protein; for example, connecting the SiCCT5 gene derived from Setaria italica or the OsCCT5 gene derived from rice with an expression regulatory element to obtain a recombinant plant expression vector for expressing the gene in plants; transforming the recombinant plant expression vector into rice to CCT5 overexpress the gene in rice, and the direct-seeding tolerance of the obtained transgenic rice is improved, including: increasing the length of the mesocotyl of rice, increasing the germination rate during direct seeding of rice seeds or the seedling height.

[0012] As a reference, the present invention provides a CCT5 gene plant recombinant expression vector, including: connecting the SiCCT5 gene derived from Setaria italica or the OsCCT5 gene derived from rice with an expression regulatory element to obtain a recombinant plant expression vector; the recombinant plant expression vector can be composed of a 5′-untranslated region, the nucleotide shown in SEQ ID NO.2 or the nucleotide shown in SEQ ID NO.4 and a 3′-untranslated region; wherein, the 5′-untranslated region may include a promoter sequence, an enhancer sequence or / and a translation enhancer sequence; the promoter may be a constitutive promoter, an inducible promoter, a tissue- or organ-specific promoter; the 3′-untranslated region may contain a terminator sequence, an mRNA cleavage sequence, etc. A suitable terminator sequence can be taken from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase termination regions.

[0013] The recombinant plant expression vector may also contain a selectable marker gene for selecting transformed cells, which is used to select transformed cells or tissues. The marker genes include: genes encoding antibiotic resistance and genes conferring resistance to herbicidal compounds, etc. In addition, the marker genes also include phenotypic markers, such as β-galactosidase and fluorescent proteins, etc.

[0014] The transformation protocol and the protocol for introducing the polynucleotide or polypeptide into the plant may vary depending on the type of plant or plant cell to be transformed. Suitable methods for introducing the polynucleotide into plant cells include: microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high-velocity ballistic bombardment, etc. In a specific embodiment, various transient transformation methods can be used to provide the SiCCT5 gene of Setaria italica or the OsCCT5 gene of rice to the plant. Transformed cells can be regenerated into stable transformed plants using conventional methods (McCormick et al. Plant Cell Reports. 1986. 5:81-84).

[0015] In a preferred specific embodiment of the present invention, the gramineous plant is rice.

[0016] Another aspect of the present invention is to provide a CCT5 gene capable of regulating plant growth and its protein, which are derived from Setaria italica or rice.

[0017] In a preferred specific embodiment of the present invention, the CCT5 gene is the OsCCT5 gene with the nucleotide sequence shown in SEQ ID NO.2 or the SiCCT5 gene with the nucleotide sequence shown in SEQ ID NO.4.

[0018] In addition, those skilled in the art can also optimize the nucleotides shown in SEQ ID NO.2 and SEQ ID NO.4 to enhance the expression efficiency in plants.

[0019] Those of ordinary skill in the art can easily use known methods, such as directed evolution or point mutation methods, to mutate the CCT5 nucleotide sequence of the gene. Those artificially modified nucleotides having 75% or higher identity with the CCT5 nucleotide sequence of the gene, as long as the encoded protein has the function of regulating plant growth, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0020] In addition, the nucleotide sequence described in the present invention may be DNA, such as cDNA, genomic DNA or recombinant DNA; it may also be RNA, such as mRNA or hnRNA, etc.

[0021] In a preferred specific embodiment of the present invention, the plant is a gramineous plant.

[0022] In a preferred specific embodiment of the present invention, the CCT5 protein is a protein having 94% or more identity with the amino acid sequence shown in SEQ ID NO.1, and this protein still has the function or activity of regulating plant growth.

[0023] The percentage of sequence identity described in the present invention can be obtained by well-known bioinformatics algorithms, including the Myers and Miller algorithms, the Needleman-Wunsch global alignment method, the Smith-Waterman local alignment method, the Pearson and Lipman similarity search method, and the algorithm of Karlin and Altschul, which are well-known to those skilled in the art.

[0024] In a preferred specific embodiment of the present invention, the CCT5 protein is the OsCCT5 protein with the amino acid sequence shown in SEQ ID NO.1 or the SiCCT5 protein with the amino acid sequence shown in SEQ ID NO.3.

[0025] The present invention uses GWAS to analyze the genes regulating the development of the mesocotyl in foxtail millet, clones the SiCCT5 gene, and by overexpressing the SiCCT5 gene in Nipponbare rice, it is proved that the SiCCT5 gene in foxtail millet has the function of regulating the development of the mesocotyl in rice. On this basis, the present invention further conducts sequence alignment and phylogenetic analysis to determine the homologous protein OsCCT5 protein of the SiCCT5 protein in foxtail millet in rice. By overexpressing the OsCCT5 gene and overexpressing the OsCCT5 gene in Nipponbare rice, the Nipponbare rice shows an increase in the length of the mesocotyl, an increase in the height and germination rate of the seedlings during direct seeding of rice seeds, that is, the growth performance during direct seeding is significantly improved, proving that the OsCCT5 gene in rice has the function of positively regulating the growth performance of plants during direct seeding. The present invention further analyzes through databases and analysis software to obtain the OsCCT5 gene and the excellent haplotype related to the elongation of the mesocotyl in plants, that is, haplotype B, indicating that this haplotype has the application potential for cultivating new varieties of direct-seeding rice suitable for cultivation.

[0026] Term definitions involved in the present invention

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0028] The terms "polynucleotide" or "nucleotide" mean deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides in single-stranded or double-stranded form, and their polymers. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs (such as phosphorothioates, phosphoroamidates, etc.) used in antisense technology. Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (including, but not limited to, degenerate codon substitutions) and complementary sequences, as well as the explicitly specified sequences. Specifically, degenerate codon substitutions can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is substituted with a mixture of bases and / or deoxyinosine residues.

[0029] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, a description of a polypeptide applies equally to a description of a peptide and a description of a protein, and vice versa. The term applies to both naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked by covalent peptide bonds.

[0030] The term "recombinant host cell line" or "host cell" means a cell that contains the polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide can be maintained as a non-integrated vector, such as a plasmid, or can be integrated into the host genome. The host cell can be a prokaryotic cell or a eukaryotic cell, and the host cell can also be a monocotyledonous or dicotyledonous plant cell.

[0031] The term "operably linked" refers to a functional connection between two or more elements, and the elements that are operably linked can be adjacent or non-adjacent.

[0032] The term "recombinant plant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, together with vectors having helper plasmids, are most commonly used for Agrobacterium tumefaciens-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selectable markers engineered to be able to express in plant cells, heterologous DNA sequences to be transcribed, etc.

[0033] The term "transformation" refers to a method of introducing a heterologous DNA sequence into a host cell or organism.

[0034] The term "expression" refers to the transcription and / or translation of an endogenous gene or transgene in a plant cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 for foxtail millet SiCCT5 cloning and functional verification of the gene; wherein, Figure 1 -A is a Manhattan plot of the GWAS analysis results; Figure 1 -B is a quantile plot (QQ plot) for detecting whether the p-values observed in the GWAS analysis conform to the expected distribution; Figure 1 -C is a schematic diagram of the constructed pCam23A-SiCCT5 vector; Figure 1 -D is for wild type WT and overexpression SiCCT5 gene in rice lines SiCCT5 gene expression level detection results; Figure 1 -E is for wild type rice WT and overexpression SiCCT5 gene in rice lines after culturing for 7 days in continuous darkness, the mesocotyl is the part between the arrow and the seed, and the arrow indicates the coleoptile node; Figure 1 -F is the statistical analysis result of the mesocotyl length of wild type rice WT and overexpression SiCCT5 gene in rice lines after culturing for 7 days in continuous darkness; Figure 1 -G is the longitudinal section of the mesocotyl of wild type rice WT and overexpression SiCCT5 gene in rice lines; Figure 1 -H is the statistical analysis data of the cell length of the mesocotyl of wild type rice WT and overexpression SiCCT5 gene in rice lines;

[0036] Figure 2 is a phylogenetic tree constructed based on the foxtail millet SiCCT5 protein sequence;

[0037] Figure 3 is for wild type rice WT and overexpression OsCCT5 gene in rice lines for phenotypic analysis; wherein, Figure 3-A is a schematic diagram of the constructed pCam23A-OsCCT5 vector; Figure 3 -B is the detection result of the expression level of the OsCCT5 gene in wild-type rice WT and rice lines overexpressing the OsCCT5 gene; Figure 3 -C is the result diagram of the mesocotyl length of wild-type rice WT and rice lines overexpressing the OsCCT5 gene after being cultured in continuous darkness for 7 days. The arrow indicates the coleoptile node, and the mesocotyl is the part between the arrow and the seed; Figure 3 -D is the statistical analysis result of the mesocotyl length of wild-type rice WT and rice lines overexpressing the OsCCT5 gene after being cultured in continuous darkness for 7 days; Figure 3 -E is the longitudinal section of the mesocotyl of wild-type rice WT and rice lines overexpressing the OsCCT5 gene; Figure 3 -F is the statistical analysis data of the mesocotyl cell length of wild-type rice WT and rice lines overexpressing the OsCCT5 gene; Figure 3 -G is the germination test diagram of wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 planted 2 cm deep in the soil respectively; Figure 3 -H is the observation result of the mesocotyl of the seedlings in the germination test of wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 planted 2 cm deep in the soil. The arrow indicates the coleoptile node, and the mesocotyl is the part between the arrow and the seed; Figure 3 -I is the statistical analysis result of the germination rate in the germination test of wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 planted 2 cm deep in the soil, where 1-9D represents 1-9 days after sowing; Figure 3 -J is the germination test diagram of wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 planted 5 cm deep in the soil respectively; Figure 3 -K is the observation result of the mesocotyl of the seedlings in the germination test of wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 planted 5 cm deep in the soil. The arrow indicates the coleoptile node, and the mesocotyl is the part between the arrow and the seed; Figure 3 -L is the statistical analysis result of the germination rate in the germination test of wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 planted 5 cm deep in the soil, where 1-9D represents 1-9 days after sowing;

[0038] Figure 4 is the haplotype analysis of the OsCCT5 gene; among them, Figure 4-A represents the 5 haplotypes analyzed. SNP is the abbreviation of single nucleotide polymorphism, indicating a single base substitution. The red ones are the bases or amino acids that have changed compared to haplotype A. The amino acids corresponding to the SNPs and the numbers in parentheses indicate the positions. Figure 4 -B represents the information on the sample numbers and subspecies types of the 5 haplotypes. Figure 4 -C represents the significant analysis results of the hypocotyl lengths of 510 germplasm resources and 5 haplotypes. n represents the number of germplasm resources with this haplotype. Specific implementation manners

[0039] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, it should be understood that the described embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that the details and forms of the technical solutions of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements all fall within the protection scope of the present invention.

[0040] Vectors, strains and experimental materials

[0041] The pCam23A vector is preserved by the Biotechnology Research Institute of the Chinese Academy of Agricultural Sciences; Agrobacterium tumefaciens AGL1 is purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd., product number ZK296; the wild-type rice is Nipponbare rice ( Oryza sativa L.ssp. Japonica variety Nipponbare ; hereinafter also referred to as wild-type rice WT), and is preserved by the Crop High Photosynthetic Efficiency Functional Genomics Team of the Biotechnology Research Institute of the Chinese Academy of Agricultural Sciences.

[0042] Experimental reagents

[0043] The primers used for PCR are synthesized by Beijing Tsingke Biotechnology Co., Ltd., and the sequencing is completed by Beijing Tsingke Biotechnology Co., Ltd. Restriction enzymes Sma I and Xba I, Infusion recombinase, and high-fidelity enzyme are all purchased from Beijing Liuhetong Trading Co., Ltd. (TaKaRa); antibiotics are purchased from SIGMA Company of the United States; the rest of the reagents are all domestic analytical pure.

[0044] The reagent formulas used in the experimental process are as follows:

[0045] 2,4-D (2 mg / mL): First, dissolve 2,4-D in a microwave oven using 5 mL - 10 mL of 1 N KOH, and then add ultrapure water to make up the volume. Store at room temperature.

[0046] 6 - BA (3 mg / mL): Weigh 150 mg of 6 - BA, first dissolve it with 5 mL of 1 N KOH, and then make up the volume to 50 mL with sterile water. Filter sterilize.

[0047] Tim of Temeiting (200 mg / mL): Dissolve 2 g of Tim of Temeiting with sterile water and make up the volume to 10 mL, then filter sterilize.

[0048] G418 (150 mg / mL): Dissolve it with sterile water, make up the volume, and filter sterilize.

[0049] Rifampicin Rif (25 mg / mL): First dissolve 0.5 g of rifampicin (Rif) with 1 N NaOH, and then make up the volume to 10 mL with methanol; or directly make up the volume to 10 mL with DMSO, then filter sterilize. Store at -20 °C, and the working concentration is 25 μg / mL.

[0050] Kanamycin (50 mg / mL): Weigh 0.5 g of kanamycin sulfate powder, add 10 mL of ultrapure water to dissolve and filter sterilize, and the working concentration is 50 μg / mL.

[0051] Data processing

[0052] Use GraphPad Prism 8 statistical software to process the data. For the significance analysis of a set of data, use the Student's t - test. P < 0.05 (*) indicates significant difference, P < 0.01 (**), P < 0.001 (***), P < 0.0001 (****) indicate extremely significant differences. The significance difference analysis of multiple groups of data is determined by one - way analysis of variance (ANOVA) and Tukey's multiple comparison test. In the results, label the largest average with the letter a. If the second group of data has a significant difference, label it b, and if there is no significant difference, label it a, and so on.

[0053] Experimental Example 1 Foxtail millet SiCCT5 Experiment on gene cloning and function analysis

[0054] 1 Use the core germplasm resources of foxtail millet to conduct GWAS analysis on mesocotyl development

[0055] Germinate 637 foxtail millet germplasm resources in the dark, and separately count the mesocotyl lengths. Combine the genomic variation data and use GWAS to analyze the genes regulating mesocotyl development in foxtail millet. The results of the GWAS analysis are as Figure 1 shown in - A. The blue dotted line in the Manhattan plot represents the genome - wide significance threshold (P = 9.50×10 -6 ), and the results show that there is a P - value lower than 9.50×10 -6The main SNP associated locus (the position indicated by the red triangle), and there is a significant association signal ( Figure 1 -B), through further bioinformatics analysis and verification, the SiCCT5 gene (Seita.2G010200) located in this interval was cloned.

[0056] The amino acid sequence of the SiCCT5 protein is as follows: MALAFDEFGRPFIILREQEQKTRLRGLDAQKANIAAGKAVARILRTSLGPKGMDKMLQSPDGDVTITNDGATILEQMDVDNQIAKLMVELSRSQDYEIGDGTTGVVVMAGALLEQAEKLLERGIHPIRVAEGYEMASRIASEHLERISHKYEFTADNIEPLVQTCMTTLSSKIVNRCKRALAEIAVKAVLAVADLERKDVNLDLIKVEGKVGGKLEDTELIYGIVVDKDMSHPQMPKRIEDAKIAILTCPFEPPKPKTKHKVDIDTVEKFQTLREQEQKYFDEMVQKCKDAGATLVICQWGFDDEANHLLMNRNLPAVRWVGGVELELIAIATGGRIVPRFEELSPEKLGKAGLVREKSFGTTKDRMLYIEQCANSRAVTIFIRGGNKMMIEETKRSLHDALCVARNLIRNNSIVYGGGSAEISCSIAVETAADRHPGVEQYAIRSFADALDAVPLALAENSGLPPIDTLTAVKAQQVKESNPHCGIDCNDVGTNDMKEQNVFETLIGKQQQILLATQVVKMILKIDDVISPSEY (SEQ ID NO.3).

[0057] SiCCT5

[0058] 2 Extraction and Reverse Transcription of Foxtail Millet RNA

[0059] RNA Extraction: The total RNA of foxtail millet was extracted using the RNA prep pure plant kit (Cat. No. DP432) from Tiangen Biochemical Technology (Beijing) Co., Ltd. The tissue samples used for RNA extraction were quickly placed in tin foil after sampling in the field, frozen in liquid nitrogen, and then brought back to the Beijing laboratory for RNA extraction. The specific steps for RNA extraction are shown in the instruction manual.

[0060] RNA Reverse Transcription: The FastKing cDNA First Strand Synthesis Kit (Genomic DNA Removal) (Cat. No. KR116) from Tiangen Biochemical Technology (Beijing) Co., Ltd. was used for operation according to the instruction manual. The specific method is as follows:

[0061] A 20 μL reaction system can be established with 50 ng - 2 μg total RNA. Thaw the template RNA on ice; thaw 5×gDNA Buffer, FQ-RT Primer Mix, 10×King RT Buffer, and RNase-Free ddH 2 O at room temperature and quickly place them on ice after thawing. Vortex and mix each solution well before use and briefly centrifuge to collect the liquid remaining on the tube wall. The following operation steps need to be carried out on ice.

[0062] The gDNA removal reaction system is 2 μL of 5×gDNA Buffer; 50 ng - 2 μg of RNA; RNase-Free ddH 2 O to make up to 10 μL. Incubate at 42°C for 3 min, then place on ice.

[0063] The reverse transcription reaction system is 2 μL of 10×King RT Buffer; 1 μL of FastKing RT Enzyme Mix; 2 μL of FQ-RT Primer Mix; RNase-Free ddH 2 O to make up to 10 μL.

[0064] Add the Mix in the reverse transcription reaction to the reaction solution in the gDNA removal step and mix well. Incubate at 42°C for 15 min. Incubate at 95°C for 3 min and then place on ice. The obtained cDNA can be used for subsequent experiments or stored at low temperature.

[0065] 3 SiCCT5 Construction of Gene Overexpression Vector

[0066] The primers SiCCT5-CDS-F and SiCCT5-CDS-R were designed using the primer design software DNAMAN. The specific nucleotide sequences of SiCCT5-CDS-F / R are as follows:

[0067] SiCCT5-CDS-F: TTGTAGGTAGAAGAGGTACCCGGGATGGCGCTCGCCTTCGATGA (SEQ ID NO.5);

[0068] SiCCT5-CDS-R: GCATGCCTGCAGGTCGACTCTAGATCAGTATTCGGATGGTGAGA (SEQ ID NO.6).

[0069] Using the obtained cDNA as a template, SiCCT5-CDS-F and SiCCT5-CDS-R as primers, the high-fidelity enzyme PrimeSTAR HS DNA Polymerase with GC Buffer (TaKaRa product number: R044A) purchased from Beijing Liuhetong Economic and Trade Co., Ltd. was used for PCR amplification to obtain a PCR product.

[0070] The obtained PCR product was separated by agarose gel electrophoresis, the gel was cut, and the gel was recovered. The recovered product was recombined with the pCam23A vector digested with Sma I and Xba I using the recombinase In-Fusion Snap Assembly Master Mix (TaKaRa product number: 638948). After sequencing, the recombinant vector pCam23A-SiCCT5 was obtained by replacing the nucleotides of the CDS sequence of the SiCCT5 gene with the Sma I and Xba I sites of the pCam23A vector ( Figure 1 -C). The arrow in the figure indicates the SiCCT5 gene sequence.

[0071] 4 Overexpression SiCCT5 Preparation of the Nipponbare rice line overexpressing the

[0072] The prepared recombinant vector pCam23A-SiCCT5 was introduced into Agrobacterium tumefaciens AGL1 to obtain the recombinant bacterium AGL1 / pCam23A-SiCCT5. After enzymatic digestion verification, a positive recombinant bacterium was obtained.

[0073] The recombinant bacterium AGL1 / pCam23A-SiCCT5 was transformed into Nipponbare rice by rice genetic transformation to obtain T 0The overexpressing SiCCT5 gene Nipponbare rice line. The specific operation steps are as follows:

[0074] (1)Seed sterilization and callus induction stage: Shell the mature seeds, select 300 plump and intact shelled rice seeds and put them into a 50 mL sterilized centrifuge tube. Wash the seeds three times with sterilized ultrapure water. Then surface sterilize with 40 mL of 75% ethanol for 5 min, sterilize with 40 mL of 50% sodium hypochlorite for 5 min, repeat the sterilization once, and finally wash with sterile water 10 times until the water is clear. Blot the sterilized seeds dry with sterile filter paper and place them on the induction medium, 20 seeds per dish. Culture in the dark at 28°C for 28 days until calli the size of shed millet grains grow out.

[0075] (2)Subculture and pre-culture of calli: Transfer the good-quality embryogenic calli to the MS medium. About 100 calli can be placed in each dish. Culture in the dark at 28°C for 7 days. The selected calli can be put back for continuous culture. About 3-4 times of selection can be carried out for one batch of induction. At the same time, the large pieces of unshed calli can be placed on a new MS medium to make them shed again and then be selected again.

[0076] (3)Preparation of Agrobacterium: One day in advance, plate and culture Agrobacterium on the YEP medium (or LB medium) added with the corresponding screening resistance, kanamycin (50 mg / mL) and rifampicin (25 mg / mL); Scrape the Agrobacterium colonies on the original culture dish with a spreading rod and evenly smear them on the new medium. If it is a bacterial solution, pour the bacterial solution into the medium, a small amount is enough, and smear it evenly with a spreading rod. Mark the carrier number well and place it upside down in an incubator at 28°C overnight.

[0077] It is not necessary to go through the activation treatment. The transferred colonies can be directly cultured for 4-5 days. Before shaking the bacteria, use a sterilized spoon to smear all the colonies evenly, and then scrape an appropriate amount of bacteria for shaking. The bacteria stored at 4°C must be activated.

[0078] (4)OD value adjustment: Scrape off the Agrobacterium with a key, put the bacteria into the AAM liquid medium, and culture with a shaker at 28°C and 200 rpm for 2 h. Then adjust the OD value of the bacterial solution to 0.12-0.15 with the AAM liquid medium.

[0079] (5)Infection and co-culture: Collect about 100 embryogenic calli into a 100 mL Erlenmeyer flask; Pour the adjusted-concentration Agrobacterium into the conical flask for infection, and shake with a shaker at 100 g for 20 min. After shaking, pour out the infection solution, blot the calli dry with filter paper, transfer the infected calli to the co-culture medium, cover with sterile filter paper to ensure that all the calli come into contact with the filter paper surface. Culture in the dark at 22°C for 4 d.

[0080] (6)Resistance screening of transformed callus: Collect the callus that has completed the co-culture stage into a 50 mL sterilized centrifuge tube, and rinse the callus 10 times with sterile water until the washing liquid is clear. Then pour it into the suspension medium, add 1 mL of Tim washing liquid with a concentration of 200 mg / mL, shake it on a shaker at 100 g for 1 h. After shaking, pour out the filtrate and blot the moisture with filter paper. Transfer the callus to the selection medium, and use forceps to evenly place the callus particles to prevent contact inhibition and large-area contamination. Screening with 2 - 3 plates for one vector is sufficient. Incubate in the dark at 28 °C for 2 weeks, and this process is the first screening. Pay attention to observing whether there is any contamination during this period. After two weeks, subculture it once on the same medium, doubling the number of screening medium plates, and 4 - 6 plates for each vector are sufficient. Select for about 4 weeks in total. This process is the second screening. Wait until obvious yellow round solid particles the size of millet grains fall off from the callus to proceed to the next stage.

[0081] (7)Differentiation and rooting: Pick the white and dense callus and transfer it to the differentiation medium. Before using the differentiation medium, make sure to dry the water vapor. 20 pieces can be inoculated in each plate, and pay attention not to place them on the edge of the culture dish as much as possible, as it is easy to come into contact with water. Incubate under light at 28 °C for 3 - 4 weeks. Pay attention to placing the materials layer by layer. Prevent high temperature from burning the callus due to heat generated by the light under the materials, which affects the differentiation ability. It is best to place it on the bottom layer of the tissue culture room shelf to prevent the generation of water vapor and affect the differentiation of the callus. Then subculture it once on the same medium, pay attention to handling it gently to prevent the water droplets on the lid from dripping onto the callus, and the callus that comes into contact with water will no longer differentiate. The callus just subcultured onto the differentiation medium needs to be placed for two days or covered with a black plastic bag for shading treatment to prevent the callus from overheating and browning.

[0082] (8)Seedling strengthening: If relatively strong seedlings appear, transfer them to the 1 / 2 MS seedling strengthening medium. Incubate under light at 28 °C for 2 - 3 weeks. The seedlings just transferred to the seedling strengthening medium should be placed for two days before light treatment.

[0083] (9)Transplanting of tissue culture seedlings: Wash the residual medium on the roots, and transfer the seedlings with good roots to the greenhouse, keeping the soil moist in the first few days.

[0084] (10)Overexpression SiCCT5 Creation of transgenic rice T 1 generation lines: Transfer the constructed SiCCT5 gene overexpression vector into wild-type Nipponbare rice through Agrobacterium to obtain multiple SiCCT5 gene overexpression T 0 generation lines in Nipponbare rice. Self-cross the T 0 generation plants to obtain the T 1 generation SiCCT5For gene overexpression plants, SiCCT5-OE#1 and SiCCT5-OE#2 were randomly selected and used for subsequent analysis.

[0085] (11) The formulations of the media used are as follows:

[0086] N6 medium: The solutes are potassium nitrate 2830 g / L, ammonium sulfate 463 g / L, calcium chloride (CaCl 2 ·2H 2 O) 166 g / L, magnesium sulfate (MgSO 4 ·7H 2 O) 185 g / L, potassium dihydrogen phosphate 400 g / L, ferrous sulfate (FeSO 4 ·7H 2 O) 27.8 g / L, manganese sulfate (MnSO 4 ·H 2 O) 4.4 g / L, zinc sulfate (ZnSO 4 ·7H 2 O) 1.6 g / L, boric acid 0.8 g / L, potassium iodide 1.6 g / L, vitamin B1 (thiamine hydrochloride) 1.0 g / L, vitamin B6 (pyridoxine hydrochloride) 0.5 g / L, nicotinic acid 0.5 g / L, glycine 2.0 g / L, and the solvent is deionized water.

[0087] Induction medium: Based on the N6 medium, add 2,4-D at a final concentration of 2.5 mg / L, casein hydrolysate 0.8 g / L, proline 0.3 g / L, sucrose 30 g / L, and phytagel 3 g / L.

[0088] Suspension medium: Based on the N6 medium, add 2,4-D at a final concentration of 2.5 mg / L, casein hydrolysate 0.8 g / L, proline 0.3 g / L, sucrose 30 g / L, glucose 10 g / L, and acetosyringone 100 μM.

[0089] Co-culture medium: Based on the N6 medium, add 2,4-D at a final concentration of 2.5 mg / L, proline 0.3 g / L, sucrose 30 g / L, glucose 10 g / L, acetosyringone 100 μM, and agar powder 8 g / L.

[0090] Selection medium: Based on the N6 medium, add 2,4-D at a final concentration of 2.5 mg / L, proline 0.3 g / L, G418 50 mg / L, ticarcillin 200 mg / L, sucrose 30 g / L, and agar powder 8 g / L.

[0091] MS medium: The solute is CaCl2 ·2H 2 O 440 mg / L, KH 2 PO 4 170 mg / L, MgSO 4 ·7H 2 O 370 mg / L, NH 4 NO 3 1650 mg / L, KNO 3 1900 mg / L, KI 0.83 mg / L, CoCl 2 ·6H 2 O 0.025 mg / L, H 3 BO 4 6.2mg / L, Na 2 MoO 4 ·7H 2 O 0.25 mg / L, MnSO 4 ·4H 2 O 22.3 mg / L, CuSO 4 ·5H 2 O 0.025 mg / L, ZnSO 4 ·7H 2 O 8.6 mg / L, FeSO 4 ·7H 2 O 27.8 mg / L, Na 2 EDTA 37.3 mg / L, thiamine hydrochloride 0.1 mg / L, pyridoxine hydrochloride 0.5mg / L, nicotinic acid 0.5 mg / L, inositol 100 mg / L, glycine 2.0 mg / L, sucrose 30000mg / L, agar powder 7000 mg / L, with the balance being deionized water.

[0092] 1 / 2MS medium: The final concentration of solutes in MS is halved.

[0093] Differentiation medium: On the basis of MS medium, add 2 mg / L KT, 0.2 mg / L NAA, 2 mg / L 6 - BA, 0.2mg / L IAA, 0.8 g / L casein hydrolysate, 0.3 g / L proline, 30 g / L sucrose and 3 g / L phytagel, with the balance being sterile water.

[0094] 1 / 2MS medium: The final concentration of solutes in MS is halved.

[0095] 5 Overexpression SiCCT5 Phenotypic analysis of the overexpressed

[0096] Wild-type rice WT, SiCCT5-OE#1, and SiCCT5-OE#2 were identified. The DNAMAN software was used to design a pair of primers, SiCCT5-RT-F and SiCCT5-RT-R, for SiCCT5 gene quantification, as well as primers, RICE-actin-F and RICE-actin-R, for the rice reference gene ACTIN gene. The primer sequences are as follows:

[0097] SiCCT5-RT-F: GTTCAGACCTGCATGACAACTC (SEQ ID NO.7);

[0098] SiCCT5-RT-R: TCGAATGGGCATGTTAGGATGG (SEQ ID NO.8).

[0099] RICE-actin-F: TGCTATGTACGTCGCCATCCAG (SEQ ID NO.9);

[0100] RICE-actin-R: AATGAGTAACCACGCTCCGTCA (SEQ ID NO.10).

[0101] RNA was extracted from wild-type rice WT, SiCCT5-OE#1, and SiCCT5-OE#2, reverse-transcribed into cDNA, and subjected to fluorescence quantitative PCR experiments. The specific steps were the same as those for the extraction and reverse transcription of foxtail millet RNA above. The test results are shown in Figure 1 -D, demonstrating that SiCCT5 the gene was successfully overexpressed in the SiCCT5-OE#1 and SiCCT5-OE#2 lines.

[0102] The mesocotyl development of wild-type rice WT, SiCCT5-OE#1, and SiCCT5-OE#2 seeds cultured in continuous darkness for 7 days was analyzed. The test results are shown in Figure 1 -E and Figure 1 -F, showing that the mesocotyl lengths of the two overexpressing lines, SiCCT5-OE#1 and SiCCT5-OE#2, were significantly increased.

[0103] The longitudinal sections of the mesocotyls of wild-type rice WT, SiCCT5-OE#1, and SiCCT5-OE#2 seeds cultured in continuous darkness for 7 days were analyzed. The test results are shown in Figure 1 -G and Figure 1 -H, indicating that the cell lengths of the mesocotyls of the two overexpressing lines, SiCCT5-OE#1 and SiCCT5-OE#2, were significantly increased, that is, the increase in cell length was the main reason for the elongation of the mesocotyl. The above results demonstrated that foxtail milletSiCCT5 The gene has the function of regulating the development of rice mesocotyl.

[0104] Experimental Example 2 Rice OsCCT5 Experiment on Cloning and Functional Analysis of Gene

[0105] According to the function of the discovered Setaria italica SiCCT5 gene in the development of rice mesocotyl, homologous sequences of SiCCT5 protein in different species were retrieved and downloaded from the NCBI database, sequence alignment and phylogenetic analysis were performed using MEGA11 software, and a phylogenetic tree ( Figure 2 ) was constructed. The arrow in the phylogenetic tree indicates the SiCCT5 gene of Setaria italica ( S.italica Seita.2G010200.1) and the OsCCT5 gene of rice ( O.sativa LOC_Os06g36700.1). Through phylogenetic tree analysis, it was found that there is only one homologous protein OsCCT5 of SiCCT5 protein in rice. OsCCT5 The full-length cDNA sequence of the gene is 1608 bp, and its nucleotide sequence is shown in SEQ ID NO.2. The amino acid sequence of OsCCT5 protein is shown in SEQ ID NO.1.

[0106] The amino acid sequence of the OsCCT5 protein is as follows: MALAFDEFGRPFIILREQEKKSRLRGLDAQKANIAAGKAVARILRTSLGPKGMDKMLQSPDGDVTITNDGATILEQMDVDNQIAKLMVELSCSQDYEIGDGTTGVVVMAGSLLEQAEKLLERGIHPIRIAEGYELASRIAFDHLEHISHKFEFSATNIEPLVQTCMTTLSSKIVNRCKRTLAEIAVKAVLAVADLERKDVNLDLIKVEGKVGGKLEDTELVYGIIVDKDMSHPQMPKRIEDAKIAILTCPFEPPKPKTKHKVDIDTVEKFQMLREQEQKYFDEMVQKCKDVGATLVICQWGFDDEANHLLMHRNLPAVRWVGGVELELIAIATGGRIVPRFQELSPEKLGKAGIVREKSFGTTKDRMLYIEQCANSRAVTIFIRGGNKMMIEETKRSLHDALCVARNLIRNNSIVYGGGSAEISCSVAVEAAADRYPGVEQYAIRSFADALDAIPLALAENSGLSPIDTLTAVKSQQVKESNPHCGIDCNDVGTNHMKEQNVFETLIGKQQQILLATQVVKMILKIDDVISPSDY (SEQ ID NO.1).

[0107] OsCCT5

[0108] 1 Overexpression OsCCT5 Preparation of Transgenic Nipponbare Rice Lines with Overexpressed

[0109] Using the same method as in Test Example 1, RNA was extracted from Nipponbare rice and reverse transcribed into cDNA, which was used as a template for amplification OsCCT5 of the CDS sequence of the

[0110] Primers OsCCT5-OE-F and OsCCT5-OE-R were designed using the primer design software DNAMAN. The nucleotide sequences of the primers are as follows:

[0111] OsCCT5-OE-F: TTGTAGGTAGAAGAGGTACCCGGGATGGCGCTGGCCTTCGAC (SEQ ID NO.11);

[0112] OsCCT5-OE-R: GCATGCCTGCAGGTCGACTCTAGATCAATAGTCAGAAGGCGAGATAAC (SEQ ID NO.12).

[0113] Using the obtained Nipponbare rice cDNA as a template and OsCCT5-OE-F and OsCCT5-OE-R as primers, a recombinant vector pCam23A-OsCCT5 was constructed using the same method as in Test Example 1, that is, by inserting the nucleotide sequence shown in SEQ ID No.2 between the Sma I and Xba I sites of the pCam23A vector to obtain the recombinant vector pCam23A-OsCCT5 as shown in Figure 3 -A. The arrow in the figure indicates the OsCCT5 gene sequence.

[0114] Using the same method as in Test Example 1, the constructed overexpression vector pCam23A-OsCCT5 of the rice OsCCT5 gene was transferred into wild-type Nipponbare rice by Agrobacterium to obtain multiple overexpression T OsCCT5 generation lines of the 0 gene in Nipponbare rice. The T 0 generation plants were self-crossed to obtain T 1 generation OsCCT5 plants overexpressing the

[0115] gene. OsCCT5-OE#1 and OsCCT5-OE#2 were randomly selected for subsequent analysis. OsCCT5 identifying wild-type rice WT, OsCCT5-OE#1 and OsCCT5-OE#2, and using the DNAMAN software to design for OsCCT5A pair of primers OsCCT5-RT-F and OsCCT5-RT-R for gene quantification, and primers RICE-actin-F and RICE-actin-R for the rice internal reference gene ACTIN The primer sequences of the gene are as follows:

[0116] OsCCT5-RT-F: CCAATATAGAGCCTCTGGTGCA (SEQ ID NO.13);

[0117] OsCCT5-RT-R: ATGCTTTGTCTTAGGCTTCGGG (SEQ ID NO.14).

[0118] RICE-actin-F: TGCTATGTACGTCGCCATCCAG (SEQ ID NO.15);

[0119] RICE-actin-R: AATGAGTAACCACGCTCCGTCA (SEQ ID NO.16).

[0120] Using the same method as in Test Example 1, RNA was extracted from wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2, reverse-transcribed into cDNA, and a fluorescence quantitative PCR experiment was performed. The results are shown in Figure 3 -B, OsCCT5 The gene was successfully overexpressed in the OsCCT5-OE#1 and OsCCT5-OE#2 lines.

[0121] 2 Overexpression OsCCT5 Growth experiment of the gene overexpression improving plant direct seeding

[0122] The mesocotyl development of wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 seeds cultured in continuous darkness for 7 days was analyzed. The test results are shown in Figure 3 -C and Figure 3 -D. It was observed that the mesocotyl lengths of the two overexpression lines OsCCT5-OE#1 and OsCCT5-OE#2 were significantly increased.

[0123] The longitudinal sections of the mesocotyls of wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 seeds cultured in continuous darkness for 7 days were observed. The test results are shown in Figure 3 -E and Figure 3 -F. It can be seen that the cell lengths of the mesocotyls of the two overexpression lines OsCCT5-OE#1 and OsCCT5-OE#2 were significantly increased, that is OsCCT5 The elongation of mesocotyl cells in the gene overexpression lines is the main reason for the elongation of the mesocotyl.

[0124] To detect the application of the OsCCT5 gene in direct seeding of rice, wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 were respectively planted 2 cm deep in the soil for germination. It was observed that compared with wild-type rice WT, the seedling height of OsCCT5-OE#1 and OsCCT5-OE#2 increased significantly ( Figure 3 -G), the mesocotyl length increased significantly ( Figure 3 -H), and the germination rate also increased significantly compared with wild-type rice WT ( Figure 3 -I).

[0125] Wild-type rice WT, OsCCT5-OE#1, and OsCCT5-OE#2 were respectively planted 5 cm deep in the soil for germination. It was observed that compared with wild-type rice WT, OsCCT5-OE#1 and OsCCT5-OE#2 also showed a significant increase in seedling height ( Figure 3 -J), a significant increase in mesocotyl length ( Figure 3 -K), and a significant increase in the germination rate compared with wild-type rice WT ( Figure 3 -L).

[0126] The above results indicate that the rice OsCCT5 gene can significantly improve the growth status and germination rate of rice under direct seeding conditions.

[0127] Experimental Example 3 OsCCT5 Analysis of excellent haplotypes related to mesocotyl development of the gene

[0128] Based on databases such as rice 3K sequencing (snp-seek.irri.org) and analysis software, according to 6 SNP loci in the coding region of the OsCCT5 gene in different rice germplasm resources, 5 OsCCT5 gene haplotypes were identified in 4711 rice datasets ( Figure 4 -A). Analyzing 5 types of OsCCT5 gene haplotypes in different rice germplasm resources, the size of the fan area represents the number of samples of each haplotype, and different colors represent different subspecies types of rice. It was found that OsCCT5 the natural variation of the gene is mainly dominated by two haplotypes, haplotype A (the SNP type of Nipponbare) and haplotype B ( Figure 4 -B).

[0129] According to the data of mesocotyl length of seedlings of 510 cultivated rice germplasm resources retrieved, combined with 5 haplotype types for significance analysis, it was found that OsCCT5 haplotype B of the gene was significantly correlated with the increase in mesocotyl length compared with haplotype A (wild-type WT type) ( Figure 4 -C), indicating thatOsCCT5 Natural variation of the gene is associated with differences in mesocotyl elongation, and haplotype B is an important gene resource with the potential for improving direct-seeded rice applications.

Claims

1. CCT5 Gene, CCT5 protein, containing CCT5 Gene expression cassette or containing CCT5 The use of a recombinant plant expression vector of a gene in regulating plant growth; the regulating plant growth is to increase the length of the rice mesocotyl, improve the germination rate or seedling height of rice seeds during direct seeding, including: Will CCT5 Gene overexpression in rice improves CCT5 The expression amount or expression level of the gene; or enhancing the function or activity of the CCT5 protein; CCT5 The gene is the nucleotide sequence shown in SEQ ID NO.2 OsCCT5 The gene or nucleotide sequence is shown in SEQ ID NO.4 SiCCT5 Gene; the CCT5 protein is the OsCCT5 protein with an amino acid sequence as shown in SEQ ID NO.1 or the SiCCT5 protein with an amino acid sequence as shown in SEQ ID NO.

3.

2. A method for breeding a direct-seeding tolerant rice variety, characterized in that: include: Build contains CCT5 Gene overexpression recombinant plant expression vector; Will CCT5 Gene overexpression recombinant plant expression vector transformed rice, CCT5 The gene is overexpressed in rice, and the growth performance of the resulting transgenic rice during direct seeding is improved, including: increasing the length of the rice mesocotyl, increasing the germination rate or seedling height of rice seeds during direct seeding; CCT5 The gene is the nucleotide sequence shown in SEQ ID NO.2 OsCCT5 The gene or nucleotide sequence is shown in SEQ ID NO.4 SiCCT5 Gene.

Images