Primer, molecular marker, identification method and application for identifying the sex of Sichuan-Shaanxi Taimen

Abstract

The present invention provides a primer, a molecular marker, an identification method and an application for identifying the sex of Sichuan-Shaanxi Taimen, the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 5, and the sex marker-specific primer includes an upstream primer sequence 5′-GAACTCCCCTCCAGTTGCTA-3′; a downstream primer sequence 5′-TTGGAGCG GCAATGCAGTAT-3′. The identification method of the present invention only requires the extraction of DNA samples from fin rays, and the determination of female and male fish by the agarose gel electrophoresis bands of PCR amplification products, which causes little damage to the fish body and can be used for early sex identification of Sichuan-Shaanxi Taimen, while protecting the Sichuan-Shaanxi Taimen, while clearly understanding the sex ratio. The present invention uses the 18s gene as a reference, and can accurately determine whether the absence of the band is caused by genomic differences, avoiding misjudgment caused by the absence of the sex-specific primer band of male fish due to reasons such as sample degradation, human error, and PCR amplification failure. The method is simple, easy to implement, and low in cost, does not require tedious processes such as sequencing, and has strong operability and practicality.

Description

Technical Field

[0001] The invention relates to a primer, a molecular marker and an identification method for identifying the sex of Sichuan-Shaanxi Taimen, and belongs to the field of genetics and molecular biology. Background Art

[0002] The Sichuan-Shaanxi Taimen (Hucho bleekeri Kimura) belongs to the genus Hucho, family Salmonidae, order Salmoniformes. Also known as Blake's Taimen, Yangtze Taimen, tiger fish, cat fish, and tiger fish, the species is considered endangered. Since the 1980s, its abundance has plummeted due to overfishing, water pollution, and blocked migration routes. It is now listed as a Class I protected species on the National List of Key Protected Wildlife and as endangered on the IUCN Red List of Threatened Species.

[0003] Juvenile Sichuan and Shaanxi Taimen often have dark horizontal stripes on their sides and pale yellow fins. They grow slowly, reaching sexual maturity at age 4 to 5, spawning between May and June. During the reproductive period, their abdomens, pelvic fins, and the lower fork of their caudal fins are orange-red. After sexual maturity, male and female fish exhibit no distinct body shape or coloration, lacking distinct sexual characteristics, and sex identification by shape or coloration is difficult. Sichuan and Shaanxi Taimen are Class I protected species. The traditional method of killing fish, removing gonads, and slicing them for sex identification cannot be used during field surveys, making it difficult to fully understand the sex ratio of wild Sichuan and Shaanxi Taimen.

[0004] Currently, fully artificial breeding of Sichuan-Shaanxi Taimen has been successful and is expected to be further developed and utilized. Taimen eggs are similar to those of rainbow trout and Atlantic salmon and can be made into caviar. Females are more commercially valuable than males. Furthermore, the fish reach sexual maturity at 4-5 years of age. During breeding, the semen of a single male can be used to fertilize multiple females. Therefore, adjusting the male-female ratio during the juvenile stage can reduce broodstock rearing costs. For these reasons, there is an urgent need to develop a simple, accurate, and non-killing method for sexing Taimen juveniles. Summary of the Invention

[0005] In view of the deficiencies in the prior art, the present invention provides a primer, a molecular marker, an identification method and an application for identifying the sex of Sichuan-Shaanxi Taimen.

[0006] In order to achieve the above object, the technical solution provided by the present invention is:

[0007] A molecular marker for identifying the sex of Sichuan-Shaanxi Taimen, the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 5.

[0008] Gender marker-specific primers include upstream primers and downstream primers:

[0009] The upstream primer sequence was 1F 5′-GAACTCCCCTCCAGTTGCTA-3′;

[0010] The downstream primer sequence was 1R 5′-TTGGAGCGGCAATGCAGTAT-3′.

[0011] The method for identifying the sex of Sichuan-Shaanxi Taimen using the primer comprises the following steps:

[0012] (1) Sample acquisition: Samples of fertile female and male taimen were collected during the breeding period of Sichuan-Shaanxi Taimen. Approximately 0.5 cm2 of their caudal fins were cut off and the fins were stored in 95% ethanol by volume. The ethanol was replaced once every 4 h, 24 h, and 48 h. After the ethanol replacement, the fins were stored in a -20°C refrigerator for future use.

[0013] (2) DNA extraction: The fin ray samples were taken out, rinsed repeatedly with clean water, dried with filter paper, cut into pieces, and DNA was extracted using a kit. The DNA concentration was adjusted to 30 ng / l and used as a template for PCR amplification.

[0014] (3) PCR amplification: The amplification system includes 2 l of 30 ng / l DNA template, 12.5 l of 2× PCR mix, 1.0 l each of 10 μM sex marker-specific upstream and downstream primers, and 0.7 l each of 10 μM 18s reference upstream and downstream primers. Add enzyme-free water to make up to 25 l, mix well, and perform PCR amplification.

[0015] PCR amplification procedure: pre-denaturation at 95°C for 4 min, followed by 32 cycles of denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 30 sec; followed by extension at 72°C for 4 min to obtain the amplified product;

[0016] (4) Gel electrophoresis detection: Use agarose gel electrophoresis to detect the amplified product and determine the gender based on the electrophoresis results.

[0017] The 18s reference primers include upstream primers and downstream primers:

[0018] The upstream primer sequence was: 18sF 5′-CATGATGGAGCCTCCGATCC-3′;

[0019] The downstream primer sequence is: 18sR 5′-GCCAACACTGTGCTGTCTTG-3′.

[0020] The method for determining sex based on electrophoresis results is: if only one 141bp 18s reference primer band can be amplified, the sample is a female fish; if in addition to a 141bp 18s reference primer band, a 229bp sex marker-specific primer band can be amplified, the fish is a male fish.

[0021] The primers can be used to identify the sex of Sichuan-Shaanxi Taimen.

[0022] Beneficial effects of the present invention

[0023] 1. The sex identification method of Sichuan-Shaanxi Taimen of the present invention only requires extracting DNA samples from fin rays and judging female and male fish by agarose gel electrophoresis bands of PCR amplification products. This method causes little damage to the fish body and does not require killing the fish. It can be used for early sex identification of Sichuan-Shaanxi Taimen, and can clearly understand the sex ratio while protecting Sichuan-Shaanxi Taimen, a national first-class protected animal.

[0024] 2. The present invention uses the 18s gene as a reference and can accurately determine whether the absence of the band is caused by genomic differences, avoiding the misjudgment caused by the absence of the male fish sex-specific primer band due to reasons such as sample degradation, human error, and PCR amplification failure.

[0025] 3. The method of the present invention is simple, easy, low-cost, does not require tedious processes such as sequencing, and has good operability and practicality. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 : Agarose gel electrophoresis results. DETAILED DESCRIPTION

[0027] Example 1: Primers, molecular markers, and identification methods for identifying the sex of Sichuan-Shaanxi Taimen

[0028] 1. Sample acquisition: 30 female and 30 male taimen that can reproduce were collected during the breeding season of Sichuan-Shaanxi Taimen. The tail fin of each fish was trimmed to about 0.5 cm. 2 The fins of each fish were stored separately. To prevent DNA degradation, the fins were stored in 95% ethanol by volume, and the ethanol was replaced once every 4 h, 24 h, and 48 h. After the ethanol was replaced, the fins were stored in a -20 °C refrigerator for future use.

[0029] 2. DNA extraction: Take out the fin ray samples, rinse them repeatedly with clean water, absorb the water with filter paper, cut them into pieces, and extract DNA using the QIAGEN DNA extraction kit. Adjust the DNA concentration to 30 ng / μl and use it as a template for PCR amplification.

[0030] 3. PCR amplification: The amplification system includes 2 μl of 30 ng / μl DNA template, 12.5 μl of 2× PCR mix, 1.0 μl each of 10 μM sex marker-specific upstream and downstream primers, and 0.7 μl each of 10 μM 18s reference upstream and downstream primers. Add enzyme-free water to make up to 25 μl.

[0031] PCR amplification program: 95℃ pre-denaturation for 4 minutes, followed by 32 cycles of 95℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, and 72℃ extension for 30 seconds; then 72℃ extension for 4 minutes, and finally 10℃ hold. Gender marker specific primers:

[0032] Upstream primer sequence: 1F 5′GAACTCCCCTCCAGTTGCTA-3′ (SEQ ID NO: 1);

[0033] Downstream primer sequence: 1R 5′-TTGGAGCGGCAATGCAGTAT-3′ (SEQ ID NO: 2).

[0034] 18s reference primer:

[0035] Upstream primer sequence: 18sF 5′-CATGATGGAGCCTCCGATCC-3′ (SEQ ID NO: 3);

[0036] Downstream primer sequence: 18sR 5′-GCCAACACTGTGCTGTCTTG-3′ (SEQ ID NO: 4).

[0037] Since there are certain differences in the amplification efficiency of sex marker-specific primers and 18s reference primers, through experimental optimization, it was found that both can obtain relatively clear bands when the molar ratio is 1:0.7.

[0038] 4. Gel electrophoresis detection: Use 1.8-2.0% agarose gel electrophoresis to detect the PCR amplification product, spot 6-8 μl of the sample, and record the electrophoresis results with a gel imager.

[0039] Gel imager records electrophoresis results. Figure 1 , 30 female fish samples could only amplify one 141bp 18s reference primer band; 30 male fish samples could amplify not only one 141bp 18s reference primer band, but also one 229bp sex marker specific primer band, which was consistent with the sampling results, proving that the sex identification method of the present invention is reliable.

[0040] 5. Molecular marker: The product amplified by the sex marker-specific primers was cloned and sequenced to obtain a sequence of SEQ ID NO: 5, which was used as the sex marker-specific molecular marker sequence.

[0041] The product amplified by the 18s reference primer was cloned and sequenced, and the obtained sequence was SEQ ID NO: 6.

[0042] Molecular marker sequence SEQ ID NO: 5:

[0043] GAACTCCCCTCCAGTTGCTAATTACTACTGGGAAAGTCTTTGGTCAATCCAC

[0044] TGGAAAGCCCCTCCAAATGGTAAATGCTACTGGGAAACACATACATCAATC

[0045] CACTGTAATGCCAATTTAACTGGCAATTACTAGTGGGAAACTCATTTATCAA

[0046] TCCCCTGGAATGCCCCTCCAACTGGTAATACTACTGGGAAAGTCTTCGTGCAATATACTGCATTGCCGCTCCAA。

[0047] 18s reference sequence SEQ ID NO: 6:

[0048] CATGATGGAGCCTCCGATCCAGACGGAGTACTTACGCTCTGCAGGGGTGAT

[0049] GGTGGAGGGGGCCAGAGAGGTGATCTCCTTCTGCATCCTGTCAGCGATGCC GGGGTACATGGTGGTTCCTCAAGACAGCACAGTGTTGGC。

Claims

1. A primer for molecular markers for identifying the sex of Sichuan-Shaanxi Taimen, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 5; Gender marker-specific primers include upstream primers and downstream primers: The upstream primer sequence was 1F 5 ́-GAACTCCCCTCCAGTTGCTA-3 ́; The downstream primer sequence was 1R 5 ́-TTGGAGCGGCAATGCAGTAT-3 ́.

2. A method for identifying the sex of Sichuan-Shaanxi Taimen using the primers according to claim 1, characterized in that: The following steps are involved: (1) Sample acquisition: Samples of fertile female and male Taimen salmon were collected during their reproduction period, and their tail fins were cut about 0.5 cm apart. 2 The fins were stored in 95% ethanol by volume, and the ethanol was replaced once every 4 h, 24 h, and 48 h. After the ethanol was replaced, the fins were stored in a -20°C refrigerator for later use. (2) DNA extraction: The fin ray samples were taken out, rinsed repeatedly with clean water, dried with filter paper, cut into pieces, and DNA was extracted using a kit. The DNA concentration was adjusted to 30 ng / ml and used as a template for PCR amplification. (3) PCR amplification: The amplification system includes 2 ml of 30 ng / ml DNA template, 12.5 ml of 2×PCR mix, 10 mM of 1.0 ml each of the upstream and downstream primers specific for sex markers, and 10 mM of 18s 0.7 ml of each upstream and downstream primers were added, enzyme-free water was added to make up to 25 ml, mixed, and then PCR amplification was performed; PCR amplification program: pre-denaturation at 95°C for 4 min, followed by denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 30 sec, for 32 cycles; Then, the amplified product was obtained by extension at 72°C for 4 min; (4) Gel electrophoresis detection: Detect the amplified product using agarose gel electrophoresis, and determine the gender based on the electrophoresis results; The method of determining gender based on electrophoresis results is: only one 141bp fragment can be amplified 18s For reference primer bands, the samples are female fish; A 141 bp fragment can be amplified 18s If, in addition to the reference primer band, a 229 bp sex marker-specific primer band can be amplified, the fish is a male.

3. The method according to claim 2, wherein 18s The upstream primer sequence of the reference primer is: 18s F 5 ́-CATGATGGAGCCTCCGATCC-3 ́; downstream primer sequence is: 18s R 5 ́-GCCAA´CACTGTGCTGTCTTG-3 ́.

4. Use of the primer according to claim 1 in identifying the sex of Sichuan-Shaanxi Taimen.

Images