SgRNA for detecting salmonella pullorum and application thereof in rpa-crispr / cas12b detection

Abstract

The application discloses sgRNA for detecting chicken salmonella pullorum and application of the sgRNA in RPA-CRISPR / Cas12b detection, and belongs to the technical field of biology. The sgRNA designed by taking group_3798 gene as a specific target has good sensitivity, specificity and repeatability when used for detecting chicken salmonella pullorum, does not depend on large experimental equipment, can visually display results, and provides a method for rapidly detecting chicken salmonella pullorum on site for poultry breeding.

Description

Technical Field

[0001] This invention relates to an sgRNA for detecting Salmonella pullorum and its application in RPA-CRISPR / Cas12b detection, belonging to the field of biotechnology. Background Technology

[0002] Pullorum disease, also known as fowl cholera, is an acute systemic disease caused by Salmonella Pullorum. It primarily affects chicks aged 2-3 weeks, but adult chickens can also be infected. It can spread vertically and horizontally, has an extremely high mortality rate, and is difficult to eradicate, seriously impacting the development of my country's poultry industry. In my country, purging breeding stock of pullorum is a key method for its prevention and control, and the core of this purification lies in accurately detecting infected individuals.

[0003] Currently, methods for detecting Salmonella pullorum in chickens mainly include traditional bacterial isolation and identification, as well as detection techniques based on immunology and molecular biology, such as glass plate agglutination and PCR. Although significant progress has been made in methods such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA), their application is still limited due to the need for higher operational skills and complex equipment, making them cumbersome to operate. Therefore, there is an urgent need to develop a rapid, on-site detection method for Salmonella pullorum with high specificity and sensitivity.

[0004] In recent years, clustered regularly interspaced short palindromic repeats (CRISPR) have shown significant advantages in rapid detection technologies. The CRISPR-Cas (clustered regularly interspaced short palindromic repeats, CRISPR-associated proteins) detection system, developed based on the Cas12b protein, is a novel detection method showing promising applications in nucleic acid detection. Guided by sgRNA, the Cas12b protein activates its trans-cleavage activity upon recognizing a matching target sequence, thus indiscriminately cleaving single-stranded nonspecific nucleic acid sequences. Therefore, target DNA can be detected by detecting the fluorescence of the fluorescent group of nonspecific single-stranded DNA. However, in nucleic acid detection, it is necessary to amplify a small amount of the target fragment in the sample before the Cas protein cleavage reaction to further improve detection sensitivity.

[0005] Recombinase polymerase amplification (RPA) is a novel isothermal nucleic acid amplification technique developed by Piepenburg et al. in 2006. Compared to conventional PCR methods, RPA amplification is more sensitive, simpler, and faster, requiring only a small amount of nucleic acid sample to complete amplification under isothermal conditions of 37-45℃. Its simple operation and sample tolerance demonstrate great potential for rapid on-site detection. Combining RPA technology with CRISPR / Cas technology enables immediate on-site detection.

[0006] The detection method for Salmonella pullorum based on the PRA-CRISPR / Cas12b detection system can achieve rapid and convenient detection, and has the characteristics of high sensitivity and high specificity. It is expected to provide strong technical support and efficient detection methods for the quarantine and purification of Salmonella pullorum. Summary of the Invention

[0007] Purpose of the invention: The purpose of this invention is to provide an application of the group_3798 gene as a specific target in the detection of Salmonella pullorum, as well as an sgRNA designed for the group_3798 gene for the detection of Salmonella pullorum and its application.

[0008] Technical solution: The present invention provides an application of the group_3798 gene as a specific target in the detection of Salmonella pullorum in chickens, wherein the nucleotide sequence of the group_3798 gene is shown in SEQ ID NO.1.

[0009] The present invention also provides an sgRNA for detecting Salmonella pullorum, said sgRNA containing a specific target sequence as shown in SEQ ID NO. 2.

[0010] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.3.

[0011] The present invention also provides the application of the above-mentioned sgRNA in the preparation of a kit for detecting Salmonella pullorum in chickens.

[0012] The present invention also provides a Salmonella pullorum RPA-CRISPR / Cas12b detection kit, the kit comprising sgRNA of the Salmonella pullorum target sequence as shown in SEQ ID NO.2, and primer pairs for amplifying the Salmonella pullorum target sequence as shown in SEQ ID NO.2.

[0013] Furthermore, the nucleotide sequences of the primer pairs are shown in SEQ ID NO.4-5.

[0014] Furthermore, the kit also includes RPA amplification reagents and CRISPR / Cas12b detection reagents, as well as positive and negative controls.

[0015] Furthermore, the RPA amplification reagent includes polymerase dry powder, Buffer A, Buffer B, and ddH2O.

[0016] Furthermore, the CRISPR / Cas12b detection reagent includes a 10×HOLMES Buffer detection buffer, a fluorescent signal reporter molecule, ddH2O, and Cas12b protein.

[0017] This invention also provides a method for detecting Salmonella pullorum using RPA-CRISPR / Cas12b. First, the sample to be tested is subjected to RPA amplification, and the nucleotide sequences of the primers used are shown in SEQ ID NO. 6-7. Then, the RPA amplification product is subjected to CRISPR / Cas12b detection using the aforementioned sgRNA. After the CRISPR / Cas12b detection is completed, the fluorescence signal is read visually under 485nm excitation light. If there is a fluorescence signal, the sample to be tested contains Salmonella pullorum; if there is no fluorescence signal, the sample to be tested does not contain Salmonella pullorum.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: Using the group_3798 gene as a specific target, the designed sgRNA can achieve detection results within 1 hour without the need for multiple complex instruments and equipment when used to detect Salmonella pullorum, and can detect levels as low as 10. 0 CFU (Chemical Fusion Method) for Salmonella Pullorum Disease. It boasts multiple technical advantages, including ease of operation, rapid response, and excellent sensitivity, meeting the needs of on-site, real-time detection applications. Attached Figure Description

[0019] Figure 1 This is an electrophoresis image of the amplification products from the RPA primer screening test for Salmonella pullorum. Lane M is for DL2000 DNA Marker (Novozymes Biotechnology Co., Ltd.); lane 1 is for the amplification products of RPA-F1 / R1 primers; lane 2 is for the amplification products of RPA-F2 / R2 primers; lane 3 is for the amplification products of RPA-F3 / R3 primers; and lane 4 (RPA-) is for the amplification products of F / R primers.

[0020] Figure 2 This is a graph showing the performance validation results of the RPA-CRISPR / Cas12b detection kit. In the graph, 1 is a positive reaction tube containing the target bacterium *Salmonella pullorum* DNA; 2 is a negative control without sgRNA; 3 is a negative control without Cas12b protein; 4 is a negative control without target DNA; and 5 is a negative control containing only the fluorescent reporter gene.

[0021] Figure 3 This is a graph showing the optimal detection time for the RPA-CRISPR / Cas12b detection system.

[0022] Figure 4 This is a graph showing the results of the RPA-CRISPR / Cas12b detection system's specific assays for different serotypes of Salmonella strains and non-Salmonella strains. Tube 1 contains Salmonella pullorum; tubes 2-10 contain non-target bacteria, namely Salmonella enteritidis, Salmonella typhimurium, Salmonella Kentuckyis, Salmonella infantis, Salmonella Indiana, Salmonella London, Salmonella Argonnae, Escherichia coli, and Citrobacter; tube 11 is a negative control without target DNA; and tube 12 is a negative control containing only the fluorescent reporter gene.

[0023] Figure 5 This is a graph showing the results of the sensitivity evaluation of the RPA-CRISPR / Cas12b detection system. Figure 5 Using the Salmonella pullorum genome as a detection template, the concentrations of Salmonella pullorum genome in tubes 1-7 were 250 ng / μL, 25 ng / μL, 2.5 ng / μL, and 2.5 × 10, respectively. -1 ng / μL, 2.5 x 10 -2 ng / μL, 2.5 x 10 -3 ng / μL, 2.5 x 10 -4 ng / μL, tube 8 is the negative control; Figure 5 b. Using Salmonella pullorum bacterial suspension DNA as a detection template, the concentrations of Salmonella pullorum in tubes 1-6 were 10, respectively. 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL, 10 1 CFU / mL, 10 0 CFU / mL, tube 7 is the negative control.

[0024] Figure 6 This is a graph showing the detection results of the RPA CRISPR / Cas12b detection system for clinical isolates of Salmonella pullorum. Tubes 1-3 contain standard strains of Salmonella pullorum, tubes 4-59 contain isolates of Salmonella pullorum, and tube 60 is a negative control.

[0025] Figure 7 This is a graph showing the results of using the RPA-CRISPR / Cas12b detection kit to detect Salmonella pullorum in fecal simulated samples. Figure 7 a. Detection of Salmonella pullorum in fecal simulated samples before enrichment culture; Figure 7b. Detection of Salmonella pullorum in fecal samples after enrichment culture, with tubes 1-6 containing 10 μL of Salmonella pullorum. 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL, 10 1 CFU / mL, 10 0 The test results for CFU / mL Salmonella pullorum mixed with feces were obtained. Tube 7 was the fecal sample for testing, and tube 8 was the negative control. Detailed Implementation

[0026] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0027] Example 1: Screening for Salmonella pullorum-specific genes

[0028] To screen for Salmonella pullorum-specific genes, 100 strains each of the widely prevalent Salmonella serotypes in poultry, including Salmonella pullorum, Salmonella typhimurium, Salmonella enteritidis, Salmonella infantis, Salmonella Kentuckyii, Salmonella Indiana, Salmonella Argonnae, and Salmonella Londonii, as well as 100 non-Salmonella strains such as Escherichia coli, Citrobacter, Shigella, Vibrio parahaemolyticus, and Staphylococcus aureus, were selected. Genomic comparative analysis was used to screen for Salmonella pullorum-specific genes. All genomic information was obtained from the EnteroBase website (…). https: / / enterobase.warwick.ac.uk ).

[0029] The results are shown in Table 1. group_3798 (Sequence ID: CP126324.1) is specifically present in *Salmonella pullorum* (100%), while this gene is absent in other serotypes of *Salmonella* and non-*Salmonella* species prevalent in poultry. This indicates that the group_3798 gene can serve as a specific gene for the detection of *Salmonella pullorum*. The nucleotide sequence of the group_3798 gene is shown in SEQ ID NO.1:

[0030] ATGAATCGCCTGATATCAGCCTTCTGTATTACATTCTGTTGTCATGCTTACGCTATAACCCTAGATGCCAGTATTACTGATTTTACGGTACTATTTGGGCAACATATGGGGCACAGTGCTTGTGTAGGCAAATTTCCACAAGGTGCTCCACCCAGTACTTTTGTAGGATGCCGATCGAATGGTGATTTTTCAATGTATAATTCATTTACCTCAAAAGTCATCATTACTCGGTTGCCCGACAAAGTATCCGCTGCACATGGTGAGAGTCTGCCATGTACAGTTCCCTCGTTGAGGGTCCGGGGAGGGTTAGAATTCGCTAAGTCAACCTCCGATGCAGGAATAGTCGAAACTATTGATATTAGTGGAATGAATGTAGGTGAAAGCCGGACAGGGGAGATTAAAAATGCCAAATATATTGCCCTTACGCCCGGAACTGTTATCAGCCTAGAGGCGCTTCAGTGTGATTACAGTGCTGGTTCGCTTTTTGGCGATACATCTGCTCGAGTCTCTGCTAATTATTCAATAGAAATGCCTGATAGTAATTTCAGCACCTCGGTACTATATGAGGTACTGGCTAAAATTGACAAAATTGGGAGCAAACCCGACTTTACTTTGTCACCGACTTATGTCAGGTGTGTAGGTAACACTGCGTCCGGGTGCATGACTGAACCTGTGACAGTAAGCGTAAAAGATGTAACTAATGGTCACAGAATTCAAGTCACTGGTCTGGTAACTGGAGGGGATTTATCATATATATCAAATACTGGCCGTGTCGACCTGCCCGAGGGTAAGTTGACAAATCTTGTCAACACCGTCTCTTCTGGGGGAATACAGCAAGTGACATCAGGGCGTTTTGTTATCCCGGGAGGAGGAACTGAAGGGACCCGATTCTATACGGTGAACTACACTTTAACCGTAGAATAA

[0031] Table 1 Screening of specific genes of Salmonella pullorum

[0032]

[0033] Example 2: sgRNA and RPA primer design and screening, and establishment of an RPA-CRISPR / Cas12b detection system.

[0034] I. sgRNA Design

[0035] Using the Salmonella pullorum-specific gene group_3798 screened in Example 1 as the target, and combining the PAM sequence recognition preference of the Cas12b protein, the NCBI Blasten online alignment software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) was used to search for a specific and conserved sequence of this gene as a prespacer sequence to ensure that it can distinguish avian Salmonella pullorum from other serotypes of Salmonella and non-Salmonella. Finally, a 20bp gene sequence (SEQ ID NO.2) was selected as the specific detection target for Salmonella pullorum.

[0036] Based on the specific conserved sequence of *Salmonella pullorum*, a target recognition sequence was designed on the sgRNA. Combined with the fixed sgRNA sequence, a specific sgRNA sequence for *Salmonella pullorum* was designed, as shown in SEQ ID No. 3. In SEQ ID No. 3, positions 1-19 are the T7 promoter sequence, positions 20-111 are the scaffold sequence of the sgRNA, and positions 112-131 are the specific detection target sequence for *Salmonella pullorum*. A recombinant plasmid pUC18-sgRNA containing the specific sgRNA sequence was constructed, and primers for sgRNA sequence amplification were designed (SEQ ID NO. 4-5). The pUC18-sgRNA recombinant plasmid was synthesized by Sangon Biotech Co., Ltd., and the sgRNA sequence amplification primers were synthesized by Qingke Biotechnology Co., Ltd.

[0037] II. RPA Primer Design and Screening

[0038] 1. Primer Design and Synthesis: Based on the specific conserved sequences of Salmonella pullorum obtained through screening and the requirements for RPA primer design, RPA primers (SEQ ID NO. 6-13) were artificially designed. The RPA primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0039] 2. RPA primer screening:

[0040] 2.1 Genome Extraction

[0041] The genome of Salmonella pullorum S06004 was extracted using a genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.), and the extracted DNA was accurately quantified using a Nanodrop micro-spectrophotometer (Thermo Fisher Scientific).

[0042] 2.2 Primer amplification

[0043] RPA amplification was performed using the DNA isothermal amplification kit from Anpu Future Biotechnology Co., Ltd. The reaction system was as follows: 29.4 μL of Buffer A, 5 μL of template DNA, 9.1 μL of ddH2O, and 2 μL each of forward and reverse primers (10 μM) were added to the RPA enzyme lyophilized powder. Finally, 2.5 μL of Buffer B was added. The mixture was inverted 8-10 times, briefly centrifuged, and then incubated in a PCR instrument at 41°C for 30 min. 10 μL of the amplification product was analyzed by agarose gel electrophoresis to screen for RPA primers with high concentration and strong specificity.

[0044] RPA amplification was performed using primer pairs F / R, F1 / R1, F2 / R2, and F3 / R3, respectively. Under identical template concentration, reaction time, and primer concentrations, amplification was carried out at 41℃ for 30 min. After the reaction, 10 μL of the amplification product was analyzed by agarose gel electrophoresis. The sgRNA sequence and nucleotide sequences of the RPA primers are shown in Table 2.

[0045] Table 2. Sequences of RPA amplification primers and sgRNA transcription templates

[0046]

[0047] like Figure 1 As shown, the amplification bands of primer pairs RPA-F1 / R1 and F2 / R2 are light in color, indicating that the primer amplification efficiency is low; the amplification product of RPA-F3 / R3 is darker and contains non-specific bands, indicating that the primer specificity is not strong; the amplification band of primer pair F / R is brighter and the amplification band is single, indicating that the primer amplification efficiency is high. Unless otherwise specified, RPA primers in subsequent experiments will all use RPA-F / R primer pairs.

[0048] III. Establishment of the RPA-CRISPR / Cas12b Detection System

[0049] 1. In vitro transcription and purification of sgRNA

[0050] The pUC18-sgRNA recombinant plasmid was constructed by Sangon Biotech Co., Ltd. Using the plasmid as a template, in vitro transcription and purification were performed using Thermo Fisher Scientific's TranscriptAid T7 high-yield transcription kit and Novizan's VAHTS RNA Clean Beads. The specific procedure is shown below.

[0051] 1.1 DNA transcription template preparation

[0052] PCR amplification of specific sgRNAs of Salmonella pullorum was performed using primer pair sgRNA-F / R. The total PCR volume was 50 μL, containing 22 μL 2×Taq Master Mix, 22 μL ddH2O, 2 μL each of sgRNA-F / R primers (final concentration 0.4 μM), and 2 μL DNA template. The PCR reaction program was as follows: (a) 95℃ pre-denaturation for 3 min, (b) 95℃ denaturation for 30 s, (c) 56.1℃ annealing for 30 s, (d) 72℃ extension for 1 min, (b)-(d) 30 cycles, and (e) 72℃ extension for 5 min. The PCR products were analyzed by 1% agarose gel electrophoresis, and the products were recovered and purified using an agarose gel DNA recovery kit (purchased from TIANGEN, catalog number DP219-03).

[0053] 1.2 In vitro transcription of sgRNA

[0054] (1) Mix the DNA transcription template (0.5 μg), 5×Transcript Max reaction buffer (4 μL), TranscriptMax EnzymeMix (2 μL), NTP mix (8 μL), and nuclease-free water (to a final volume of 20 μL) thoroughly, then centrifuge briefly and incubate at 37°C for 10-12 h for in vitro transcription.

[0055] (2) After incubation at 37°C, add 1 μL of DNase I reaction solution to 20 μL of in vitro transcription product and incubate at 37°C for 30 min to remove residual DNA template in the transcription system.

[0056] (3) Purification of sgRNA transcripts:

[0057] a. First, remove the magnetic beads from the 4°C freezer and allow them to equilibrate to room temperature for about 30 minutes. Invert or vortex the beads to mix them thoroughly. Add 1.8 times the volume of the magnetic beads to the sgRNA sample to be purified and mix thoroughly by pipetting.

[0058] b. Incubate at room temperature for 5 minutes to allow the RNA to bind to the magnetic beads.

[0059] c. Place the sample on a magnetic rack for 5 minutes. After the solution has clarified, carefully remove the supernatant.

[0060] d. Keep the sample on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, rinse the magnetic beads, incubate at room temperature for 30 s, and carefully remove the supernatant.

[0061] e. Repeat step d, rinsing a total of 2 times.

[0062] f. Keep the sample on the magnetic rack at all times, and open the lid to air dry the magnetic beads for 5 minutes.

[0063] g. Remove the sample from the magnetic rack, add 32 μL of nuclease-free water, mix thoroughly by pipetting, and let stand at room temperature for 5 min.

[0064] h. Place the sample on a magnetic rack for 5 minutes. After the solution becomes clear, carefully transfer the supernatant to a new nuclease-free centrifuge tube to obtain the purified sgRNA.

[0065] 2. Establishment of RPA-CRISPR / Cas12b detection system

[0066] (1) The RPA-CRISPR / Cas12b detection system includes: Buffer A, RPA upstream and downstream primers (10μM), Buffer B, Cas12b protein (5μM), sgRNA (5μM), fluorescent reporter gene (FAM-N12-BHQ 1, 5μM), Buffer, and ddH2O.

[0067] (2) First, RPA amplification is performed, specifically including: adding 29.4 μL Buffer A, 5 μL template DNA, 9.1 μL ddH2O, and 2 μL each of RPA-F / R primer (10 μM) to the RPA enzyme lyophilized powder, and finally adding 2.5 μL Buffer B. Invert the container 8-10 times, centrifuge briefly, and then place it in a metal bath for amplification at 41℃ for 30 min.

[0068] (3) Then perform CRISPR / Cas12b detection with the above amplification products, specifically including: 1 μL Cas12b protein (5 μM), 1 μL sgRNA (5 μM), 1 μL of the above RPA amplification product, 1 μL fluorescent signal reporter gene (5 μM), 2 μL Buffer, and ddH2O to make up to 20 μL. After mixing, place in a metal bath.

[0069] (4) Reaction procedure: PCR instrument at 48℃ for 30 min.

[0070] (5) Results showed that when the reaction solution was irradiated with 485nm blue light, the color of the reaction tube that had cut the probe sequence turned green and there was a color difference with the control group, indicating that the CRISPR / Cas12b protein had been cut and the detection system was working normally.

[0071] Example 3: Performance Validation of the RPA-CRISPR / Cas12b Detection Kit

[0072] The feasibility of the kit reaction procedure was verified using the RPA-CRISPR / Cas12b detection method described in Example 2.

[0073] 1. The genome of Salmonella pullorum standard strain S06004 was extracted as a detection template and RPA amplification was performed.

[0074] 2. Add 1 μL of the above RPA amplification product to the CRISPR / Cas12b detection system for detection.

[0075] 3. According to Figure 2 It can be seen that, compared with the positive reaction tube containing the target bacterium Salmonella pullorum DNA (tube 1), the negative control tube (tube 2 without sgRNA), the negative control tube (tube 3 without Cas12b protein), the negative control tube (tube 4 without target DNA), and the negative control tube (tube 5 containing only the fluorescent reporter gene), a strong fluorescent signal can be observed by the naked eye. This indicates that the system can detect Salmonella pullorum. The Cas12b protein exerts trans-cleavage activity to generate a fluorescent signal, indicating that the detection system is feasible.

[0076] Example 4: Optimal Detection Time Optimization of RPA-CRISPR / Cas12b Detection System

[0077] The optimal detection time was optimized using the RPA-CRISPR / Cas12b detection method described in Example 2.

[0078] 1. The genome of Salmonella pullorum standard strain S06004 was extracted as a detection template and RPA amplification was performed.

[0079] 2. Add 1 μL of the above RPA amplification product to the CRISPR / Cas12b detection system, mix well, and place in a qPCR instrument. Collect fluorescence every 1 min for a total of 100 min.

[0080] 3. According to Figure 3 It can be seen that the fluorescence value reaches its peak after 30 minutes of detection, and there is no significant change in fluorescence value after extending the detection time. Therefore, the optimal detection time is 30 minutes.

[0081] Example 5: Specificity detection of the RPACRISPR / Cas12b detection system

[0082] Using the RPA-CRISPR / Cas12b detection method described in Example 2, the specificity of the RPA-CRISPR / Cas12b kit was tested using avian Salmonella and non-Salmonella genomes (Table 3) as templates.

[0083] Table 3. Avian Salmonella and non-Salmonella strains used in the experiment.

[0084] Serial Number bacteria strain number 1 Salmonella Pullorum S06004 2 Salmonella Enteritidis C50041 3 Salmonella Typhimurium SL1344 4 Salmonella Kentucky 0613-J8 5 Salmonella Infantis 308 6 Salmonella Indiana 606 7 Salmonella London P167 8 Salmonella Agona 3802 9 Escherichia coli K12 10 Citrobacter YZ19VE7

[0085] The results show ( Figure 4 The reaction solution only produces a fluorescent signal (tube 1) when the template is Salmonella pullorum genomic DNA, while tubes 2-10, which do not contain Salmonella pullorum genomic DNA, do not produce a fluorescent signal.

[0086] Example 6: Sensitivity Identification of the RPA-CRISPR / Cas12b Detection System

[0087] I. The RPA-CRISPR / Cas12b detection method described in Example 2 was used to detect the genome of Salmonella pullorum S06004.

[0088] After determining the genomic concentration of Salmonella pullorum S06004, it was diluted to concentrations of 250 ng / μL, 25 ng / μL, 2.5 ng / μL, and 2.5 × 10⁻⁶. -1 ng / μL, 2.5 x 10 -2 ng / μL, 2.5 x 10 -3 ng / μL, 2.5 x 10 -4 ng / μL, using the diluted genome as a template for detection.

[0089] according to Figure 5 As shown in Figure a, PCR tubes 1-6 all produced fluorescence, while the genome concentration in PCR tube 7 was 2.5 × 10⁻⁶. -4 No fluorescence signal was observed at ng / μL. Therefore, this detection method can be used for concentrations of 2.5 x 10 ng / μL. -3 The genome of Salmonella pullorum at concentrations above ng / μL was detected.

[0090] II. Detection of Salmonella pullorum S06004 bacterial suspension using the RPA-CRISPR / Cas12b detection method described in Example 2.

[0091] OD of Salmonella pullorum solution 600 Adjust to 1, then perform serial dilutions of 10-fold and plate counts. After counting, use PBS buffer to serially dilute the bacterial culture to 10⁻¹⁰. 5 10 4 10 3 10 2 10 1 10 0 DNA templates were obtained by high-temperature lysis at CFU / mL and then detected.

[0092] The results show ( Figure 5 b) PCR tubes 1-6 all produced fluorescence, indicating that this detection method can detect Salmonella pullorum at a concentration of 10. 0 CFU / mL.

[0093] Example 7: Detection of Salmonella pullorum isolates using the RPA-CRISPR / Cas12b detection system.

[0094] 1. The 56 clinical isolates of Salmonella pullorum previously isolated in our laboratory were revived, and their genomes were extracted for later use. The strains used in this experiment are shown in Table 4.

[0095] Table 4. Standard strains and clinical isolates of Salmonella pullorum in chickens.

[0096]

[0097]

[0098]

[0099] 2. Using the genomes of the above-mentioned Salmonella pullorum standard strain and isolate as detection templates, the detection was performed using the method described in Example 2.

[0100] according to Figure 6 It can be seen that PCR tubes 1-59 all produced obvious fluorescent signals, indicating that the detection method can detect Salmonella pullorum isolates.

[0101] Example 8: Detection of Salmonella pullorum in fecal simulated samples using the RPA-CRISPR / Cas12b detection method.

[0102] 1. OD of overnight cultured Salmonella pullorum S06004 600 Adjust the concentration to 1, and use PBS for serial dilution to achieve a concentration of 10. 5 -10 0 CFU / mL.

[0103] 2. Processing of unenriched samples: Add 1g of feces to 9mL of enrichment broth BPW. Take 1mL of bacterial solution of different concentrations and mix it with 9mL of feces sample. Then take 1mL of each solution to extract the genome. After extracting the genome, perform RPA amplification according to the method described in Example 2 and detect it by CRISPR / Cas12b fluorescence method.

[0104] 3. Enrichment sample processing: The remaining simulated contamination samples were simultaneously enriched at 37°C and 180 r / min. After 24 h, 1 mL of each sample was taken to extract the genome. After the genome was extracted, RPA amplification was performed according to the method described in Example 2, and the results were detected by CRISPR / Cas12b.

[0105] 4. Genomic DNA from the simulated contaminated samples (both unenriched and enriched) and control samples was simultaneously detected using the qPCR method in GB / T 43173-2023, "Procedure for Purification of Salmonella Pullorum in Breeding Farms," ​​and the concordance rates of the two methods were compared.

[0106] The results showed that the RPA-CRISPR / Cas12b method of the present invention can detect simulated contaminated fecal samples, and after enrichment culture, the detection limit of RPA-CRISPR / Cas12b in simulated contamination detection reached 10. 0 CFU / mL (e.g.) Figure 7 As shown in Table 5); at the same time, the qPCR method in the national standard was used for detection, and the results were consistent with those of the RPA-CRISPR / Cas12b method, indicating that the RPA-CRISPR / Cas12b method has good sensitivity and practicality.

[0107] This specific implementation method detects the extracted sample DNA, providing results within one hour. It exhibits high specificity and can detect up to 10... 0 It contains CFU / mL of Salmonella pullorum and can be used to detect samples such as poultry feces and anal swabs.

[0108] Table 5 Comparison of RPA-CRISPR / Cas12b and national standard methods for detecting fecal simulated contamination samples

[0109]

Claims

1. An sgRNA for detecting Salmonella pullorum, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

3.

2. The use of the sgRNA according to claim 1 in the preparation of a kit for detecting Salmonella pullorum in chickens.

3. A detection kit for Salmonella pullorum RPA-CRISPR / Cas12b, characterized in that, The kit includes the sgRNA shown in SEQ ID NO.3 and a primer pair for amplifying the sgRNA shown in SEQ ID NO.

3.

4. The detection kit according to claim 3, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO. 4~5.

5. The detection kit according to claim 3, characterized in that, The kit also includes RPA amplification reagents, CRISPR / Cas12b detection reagents, and positive and negative controls.

6. The detection kit according to claim 5, characterized in that, The CRISPR / Cas12b detection reagent includes a 10×HOLMES Buffer, a fluorescent signal reporter molecule, ddH2O, and Cas12b protein.

Images