SNP (Single Nucleotide Polymorphism) molecular marker for identifying upland cotton fiber strength character and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for identifying upland cotton fiber strength character and application thereof, and belongs to the technical field of plant molecular biology. The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for identifying upland cotton fiber strength character, which comprises two SNP molecular marker sites which are both positioned on an A10 chromosome of an upland cotton genome. The method has the characteristics of simplicity in operation, accurate result, convenience in repetition and the like, is suitable for screening upland cotton germplasm resources with different fiber strengths, identifies excellent sites with potential application values for molecular marker-assisted selective breeding, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular biology, and more particularly to a SNP molecular marker for identifying fiber strength traits of upland cotton and an application thereof. Background Art

[0002] As an important global cash crop and natural fiber crop, cotton is the main raw material for the textile industry, providing about 35% of the world's total fiber usage. As a natural fiber crop, upland cotton is widely planted around the world due to its wide adaptability and high yield characteristics, accounting for more than 95% of the world's cotton and is the main cultivated species. China is a major cotton producer in the world, but the output of high-quality cotton is seriously insufficient. 95% of high-grade cotton yarn needs to be imported. Improving fiber quality is still an important goal of upland cotton breeding in my country. Traditional hybrid breeding and system selection are not only time-consuming and labor-intensive, but also difficult to truly advance the cultivation process of high-quality cotton, and can no longer meet current production needs.

[0003] In order to solve the current problems of upland cotton fiber quality, it is necessary to explore excellent loci related to fiber quality. The development of molecular marker technology makes it possible to directly select the genotype of quantitative traits. With the development and application of whole genome association technology, SNPs and excellent loci related to fiber quality have been gradually explored. The development of these technologies and the exploration of excellent loci have laid a solid foundation and diverse options for the improvement of upland cotton fiber quality.

[0004] Whole Genome Resequencing (WGRS) is a whole genome sequencing of different individuals of species with known reference genome sequences. It has the advantages of rich detection of variant types, high cost performance, and wide application. Through sequence alignment, a large number of single nucleotide polymorphism sites (SNPs), insertion / deletion sites (InDels), and structure variation sites (SVs) can be found for individuals undergoing whole genome resequencing, which can be applied to the detection of pathogenic genes, genetic variation, and many other fields.

[0005] Single nucleotide polymorphism (SNP) mainly refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level, including the insertion, deletion and substitution of a single base. Non-synonymous SNPs located in the gene coding region can lead to changes in gene function. SNPs exist in all eukaryotic genomes and are very abundant. SNP variation sites have the following advantages: rich polymorphism, good stability, site specificity, co-dominance, etc., which facilitates molecular marker detection. Molecular markers based on SNPs will not separate the marker and the target gene, which can greatly improve the accuracy and stability of the marker.

[0006] Since fiber strength is a polygenic inheritance, the phenotype often shows continuous variation, and the gene effect is difficult to quantify. It takes a long time to artificially select fiber strength control sites using conventional breeding techniques, and because the fiber strength phenotype is easily affected by the environment, it is difficult to ensure that the fiber strength control genes are not lost during the breeding and improvement process based on phenotypic judgment after each backcrossing, which requires a large amount of cotton fields, manpower and financial resources. At present, the positioning and gene mining of fiber strength-related QTLs have made great progress, but relatively few are directly applied to the quality improvement of upland cotton. The main reason is that stable QTLs and major functional genes are rarely obtained, so it is urgent to further explore and verify the genes in fiber strength. Therefore, how to stably, reliably, quickly and easily carry out the breeding and improvement of high fiber strength materials through molecular marker-assisted selection methods has become the key core of the present invention.

[0007] Molecular markers directly reflect the differences in nucleotide sequences at the DNA level. They are not affected by developmental stages, environmental factors, or whether genes are expressed. They are characterized by being extremely abundant and genetically stable. At present, with the rapid development of molecular biology, molecular marker detection technology has developed dozens of technologies that can be used for the screening of molecular markers. The more commonly used molecular markers are RFLP (Restriction Fragment Length Polymorphism), RAPD (Random Amplified Polymorphic DNA), ISSR (inter-simple sequence repeat, molecular markers based on microsatellites), SSR (Simple Sequence Repeats), SCAR (sequence characterized amplified regions), STS (Sequence Tagged Sites), AFLP (Amplified Fragment Length Polymorphism) and SNP (Single Nucleotide Polymorphism), etc. With the continuous development and application of molecular marker technology, various molecular marker technologies have been increasingly applied to molecular marker-assisted selection breeding of crop breeding materials at home and abroad.

[0008] Therefore, providing a SNP molecular marker for identifying the fiber strength trait of upland cotton and its application is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0009] In view of this, the present invention provides a SNP molecular marker for identifying the fiber strength trait of upland cotton and its application, which are used to identify the fiber strength trait of upland cotton.

[0010] The purpose of the present invention is to develop SNP markers for detecting gene loci of fiber strength traits of upland cotton, and use the markers for detection and verification in large genetic populations, to provide a new method for early detection of fiber strength traits of upland cotton, and to provide practical markers for the utilization of hybrid vigor of upland cotton and the breeding of new varieties.

[0011] In order to achieve the above object, the present invention adopts the following technical solution:

[0012] Identify the SNP molecular markers for the fiber strength trait of upland cotton, which are single base mutations at sites 21331712 and 21332765 on chromosome A10 of upland cotton. The SNP molecular marker is directly expressed in the form of DNA, can be detected in all tissues and developmental stages of upland cotton, and is not restricted by the environment and season, and is not affected by problems such as expression or not. Therefore, the marker operation is simple, the amplification results are accurate, and the required reagent cost is low, and it can be used for molecular marker-assisted selection breeding of upland cotton fiber strength. The molecular markers associated with upland cotton fiber strength provided by the present invention can also be used for early prediction and preliminary screening and identification of upland cotton fiber strength traits.

[0013] A SNP molecular marker for identifying fiber strength traits of upland cotton, the SNP molecular marker comprising two SNP molecular marker sites, both located on chromosome A10 of the upland cotton genome, specifically:

[0014] SNP ID NO.1: The genotype of the reference genome at base 21331712 is TT, and the genotype of the mutation is CT or CC;

[0015] SNP ID NO.2: The genotype of the reference genome at base 21332765 is GG, and the genotype of the mutation is CG or CC;

[0016] Reference genome URL:

[0017] https: / / www.cottongen.org / species / Gossypium_hirsutum / ZJU-AD1_v2.1.

[0018] Furthermore, the SNP molecular marker is used in identifying the fiber strength trait of upland cotton.

[0019] Furthermore, the SNP molecular marker is used in the molecular marker-assisted selection breeding of upland cotton fiber strength.

[0020] Furthermore, when SNP ID NO.1 is TT and SNP ID NO.2 is GG, the fiber strength of upland cotton is average; when SNP ID NO.1 is CT / CC and SNP ID NO.2 is CG / CC, the fiber strength of upland cotton is good.

[0021] Further, a method for identifying the strength trait of upland cotton fiber comprises the following steps:

[0022] (1) extracting DNA from upland cotton tissue to be tested;

[0023] (2) designing specific primers according to the SNP molecular markers, using upland cotton tissue DNA as a template, and performing PCR amplification using the designed specific primers;

[0024] (3) Detect the genotype of SNP molecular marker loci for rapid identification of upland cotton germplasm resources with fiber strength traits.

[0025] Further, the specific primers are specifically:

[0026] Specific primers for SNP ID NO.1 site:

[0027] 21331712-F: AAGAAATTAGAAACCCTTC;

[0028] 21331712-R:TGAAGAATAAAGGGACTGC;

[0029] Specific primers for SNP ID NO.2 site:

[0030] 21332765-F:ATGGTATTGAAGCAGAAGG;

[0031] 21332765-R: TTCCATCAAGAACAGCAAG.

[0032] Furthermore, a kit for detecting the fiber strength trait of upland cotton is provided, the kit comprising specific primers for the SNP molecular marker.

[0033] It can be known from the above technical scheme that, compared with the prior art, the present invention discloses a SNP molecular marker for identifying the fiber strength trait of upland cotton and its application. The SNP molecular marker related to the fiber strength of upland cotton can be used for the early prediction and screening of the fiber strength of upland cotton, and can also be used for molecular marker-assisted selection breeding of cotton fiber strength. It is directly expressed in the form of DNA and can be detected in various tissues and various developmental stages of upland cotton, without being restricted by seasons and the environment, and there are no problems such as whether it is expressed or not. The present invention uses the third-generation molecular marker SNP to determine the genotype related to the fiber strength trait, and realizes the accurate and rapid screening and identification of the fiber strength of upland cotton germplasm resources. The present invention has the characteristics of simple operation, accurate results, and easy repetition. It is suitable for screening upland cotton germplasm resources with different fiber strengths, identifying excellent sites with potential application value for molecular marker-assisted selection breeding, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0035] Figure 1 The accompanying drawing is a scheme for constructing a genetic population of upland cotton according to the present invention;

[0036] Figure 2 The accompanying drawings are the present invention BC 8 F 2 Analysis of population genotype and fiber strength. DETAILED DESCRIPTION

[0037] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] Example 1

[0039] (I) Whole genome resequencing and development of SNP molecular markers

[0040] Based on the early breeding of a set of chromosome fragment introduction lines of Xinhai 36 with Xinluzhong 60 as the background, the test upland cotton variety Xinluzhong 60 is a high-quality national upland cotton variety with excellent characteristics such as high breaking strength and good stable yield. Xinhai 36 is a high-quality disease-resistant sea island cotton variety. Both parents are varieties bred locally in Xinjiang in recent years. The breeding process is as follows: In the summer of 2014, at the Kuche Upland Cotton Experimental Station of Xinjiang Academy of Agricultural Sciences in Kuche City, Xinjiang, Xinluzhong 60 and Xinhai 36 were hybridized to produce F 1 In the winter of the same year, BC was obtained by backcrossing with Xinluzhong No. 60 in Sanya, Hainan. 1 F 1 BC was planted in Kuche City, Xinjiang in the summer of 2015 1 F 1 and Xinluzhong No. 60, backcrossing with Xinluzhong No. 60 to obtain BC 2 F 1 , and then backcrossed with Xinluzhong No. 60 every year in Kuche City, Xinjiang, until BC 6 F 1 Planting BC in Kuche in 2020 6 F 1 Introgression population, BC produced by selfing 6 F2 The population was used for BSA-seq localization research. After that, Xinluzhong No. 60 was used for two generations of backcrossing in Kuche City, Xinjiang until BC 8 F 1 , after self-pollination, BC 8 F 2 The population is used for SNP molecular marker verification. The construction plan of upland cotton genetic population is shown in Figure 1 .

[0041] About BC 6 F 2 After the population was harvested, quality indicators were measured, and families with higher fiber strength and families with lower fiber strength were selected to construct extreme mixed pools for BSA-Seq mixed pool sequencing. The high-throughput Illumina HiSeq sequencing platform was used to perform whole-genome resequencing on 2 parental pools and 2 DNA mixed pools, and a total of 17.01G of raw data (Reads Num.) base sequence fragments were obtained. The original sequencing sequence obtained by sequencing may contain adapter sequences or low-quality bases. Through quality control and data filtering, high-quality clean data was obtained for subsequent analysis. The average base error rate of bases below 1% (Q20) accounted for 96.69%, and the average base error rate of bases below 0.1% (Q30) accounted for 91.38%, and the GC distribution was normal. The average proportion of sample sequencing data aligned to the reference genome (https: / / www.cottongen.org / species / Gossypium_hirsutum / ZJU-AD1_v2.1; Gossypium hirsutum (AD1) 'TM-1' genome ZJU-improved_v2.1_a1) was 95.20%, which met the requirements of subsequent experimental analysis.

[0042] Based on the reference genome data of upland cotton, the BSA-Seq analysis of the fiber strength trait of upland cotton obtained the interval of 20,600,000bp to 22,200,000bp on chromosome A10 of upland cotton as the candidate interval for fiber strength trait of upland cotton. All genes identified in the candidate region were annotated. First, the candidate genes were deeply annotated and preliminarily functionally verified using BLAST software through multiple databases NR, Swiss-Prot, GO, KEGG and COG, and finally the key candidate gene GH_A10G1043 and its SNP molecular markers were determined (Table 1).

[0043] Table 1 Distribution of candidate genes on chromosomes

[0044]

[0045] The SNP molecular markers include two SNP molecular marker sites, both located on chromosome A10 of the upland cotton genome, specifically:

[0046] SNP ID NO.1: The genotype of the reference genome at base 21331712 is TT, and the genotype of the mutation is CT or CC;

[0047] SNP ID NO.2: The genotype of the reference genome at base position 21332765 is GG, and the mutated genotype is CG or CC.

[0048] The SNP sites of the candidate interval GH_A10G1043 gene were analyzed in the parents and BC 8 F 2 The statistical analysis of genotypes and phenotypes in the offspring population showed that the parent Xinluzhong No. 60 had a weaker fiber strength at SNP ID NO.1 (genotype TT) and SNP ID NO.2 (genotype GG); the parent Xinhai No. 36 had a weaker fiber strength at SNP ID NO.1 (genotype CC) and SNP ID NO.2 (genotype CC). The fiber strength of the offspring SNP ID NO.1 (genotype TT) and SNP ID NO.2 (genotype GG) was average (breaking strength ≤30.8 cN·tex). -1 ), the fiber strength of SNP ID NO.1 (genotype is CT / CC) and SNP ID NO.2 (genotype is CG / CC) in the offspring is good (breaking strength>30.8cN·tex -1 ).

[0049] The detection primer sequences of SNP ID NO.1 and SNP ID NO.2 sites are shown in Table 2.

[0050] Table 2

[0051]

[0052] (II) SNP markers in the progeny population BC 8 F 2 Verification in

[0053] The basic principle of plant genomic DNA extraction is to use chemical methods to destroy the cell wall and cell membrane to expose the DNA in the cell, and then purify the DNA through centrifugation, washing and other steps.

[0054] The basic principle of SNP typing analysis experiment is that the sequencing of two DNA fragments from different individuals, ATGGTC and ATGCTC, contains changes in a single nucleotide (G and C), involving two alleles. Most common SNPs have only two alleles. The selection of SNPs depends on the lowest allele frequency of a certain SNP in the population.

[0055] 1) Use Tiangen Plant Genomic DNA Extraction Kit (DP305) to extract the DNA from the leaves of upland cotton to be tested, the steps are as follows:

[0056] (1) Grind the cotton leaf sample into powder using liquid nitrogen and transfer 20-200 mg of the plant powder into a new 2.0 ml centrifuge tube.

[0057] (2) Add 700 μl (preheated at 65°C) GP1, mix the sample by inversion, and incubate at 65°C for 20 min. Repeat inversion several times (or oscillate for 5 min).

[0058] (3) Add 700 μl of chloroform, vortex to mix, incubate at room temperature for 2 min, and centrifuge at 12,000 g for 5 min.

[0059] (4) Transfer the supernatant to a new 2.0 mL EP tube and add 700 μl of buffer GP2 and mix well.

[0060] (5) Insert the DNA adsorption column into the collection tube and transfer the supernatant to the adsorption column.

[0061] (6) Centrifuge at 12,000 g for 1 min at room temperature.

[0062] (7) Discard the waste liquid, transfer the adsorption column back to the collection tube, and add 500 μl Buffer GD to the adsorption column.

[0063] (8) Centrifuge at 12,000 g for 1 min at room temperature.

[0064] (9) Discard the waste liquid, transfer the adsorption column back to the collection tube, and add 600 μl Buffer PW (add 4 times anhydrous ethanol before use) to the adsorption column.

[0065] (10) Discard the waste liquid, transfer the adsorption column back to the collection tube, and centrifuge at 12,000 g for 3 min to completely remove the ethanol.

[0066] (11) Discard the collection tube and place the DNA adsorption column into a new centrifuge tube (self-prepared).

[0067] (12) Add 30-100 μl of sterile water or 10 mM Tris HCL, pH 8-9 (preheated to 65°C is recommended) to the middle of the column membrane, let stand for 1 min, and centrifuge at 12,000 g for 2 min.

[0068] (13) Discard the DNA binding column and store the DNA in the refrigerator.

[0069] 2) Using genotyping technology, specific primers (21331712 (F / R) / 21332765 (F / R)) were designed according to the SNP site. The primer sequences are shown in Table 2.

[0070] 3) Using the upland cotton tissue DNA as a template, PCR amplification was performed using the designed specific primers. The PCR amplification reaction system is shown in Table 3.

[0071] Table 3

[0072]

[0073] After the PCR reaction, the results were observed using blue light imaging, the positive bands were removed, and the PCR products were recovered. The PCR products were recovered using the Aoke Bio Gel Recovery Kit. The specific operation was carried out according to the kit instructions. The steps are as follows:

[0074] (1) Cut the gel block containing the target band into a 1.5 ml centrifuge tube, add 3 times the volume of the sol solution, shake and mix. Let stand at room temperature for 5 min.

[0075] (2) After the gel block is completely dissolved, add 6 μl of silica-based magnetic beads, shake thoroughly, and let stand at room temperature for 5 min to allow the magnetic beads to fully combine with the solution.

[0076] (3) Place the centrifuge tube on the magnetic rack. When the magnetic beads are completely adsorbed to the tube wall, pour out the supernatant. During the process of pouring out the supernatant, keep the centrifuge tube on the magnetic rack.

[0077] (4) Add 500 μl of 80% anhydrous ethanol, take the centrifuge tube out of the magnetic rack, shake and mix, and place it on the magnetic rack. When the magnetic beads are completely adsorbed to the tube wall, pour out the supernatant. During the process of pouring out the supernatant, keep the centrifuge tube on the magnetic rack.

[0078] (5) Repeat step (4).

[0079] (6) Blow dry the centrifuge tube until there is no ethanol residue on the surface of the magnetic beads, add 25 μl TE, shake and mix, and set aside.

[0080] 4) Take the above recovered and purified PCR products and use the sequencer ABI3730-XL for DNA sequencing. Detect the genotype of the SNP molecular marker site in the PCR amplification product for rapid identification of BC8 F 2 group.

[0081] The sequencing results are compared with the data to obtain the comparison result, which is the identification result.

[0082] 5) SNP result analysis

[0083] The sequence of the amplified product of SNP ID NO.1 site (716 bp) is as follows:

[0084] AAGAAATTAGAAACCCTTCTTTTCAATTTATACCGAAATTAGAAAAACACTTTTTCATTGTTATTATTATTCCTCTTTTATCCCAAATTTATTTTCGAAATTTTGCTTTACGGCTTTAGATCTTAGAGCAAGAACGGGGTTCTTTTTGTTCCAAGATTTCTTGGTGTAAATCTTTTTATCTGGGTTCATAAAAGGTTTGATCTTTAGGTATTATTGATTTTAGTTTGAGTTCTCTGTTGGAAATGGAGG Y CTCGGTAATTAGGAGTTCTTCACAGGCAAAGATCTCTAAAACAGAATTAGGATGCAGGATTTAAGGTTTTGTTTTGGGAAAAGTAATGATAAAAACAAAATATTTCTCGGAAACCAAACAGTGTTTGCTTTGAAAGCCAAATTTCGAGGTTTAGAAAAGCTGGGCTCAGATTTACGTTGAAAGCTGTCCACTCTGATCCCGTTCTTGAATCCAAGTCTCCTGCAACTTTCAA ATCTGTAAGTTCCATTTTTTCCCCTTCTTTTTGGCTTTTTTCCCCCTCAATTTTGTGTATTTTCTGTTCTTTTATTCTTAAAAATAGATTATCAGTTTGGTGTTATTTGTTTTAAATTGATAAAGTTGGAACCTTTTTTAAGCTAAGTTGGGACGATTTGAGCTCTATTTTGGGTAGATCTTAGATAATAAAAATTAGGTGTAATTCCGCTGCAGTCCTTTTATTCTTCA; SEQ. ID NO.5; Y is C / T, the variation type of SNP base.

[0085] The sequence of the amplified product of SNP ID NO.2 (793 bp) is as follows:

[0086] ATGGTATTGAAGCAGAAGGATTAAATTAAAAATTATATATTTTAAAAGCAAATTGTTTCATGTTTATTCTTTTTGACAAGTGTGAAGAAATTTAGTATTTCCATATCAATACTTGTAGAGGAATTAAAGTGAATATAGCCATCTATTTATAGTTACTTCGTAGTTTTCTAAGCTGGTTTTAGTGATGAATTTAAGGTATT TTTATTTATATCTACATTTGCATTTGATGCTTGAATCTTTGGAATTGATATGCAGTCATTCTTTATTGAAAGCCATGCCTTAAAAACTTTTGTTTTTAATGCAGATTCTGGCTGAAAAACATCATAAAATTGAATTGATAAACAACTGTATTTGGTTATGCTGATTGTTGCAAATTCTGGTTTTTCTTTTTCAGCTTGATA S GCTAAGATTATTTGTTGGTCTGCCTCTAGATGCGGTTTCCGATGGCAATTCGGTAAACCATGCCCGGGCAATTGGGGCGGGACTGAAAGCTTTGAAACTTTTGGGTGTGGAAGGTGTTGAATTGCCTGTCTGGTGGGGAGTGGTCGAAAATGAGATGGGGAAGTATGACTGGTCAGGCTATCTTGCTGTTGCTGAGAT GGTTCAGAAAGCAGGTCTGAAGCTTCACGTATCGCTCTGCTTCCACGCTTCGAGTCAACCGAGAATTCTGCTTCCCAAGTGGGTAACGAAGATTGGCGAATCCCAATCAAGTATCTTCTTTGCGGATCGTTCAGGACAGCATTATCAGCAATGTCTATCACTGGCTGTCGATAATCTTGCTGTTCTTGATGGAA; SEQ ID NO.6; S is G / C, the variation type of SNP base.

[0087] To further verify the universality of the SNP molecular markers related to fiber strength traits of upland cotton developed based on BSA-Seq in this study, the primers of the above SNP ID NO.1 and SNP ID NO.2 sites were used to8 F 2 The results of the group test are shown in Figure 2 and Table 4.

[0088] Table 4 Test results of upland cotton genotype and fiber strength

[0089]

[0090]

[0091]

[0092]

[0093]

[0094] Note: Ref: abbreviation of Reference, indicating the same sites as the reference genome;

[0095] Alt: The abbreviation of Alternative, which indicates a site that is different from the reference genome; that is, a mutation site.

[0096] The test results found 147 BC infiltrations from land and sea 8 F 2 Among the pedigrees, 57 pedigrees had genotypes of TT and GG at SNP ID NO.1 and SNP ID NO.2, respectively, and the fiber strength was average (breaking strength ≤ 30.8 cN·tex -1 ); 86 families had genotypes of CT / CC and CG / CC at SNP ID NO.1 and SNP ID NO.2, respectively, and had good fiber strength (breaking strength>30.8cN·tex -1 ); genotypes of 4 families were missing.

[0097] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A SNP molecular marker for identifying fiber strength traits of upland cotton, characterized in that: The SNP molecular marker includes two SNP molecular marker sites, both of which are located on chromosome A10 of the upland cotton genome, specifically: SNP ID NO.1: The genotype of the reference genome at base 21331712 is TT, and the genotype of the mutation is CT or CC; SNP ID NO.2: The genotype of the reference genome at base position 21332765 is GG, and the mutated genotype is CG or CC.

2. Use of the SNP molecular marker described in claim 1 in identifying fiber strength traits of upland cotton.

3. Use of the SNP molecular marker according to claim 1 in molecular marker-assisted selection breeding of upland cotton fiber strength.

4. The use according to claim 2 or 3, characterized in that: When SNP ID NO.1 is TT and SNP ID NO.2 is GG, the fiber strength of upland cotton is average; when SNP ID NO.1 is CT / CC and SNP ID NO.2 is CG / CC, the fiber strength of upland cotton is good.

5. A method for identifying the strength traits of upland cotton fibers, characterized in that: The following steps are involved: (1) extracting DNA from upland cotton tissue to be tested; (2) designing specific primers according to the SNP molecular marker of claim 1, using the DNA of upland cotton tissue as a template, and performing PCR amplification using the designed specific primers; (3) Detect the genotype of SNP molecular marker loci for rapid identification of upland cotton germplasm resources with fiber strength traits.

6. The method for identifying the strength trait of upland cotton fiber according to claim 5, characterized in that: The specific primers are specifically: Specific primers for SNP ID NO.1 site: 21331712-F: AAGAAATTAGAAACCCTTC; 21331712-R:TGAAGAATAAAGGGACTGC; Specific primers for SNP ID NO.2 site: 21332765-F:ATGGTATTGAAGCAGAAGG; 21332765-R:TTCCATCAAGAACAGCAAG.

7. A kit for detecting the strength properties of upland cotton fibers, characterized in that: The kit comprises the specific primers for the SNP molecular markers according to claim 6.

Images