Liver protection compositions and methods

Abstract

Low dose formulations of orally administered medium chain dicarboxylic acids surprisingly have many beneficial cell protection effects in a variety of cells. In particular, contemplated formulations, compositions, and methods reduce, reverse, and / or prevent liver inflammation, liver steatosis, and / or liver fibrosis in NASH, improve glycemic control, and provide additional cytoprotective benefits such as stimulation of mitochondrial biosynthesis, increase SIRT and NAMPT levels, increase NAD +, increase antioxidant capacity, and / or reduction of DNA damage.

Description

[0001] Priority claim

[0002] This application claims priority to our co-pending U.S. Provisional Patent Application Serial No. 63 / 341,913, filed May 13, 2022, and U.S. Provisional Patent Application Serial No. 63 / 359,587, filed July 8, 2022. Each of these applications is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] An XML text file of the sequence listing named 104026.0081PCT.xml was created on April 28, 2023, is 11,610 bytes in size, and was submitted electronically via EFS-Web with this application, which is incorporated herein by reference in its entirety. Technical Field

[0005] The field of the invention is compositions and methods for treating and preventing the sequelae of lipid accumulation in the liver, particularly as they involve effects mediated by low dose medium chain dicarboxylic acids. Background Art

[0006] The Background Description includes information that may be useful in understanding the present invention. No admission is made that any of the information provided herein is prior art or relevant to the presently claimed invention, nor is any admission made that any publication specifically or implicitly referenced is prior art.

[0007] All publications and patent applications are incorporated herein by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Where a definition or use of a term in an incorporated reference is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.

[0008] In addition to its well-known role in preservatives, coatings, paint materials, corrosion inhibitors, surfactants and engineering plastics, dodecanedioic acid (also known as DDDA or DDA) has also been reported to be a readily convertible source of various energy intermediates such as succinyl-CoA and acetyl-CoA and ATP, wherein DDDA is administered orally in large quantities. It is noteworthy that oral administration of relatively large doses of DDDA (>20 g) also has a hypoglycemic effect on individuals diagnosed with non-insulin-dependent diabetes mellitus (NIDDM), but has no corresponding effect on healthy individuals (see U.S. Patent Publication No. 2011 / 0002900). Similarly, when DDDA is administered to individuals diagnosed with NIDDM by intravenous infusion, the plasma glucose level of NIDDM patients is significantly reduced during the infusion (see, e.g., Nutrition 1998 Apr; 14 (4): 351-7).

[0009] It is worth noting that, given the rapid metabolic transformation of DDDA in the liver, there are no published reports on the physiological effects of DDDA on hepatocytes and liver tissue. However, the corresponding monocarboxylic acids (i.e., lauric acid and palmitic acid) that are very closely related chemically have been reported to have significant adverse effects on the liver and other tissues. Lauric acid and palmitic acid have been reported to increase adipose tissue inflammation, induce insulin resistance, and induce non-alcoholic fatty liver disease, etc. (see, e.g., Biology (Basel). 2020 Oct 22; 9(11): 346).

[0010] Nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) have become common conditions and are associated with liver fibrosis, which can progress to cirrhosis and liver cancer. In the United States alone, the number of NAFLD cases is expected to grow from 83 million in 2015 to 101 million in 2030, with 27% of cases meeting criteria for NASH. As disease prevalence rises, so too does the number of individuals with cirrhosis and end-stage liver disease requiring liver transplantation. NASH is a proinflammatory state that leads to activation of hepatocytes, Kupffer cells (KCs), and hepatic stellate cells (HSCs). Activated HSCs undergo a phenotypic switch and deposit excess extracellular matrix, altering normal liver architecture and leading to liver fibrosis.

[0011] Unfortunately, there are currently no FDA-approved drugs to treat or reverse these conditions, and many herbal extracts have been reported to have at least some beneficial effects (see, e.g., US20100074975, US20120171312, US20100086627). However, such preparations are often poorly defined and the effects are often not as effective as expected.

[0012] Therefore, although there are various compositions and methods for treating and preventing lipid accumulation in the liver and liver damage caused by lipid accumulation, all or almost all of them have some disadvantages. Therefore, there is still a need for improved compositions and methods for treating and preventing lipid accumulation in the liver and liver damage caused by lipid accumulation. Summary of the invention

[0013] The present subject matter relates to a variety of nutritionally and / or pharmaceutically acceptable compositions and methods that use low doses of medium chain dicarboxylic acids to prevent, or even significantly reduce, liver fibrosis in NASH. This finding is particularly unexpected because the therapeutically effective doses are significantly lower than the doses used in NIDDM treatment. In addition to reducing fibrosis, it was unexpectedly found that the low doses also have significant secondary protective effects that provide significant benefits to hepatocytes and other cell types. In addition, the inventors have also found that medium chain dicarboxylic acids are effective in preventing non-alcoholic steatohepatitis (NASH) and / or reducing and / or reversing the severity of non-alcoholic steatohepatitis (NASH), and even treating NASH. In addition, the inventors also envision that medium chain dicarboxylic acids can effectively prevent hepatocellular carcinoma (HCC) in the liver of healthy livers and NASH / NAFLD individuals.

[0014] In one aspect of the inventive subject matter, the inventors contemplate a hepatoprotective composition comprising a medium chain dicarboxylic acid in combination with a nutritionally or pharmaceutically acceptable carrier, wherein a therapeutically effective unit dose of the medium chain dicarboxylic acid provides no more than 5% of the standard daily caloric intake of a mammal.

[0015] In some embodiments, the composition is formulated for oral administration. For example, the contemplated composition can be formulated as a ready-to-use drink or solid supplement or powder. Although not limited to the subject matter of the present invention, it is generally preferred that the medium chain dicarboxylic acid is dodecanedicarboxylic acid (DDA or DDDA) or sebacic acid (sebacic acid).

[0016] In some instances, the therapeutically effective unit dose provides a standard daily caloric intake of a mammal equal to or less than 3%, or less than 2%, or less than 1%. Considered from different perspectives, the therapeutically effective unit dose may also be equal to or less than 5g, or equal to or less than 4g, or equal to or less than 3g, or equal to or less than 2g, or equal to or less than 1g of a medium chain dicarboxylic acid. The therapeutically effective unit dose may also be 3g to 5g, or 2g to 4g, or 1g to 3g, or 0.1g to 2g, or 0.01g to 0.1g of a medium chain dicarboxylic acid. If desired, the composition may also include other hepatoprotectants (e.g., silymarin, silymarin extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate / ester, pyruvate / ester derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theophylline and / or methyl liberine, etc.).

[0017] Advantageously, a therapeutically effective dose can reduce the risk of liver fibrosis in non-alcoholic steatohepatitis (NASH) or even reverse its progression, and / or can reduce postprandial glucose peak and / or postprandial total blood glucose AUC (e.g., in healthy individuals or prediabetic individuals). In addition, a therapeutically effective dose can also stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+ levels, maintain antioxidant capacity and / or reduce DNA damage.

[0018] Therefore, the inventors also contemplate a method of reducing the risk or progression of liver inflammation, liver steatosis and / or liver fibrosis in non-alcoholic steatohepatitis (NASH) in an individual. Such a method would typically include the step of administering a therapeutically effective dose of a medium-chain dicarboxylic acid to an individual in need thereof, wherein the therapeutically effective dose provides no more than 5% of the individual's standard daily caloric intake. The inventors also contemplate a method of reversing liver inflammation, liver steatosis and / or liver fibrosis in non-alcoholic steatohepatitis (NASH) in an individual, wherein the method comprises administering a therapeutically effective dose of a medium-chain dicarboxylic acid to an individual in need thereof; wherein the therapeutically effective dose provides no more than 5% of the individual's standard daily caloric intake.

[0019] Preferably, but not necessarily, the medium chain dicarboxylic acid is dodecanedicarboxylic acid, and / or the individual is a human being. Also usually preferably, the therapeutically effective dose is administered orally. Most typically, the therapeutically effective dose provides a standard daily caloric intake of a mammal equal to or less than 3%, or equal to or less than 1%. Therefore, the therapeutically effective unit dose can also be equal to or less than 5g, or equal to or less than 4g, or equal to or less than 3g, or equal to or less than 2g, or equal to or less than 1g of the medium chain dicarboxylic acid. The therapeutically effective unit dose can also be 3g to 5g, or 2g to 4g, or 1g to 3g, or 0g to 2g, or 0.01g to 0.1g of the medium chain dicarboxylic acid. As described above, the contemplated compositions may also include other hepatoprotectants, such as silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvate derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theophylline and / or methylcrocarpine.

[0020] Beneficially, administration of a therapeutically effective dose can also reduce postprandial glucose peak and / or postprandial total blood glucose AUC (e.g., in healthy individuals or prediabetic individuals), and in some embodiments, administration of a therapeutically effective dose can stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+ levels, maintain antioxidant capacity and / or reduce DNA damage.

[0021] In other aspects, the inventors contemplate methods of regulating blood glucose without affecting body weight, comprising the step of administering to an individual in need thereof a therapeutically effective dose of a medium chain dicarboxylic acid, wherein the therapeutically effective dose provides no more than 5% of a standard daily caloric intake for a mammal, and wherein the regulation of blood glucose is a reduction in postprandial glucose peak and / or postprandial total blood glucose AUC (e.g., in a healthy individual or a pre-diabetic individual).

[0022] Most typically, the medium chain dicarboxylic acid is formulated for oral administration, for example, as a ready-to-use drink or as a solid supplement or powder. Preferably, but not necessarily, the medium chain dicarboxylic acid is dodecanedicarboxylic acid. In other embodiments, the therapeutically effective dose provides equal to or less than 3% of the standard daily caloric intake of a mammal, and / or the therapeutically effective dose comprises equal to or less than 3 g of the medium chain dicarboxylic acid.

[0023] In the contemplated methods, administration may also stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+ levels, maintain antioxidant capacity and / or reduce DNA damage. Advantageously, administration may also reduce the risk or progression of liver fibrosis in non-alcoholic steatohepatitis (NASH).

[0024] In other aspects, the inventors also contemplate methods for increasing the resilience and / or lifespan of cells, comprising the step of exposing the cells to medium chain dicarboxylic acids for a period of time (e.g., at least 6 hours), wherein the amount of the medium chain dicarboxylic acids is effective to stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+, maintain antioxidant capacity and / or reduce DNA damage. Most typically, the medium chain dicarboxylic acid is dodecanedicarboxylic acid, and / or the cells are exposed in vivo after oral administration of the medium chain dicarboxylic acid.

[0025] In other aspects of the inventive subject matter, the inventors contemplate methods of preventing non-alcoholic steatohepatitis (NASH) in an individual or reducing the severity of non-alcoholic steatohepatitis (NASH) in an individual, wherein a therapeutically effective dose of a medium-chain dicarboxylic acid is administered to the individual, wherein the therapeutically effective dose prevents non-alcoholic steatohepatitis (NASH) in the individual or reduces the severity of non-alcoholic steatohepatitis (NASH) in the individual. Similarly, the inventors also contemplate methods of treating non-alcoholic steatohepatitis (NASH) in an individual, wherein a therapeutically effective dose of a medium-chain dicarboxylic acid is administered to the individual, wherein the therapeutically effective dose reduces lipid deposition in the liver of an individual diagnosed or suspected of having non-alcoholic steatohepatitis (NASH).

[0026] Most typically, the medium chain dicarboxylic acid is dodecanedicarboxylic acid or its pharmaceutically or nutritionally acceptable salt, and / or the individual is a human being. It is also envisioned that the therapeutically effective dose is administered orally. Although not limited to the subject matter of the present invention, the generally preferred therapeutically effective dose provides a standard daily caloric intake of an individual equal to or less than 5% or equal to or less than 3%, or equal to or less than 1%. Considered from different angles, the therapeutically effective unit dose can also be equal to or less than 5g, or equal to or less than 4g, or equal to or less than 3g, or equal to or less than 2g, or equal to or less than 1g of the medium chain dicarboxylic acid. The therapeutically effective unit dose can also be 3g to 5g, or 2g to 4g, or 1g to 3g, or 0g to 2g, or 0.01g to 0.1g of the medium chain dicarboxylic acid.

[0027] Therefore, the inventors also contemplate a liver protection composition comprising a combination of a nutritionally or pharmaceutically acceptable carrier and a medium chain dicarboxylic acid, wherein the composition is formulated for oral administration, and its dosage is therapeutically effective to prevent or treat non-alcoholic fatty hepatitis (NASH) in an individual who ingests the composition. If desired, the composition may also include at least one other liver protection agent (e.g., silymarin, silymarin extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvate derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theophylline and / or methyl macrocarpine).

[0028] Advantageously, the therapeutically effective dose may also reduce the risk or progression of liver inflammation and / or liver fibrosis in the individual, and / or may also reduce insulin resistance in the individual.

[0029] In other aspects of the subject matter of the present invention, the inventors have contemplated a method for preventing hepatocellular carcinoma, the method comprising administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof. In a preferred embodiment, the individual is a patient suffering from non-alcoholic steatohepatitis (NASH) or non-alcoholic fatty liver disease (NAFLD). Most typically, the medium chain dicarboxylic acid is dodecanedicarboxylic acid or a pharmaceutically or nutritionally acceptable salt thereof. It is also contemplated that the therapeutically effective dose is administered orally. The generally preferred therapeutically effective dose provides an individual's standard daily caloric intake of 5%, or 4%, or 3%, or 2%, or 1%. Considered from a different perspective, the therapeutically effective unit dose may also be equal to or less than 5g, or equal to or less than 4g, or equal to or less than 3g, or equal to or less than 2g, or equal to or less than 1g of medium chain dicarboxylic acid. The therapeutically effective unit dose may also be 3 g to 5 g, or 2 g to 4 g, or 1 g to 3 g, or 0 g to 2 g, or 0.01 g to 0.1 g of medium chain dicarboxylic acid.

[0030] Various objects, features, aspects and advantages of the subject matter of the present invention will become more apparent from the following detailed description of preferred embodiments and the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 An exemplary study protocol for feeding Wistar rats a high fat / high cholesterol diet with or without low concentrations (1% of caloric intake) of dodecanedioic acid is schematically shown.

[0032] Figure 2 Shows Figure 1 Exemplary blood glucose challenge results and exemplary body weight results for animals with and without low concentrations of dodecanedioic acid in their diets.

[0033] Figure 3 Shows Figure 1 Exemplary results of liver histology in animals following a diet with or without low concentrations of dodecanedioic acid.

[0034] Figure 4 Exemplary in vitro results of lipid accumulation in hepatocytes exposed to oleic acid in the presence or absence of low concentrations of dodecanedioic acid are shown.

[0035] Figure 5 Exemplary data for the antioxidant effect of DDA (dodecanedioic acid) in hepatocytes are shown.

[0036] Figure 6 Exemplary data of overall SIRT activity in DDA-exposed hepatocytes are shown.

[0037] Figure 7 Exemplary data of PGC-1α levels in DDA-exposed hepatocytes are shown.

[0038] Figure 8 Exemplary data of NAMPT activity in DDA-exposed hepatocytes are shown.

[0039] Fig. 9 Exemplary data of SIRT3 activity in DDA-exposed hepatocytes are shown.

[0040] Fig.10 Exemplary data of SIRT1 activity in DDA-exposed hepatocytes are shown.

[0041] Fig.11 Exemplary data of DNA damage in DDA-exposed hepatocytes are shown.

[0042] Fig.12 Exemplary data for the antioxidant effect of DDA (dodecanedioic acid) in endothelial cells are shown.

[0043] Fig.13 Exemplary data of overall SIRT activity in DDA-exposed endothelial cells are shown.

[0044] Fig.14 Exemplary data of PGC-1α levels in DDA-exposed hepatocytes are shown.

[0045] Fig.15 Exemplary data of NAMPT activity in DDA-exposed endothelial cells are shown.

[0046] Fig.16 Exemplary data of SIRT3 activity in DDA-exposed endothelial cells are shown.

[0047] Fig.17 Exemplary data of DNA damage in DDA-exposed endothelial cells are shown.

[0048] Fig.18 The experimental design of the studies is schematically shown. In study 1 (A), DODA was administered together with a high-fat, high-cholesterol diet for 4 weeks, while in study 2 (B), rats were first fed a high-fat, high-cholesterol diet for 9 weeks to develop NASH and then administered DODA for another 4 weeks to evaluate its reversal effect.

[0049] Fig.19Exemplary results showing that DODA administration prevents diet-induced insulin resistance and NASH are shown. Panels A and B are the time course and AUC of blood glucose concentration and plasma insulin concentration during an oral glucose tolerance test. Panel C shows hepatic insulin resistance assessed by HOMA-IR. Data are mean ± SEM of data from 10 rats per group. ***P<0.0001; ***P<0.004; ***P<0.015.

[0050] Fig. 20 Exemplary results showing that DODA administration prevents diet-induced NASH are shown. Panels A to F are representative images of liver sections stained with hematoxylin and eosin (A, B), Oil Red O for lipid staining (C, D), and Sirius Red for fibrosis staining (E, F). Magnification 20×. Scale bar: 0.10 mm.

[0051] Fig.21 Exemplary results showing that DODA administration reverses diet-induced insulin resistance are shown. Panel A, Panel B: Time course and AUC of blood glucose concentration and plasma insulin concentration during oral glucose tolerance test. Panel C: Hepatic insulin resistance and hepatic insulin sensitivity assessed by HOMA-IR. Data are mean ± SEM of data from 10 rats per group. ***P<0.004; ***P<0.04.

[0052] Fig. 22 Exemplary results showing that DODA administration reverses diet-induced insulin-induced NASH are shown. Panels A to F: Representative liver sections stained with hematoxylin and eosin (A, B), Oil Red O for lipid staining (C, D), and Sirius Red for fibrosis staining (E, F). Magnification 20×. Scale bar: 0.10 mm.

[0053] Fig.23 Shown is the accumulation of lipid droplets in primary hepatocytes treated with (0.4 mM) palmitate in vitro as indicated by Nile Red staining in the presence or absence of 1 (weight / volume (w / v)) % DODA. Magnification 60×. Scale bar: 50 μm.

[0054] Fig.24Exemplary results showing that DODA induces HSC apoptosis and thus contributes to the regression of liver fibrosis are shown. Panel A, Panel B: Flow cytometric analysis of fibroblast differentiation of hepatic stellate cells from hepatocytes treated with palmitate for 24 hours exposed to CM containing (B) or without (A) 1 (wt / vol) % DODA for 3 days. Panel C, Panel D: Flow cytometric analysis of HSC apoptosis after incubation with CM from hepatocytes treated with palmitate containing (D) or without (C) 1 (wt / vol) % DODA using propidium iodide staining.

[0055] Fig.25 Exemplary study designs for in vivo Study 1 (prevention, Panel A) and in vivo Study 2 (reversal, Panel B) demonstrating prevention or reversal of NAFLD using compositions disclosed herein are shown.

[0056] Fig.26 C12 administration is shown to prevent diet-induced insulin resistance and NASH. Panels A and B show the time course and AUC of blood glucose concentrations and plasma insulin concentrations during an oral glucose tolerance test. Panel C shows hepatic insulin resistance assessed by HOMA-IR.

[0057] Fig. 27 C12 administration prevents diet-induced NASH. Panels A to F: Representative liver sections stained with hematoxylin and eosin (A, B), Oil Red O (C, D), and Sirius Red (E, F). Magnification 20×. Scale bar: 0.10 mm.

[0058] Fig.28 Exemplary results showing that C12 administration reverses diet-induced insulin resistance are shown. Panel A, Panel B: Time course and AUC of blood glucose concentration and plasma insulin concentration during oral glucose tolerance test. Panel C: Hepatic insulin resistance assessed by HOMA-IR. ***P<0.0001; ***P<0.004; ***P<0.015.

[0059] Fig.29 It is shown that C12 administration reverses diet-induced insulin NASH. Panels A to F: Representative liver sections stained with hematoxylin and eosin (A, B), Oil Red O (C, D), and Sirius Red (E, F). Magnification 20×. Scale bar: 0.10 mm.

[0060] Fig.30It is shown that C12 induces HSC apoptosis and thus contributes to the regression of liver fibrosis. Panel A, Panel B: Flow cytometric analysis of fibroblast differentiation of hepatic stellate cells from hepatocytes treated with palmitate for 24 hours exposed to CM containing (B) or not containing (A) 1 (wt / vol)% C12 for 3 days. Panel C, Panel D: Flow cytometric analysis of HSC apoptosis after incubation with CM of palmitate-treated hepatocytes containing (D) or not containing (C) 1 (wt / vol)% C12 using propidium iodide staining. Panel E: Real-time fluorescence quantitative-PCR (qRT-PCR) analysis of genes related to fibrosis in livers of rats from in vivo study 1 and in vivo study 2.

[0061] Fig.31 C12 is shown to inhibit citrate uptake and thus downregulate the citrate transporter SLC13A5. Panel A: In vitro citrate uptake assay with human primary hepatocytes treated with a fixed concentration of citrate (150 μM) in the presence or absence of C12 (0.1% to 1.5% v / w). Panel B: Solute carrier family 13 member 5 (SLC13A5) was assessed by qRT-PCR in primary human hepatocytes treated with palmitate (0.4 mM) with or without 1% (v / w) C12.

[0062] Fig.32 C12 is shown to reduce lipid droplet accumulation and DNL in primary hepatocytes. Panel A: Nile red staining of primary human hepatocytes treated with palmitic acid (0.4 mM) with or without 1 (wt / vol)% C12. Magnification 60×. Scale bar: 50 μM Panel B: Evaluation of de novo lipogenic enzymes (i.e., diacylglycerol O-acyltransferase 1 (DGAT1), fatty acid synthase (FASN), and stearoyl-CoA desaturase (SCD1)) in primary human hepatocytes treated with palmitic acid (0.4 mM) with or without 1 (wt / vol)% C12. Panel C: Evaluation of key enzymes for fatty acid β-oxidation (i.e., carnitine palmitoyltransferase 1A (CPT1A)) in primary human hepatocytes treated with palmitic acid (0.4 mM) with or without 1 (wt / vol)% C12.

[0063] Fig.33The effects of C12 on DNL, ​​FAO and citrate uptake in vivo are shown. Panel A: Evaluation of de novo lipogenic enzymes (i.e., diacylglycerol O-acyltransferase 1 (DGAT1), fatty acid synthase (FASN), and stearoyl-CoA desaturase (SCD1)) in the liver of rats from in vivo study 1 and in vivo study 2 by qRT-PCR. Panel B: Evaluation of key enzymes of fatty acid beta oxidation (i.e., carnitine palmitoyltransferase 1A (CPT1A)) in the liver of rats from in vivo study 1 and in vivo study 2 by qRT-PCR. Panel C: Evaluation of solute carrier family 13 member 5 (SLC13A5) in the liver of rats from in vivo study 1 and in vivo study 2 by qRT-PCR. DETAILED DESCRIPTION

[0064] The inventors unexpectedly found that oral administration of low-dose medium-chain dicarboxylic acids has multiple cytoprotective effects, and low-dose medium-chain dicarboxylic acids are particularly effective in reducing or even reversing liver fibrosis in NASH, and in reducing postprandial glucose peaks and postprandial total blood glucose AUC in non-diabetic individuals. In addition, it was unexpectedly observed that low-dose medium-chain dicarboxylic acids stimulate mitochondrial biogenesis, increase overall SIRT levels and NAMPT levels (while increasing intracellular NAD+), help maintain antioxidant capacity, and reduce DNA damage via oral administration. In addition, the inventors also found that medium-chain dicarboxylic acids are also effective in preventing non-alcoholic steatohepatitis (NASH) and / or reducing and / or reversing the severity of non-alcoholic steatohepatitis (NASH) in individuals, and can even be used to treat NASH in individuals by reducing lipid deposition in the liver of individuals diagnosed or suspected of having non-alcoholic steatohepatitis.

[0065] Therefore, based on the data provided in more detail below, the inventors contemplate that medium-chain dicarboxylic acids can be used in the form of oral administration to combat liver fibrosis, prevent NASH or reduce the severity of NASH, treat NASH, enhance cell health and / or help maintain blood glucose levels (particularly in non-diabetic individuals, for example, by reducing insulin resistance). In addition, the contemplated compositions can also be effective in promoting weight loss (particularly for overweight or obese populations), particularly over a prolonged administration period.

[0066] For example, in a representative embodiment, the nutritional supplement is formulated as a ready-to-use drink or bulk powder containing about 3 g of dodecanedicarboxylic acid (DDDA) in a single dosage unit. The drink is preferably formulated as a flavored aqueous non-alcoholic solution, while the ready-to-use powder can be formulated with an edible and preferably non-caloric or low-caloric carrier (e.g., soluble prebiotic fiber) and can be mixed with fluids or other foods. In another example, the pharmaceutical formulation for oral administration is formulated as a solid tablet to provide a daily dose of 0.05 g to 5 g of dodecanedicarboxylic acid.

[0067] It will be readily appreciated that a variety of medium chain dicarboxylic acids other than DDDA may be used in the contemplated compositions, and particularly preferred alternative dicarboxylic acids include sebacic acid and dicarboxylic acids generally having the general formula (CH2): n (CO2H)2 dicarboxylic acids, wherein n is preferably an integer from 6 to 12. In addition, it should be understood that combinations of a variety of medium chain dicarboxylic acids with different molecular weights are also considered suitable. In addition, it should be understood that various modifications to medium chain dicarboxylic acids are also considered suitable, and exemplary modifications include adding functional groups (e.g., hydroxyl, halogen, amino, sulfhydryl, etc.) or replacing hydrogen in medium chain dicarboxylic acids with functional groups. Similarly, the envisioned medium chain dicarboxylic acids can be modified to form monoesters or diesters with a variety of groups to regulate absorption, serum half-life, etc. In addition, it should also be recognized that the medium chain dicarboxylic acids envisioned herein include all metabolites of medium chain dicarboxylic acids and mixtures thereof.

[0068] In addition, the inventors have found that administration of DDDA to tumor-bearing mice contributes to hepatoblastoma and potential NASH-related cancers. Therefore, low doses (5 g or less, or 4 g or less, or 3 g or less, or 2 g or less, or 1 g or less) of DDDA can be used for chemoprevention of HCC in healthy liver or liver of NASH / NAFLD individuals, presumably due to its reduction of chronic subacute inflammation.

[0069] Throughout this disclosure, the terms "dodecane dicarboxylic acid," "DDA," "DDDA," "C12," and "DODA" are used interchangeably and refer to a compound having the formula (CH2) 10 (COOH)2 dicarboxylic acid.

[0070] About suitable carrier, it should be noted that all carriers are suitable, as long as it is nutritionally and / or pharmaceutically acceptable.Therefore, particularly preferred carriers will include materials suitable for human and animal consumption, which can be solid or liquid.For example, solid carriers will generally include all excipients commonly used in the field of nutrition and pharmaceutical fields, such as fillers, binders, disintegrants, etc., wherein the composition is formulated as powders, tablets, capsules or other forms that can be orally administered.On the other hand, when the composition is formulated as snacks or food, particularly preferred preparations include snack bars, biscuits, soft candies, etc.In addition, solid carriers also include all baked goods, wherein medium-chain dicarboxylic acids are used for nutritionally fortified baked goods, to reduce the blood sugar peak and / or blood insulin peak that would otherwise be observed after a meal.In other embodiments, liquid carriers will include aqueous preparations and soft drinks, which may or may not be carbonated beverages, syrups, fruit juices and flavored beverages, all of which can be packaged in small ready-to-use / disposable containers or containers storing multiple dosage units.

[0071] Regardless of the specific formulation, it should be understood that the contemplated compositions and products will include at least one therapeutically effective unit dose of a medium chain dicarboxylic acid that will typically (but not necessarily) provide no more than 5% of the standard daily caloric intake of a mammal. Considered from a different perspective, a therapeutically effective unit dose will generally be a dose that effectively produces the desired physiological effect, as described in more detail below. Administration of a therapeutically effective unit dose over a period of at least 1 week, or at least 2 weeks, or at least 4 weeks, or longer than 4 weeks will include the following desired effects: prevention and / or alleviation of liver inflammation, NAFLD, NASH, hepatic steatosis, and / or hepatic fibrosis in individuals diagnosed with NAFLD or NASH, prevention and / or reduction of lipid accumulation in hepatocytes of healthy individuals or individuals at risk of developing NAFLD or NASH, treatment of NAFLD or NASH, reduction of postprandial glucose peaks and / or postprandial total blood glucose (particularly in non-diabetic individuals or pre-diabetic individuals) determined by AUC measurements, etc. Other desired effects include various cytoprotective effects, such as increasing mitochondrial biogenesis, increasing SIRT levels, increasing NAMPT levels, increasing intracellular NAD+ levels, maintaining antioxidant capacity and / or reducing DNA damage. In other embodiments, it is contemplated that the compositions presented herein may also be used to treat, alleviate and / or treat conditions and diseases associated with elevated lipid load, including PCOS.

[0072] Thus, at least in some embodiments, it will be appreciated that administration of DDDA (and other dicarboxylic acids) is not only an excellent method for treating NASH (and therefore NAFLD), but also a method for reversing NASH (and therefore NAFLD). Notably, as described in more detail below, liver fibrosis can also be regressed by dicarboxylic acids. Of course, it should be noted that dicarboxylic acids other than DDDA can also provide similar benefits given their similar properties. Furthermore, it was unexpectedly found that dicarboxylic acids have significant effects at low concentrations or low doses, particularly for liver disease.

[0073] Thus, in certain embodiments, the contemplated therapeutically effective unit dose will provide equal to or less than 10%, or equal to or less than 9%, or equal to or less than 8%, or equal to or less than 7%, or equal to or less than 6%, or equal to or less than 5%, or equal to or less than 4%, or equal to or less than 3%, or equal to or less than 2%, or equal to or less than 1% of the standard daily caloric intake of a mammal. Most typically, the daily caloric intake of a human is about 2000 calories / day for an adult female and about 2500 calories / day for an adult male. When the contemplated composition is used in pet food, the typical caloric intake for a 10 pound cat is about 200 calories / day, while the typical caloric intake for a dog weighing 10 to 70 pounds is 200 to 1000 calories.

[0074] Considered from a different perspective, the contemplated therapeutically effective unit dose will generally be equal to or less than 6 g, or equal to or less than 5 g, or equal to or less than 4 g, or equal to or less than 3 g, or equal to or less than 2 g, or equal to or less than 1 g, or equal to or less than 0.5 g, or equal to or less than 0.3 g of medium chain dicarboxylic acid.

[0075] In this context, it is particularly understood that the envisioned metabolic or physiological effects of medium chain dicarboxylic acids will vary significantly as a function of the dose administered, which is not recognized or anticipated by those skilled in the art. In fact, while relatively high amounts (e.g., 40 g) of DDDA administered orally will serve primarily as a source of acetyl-CoA, succinyl-CoA, and ATP, lower doses of DDDA administered intravenously improve glycemic control in individuals with NIDDM, while very low doses as proposed herein prevent or even reverse liver fibrosis, lipid accumulation in hepatocytes, and NASH in NASH, and also reduce glycemic fluctuations and total serum concentrations (as measured by AUC) in non-diabetic individuals. Furthermore, low doses also provide significant cytoprotective effects in a significant manner, as described in more detail below. Thus, it is recognized that medium chain dicarboxylic acids have a dose-dependent, multimodal effect. Although not limited to the subject matter of the present invention, the inventors envision that the beneficial effects described herein may be attributed to the interaction of medium chain dicarboxylic acids (particularly DDDA) with NR1I3 (nuclear receptor subfamily 1 group 1 member 3), wherein NR1I3 is a known key regulator of xenobiotic metabolism and endogenous metabolism. In addition, or alternatively, the beneficial effects described herein may also be attributed to the interaction of medium chain dicarboxylic acids (particularly DDDA) with HDAC9 (histone deacetylase 9), a member of histone deacetylases, wherein HDAC9 is known to exert regulatory effects dependent on the metabolic state of the cell. In addition, the inventors also note that DDDA and compositions containing DDDA promote mitochondrial fatty acid oxidation, which is believed to contribute to weight loss and reduce liver lipid load and / or adipocyte lipid load.

[0076] It is readily understood that the contemplated compositions may also include one or more than one other functional ingredients that assist in maintaining cellular health, particularly liver cell health. For example, contemplated liver protectants include silymarin, silymarin extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvate derivatives, capsaicin, capsaicin derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theophylline and / or methyl macrocarpon. Similarly, other agents may also help control normal blood sugar levels, exemplary ingredients include powdered forms and extracts from cinnamon, ginseng, various probiotics, aloe vera, gymnema sylvestre, and alpha lipoic acid, and berberine, and trivalent chromium complexed with one or more ligands. Other agents also contemplated include those that promote and / or maintain a ketogenic state, and particularly preferred agents include β-hydroxybutyrate, butyric acid, tributyrin, acetoacetate, and the like.

[0077] Most typically, the contemplated composition is administered over an extended period of time in at least a single therapeutically effective dose per day. For example, the composition may be administered for at least 3 days, or at least 7 days, or at least 2 weeks, or at least 4 weeks, or at least 2 months, or at least 3 months, or even more than 3 months. Preferably, but not necessarily, administration is with meals, but may also be used on an empty stomach.

[0078] Example

[0079] The following examples are provided to illustrate selected physiological markers and / or physiological processes that can be beneficially and, at least in some cases, synergistically regulated by the compositions proposed herein. However, these examples are not intended to limit the subject matter of the present invention, and other and / or alternative markers and processes are also clearly contemplated herein. Unless otherwise indicated, the measurement of these markers is known in the art and will follow known protocols.

[0080] Animal Studies. All in vivo studies used Wistar rats and were maintained on a high fat / high cholesterol diet for 9 weeks. The animals were then divided into two groups, the control group continued the high fat / high cholesterol diet and regular water, while the treatment group continued the high fat / high cholesterol diet and water containing DDA (dodecanedioic acid) at 1% of caloric intake. Figure 1 The schematic scheme of the study is shown in Figure 1. After all animals were divided into their respective test groups, body weights were recorded and glucose challenge tests were performed. Figure 2 As shown in Figure 2, there were no significant differences in body weight between the two groups. However, the response to the glucose challenge clearly demonstrated that very low concentrations of DDA in the diet had a positive effect on glucose metabolism. Figure 2 As shown, the blood glucose peak in the DDA group was significantly attenuated, and the blood glucose AUC was also significantly reduced. This effect was particularly unexpected because the amount of DDA in the food was far lower than any reasonably expected amount.

[0081] In addition, the inventors unexpectedly found that low concentrations of DDA had a significant liver protective effect in a high-fat / high-cholesterol diet, such as Figure 3More specifically, in the liver tissues of rats fed a high-fat / high-cholesterol diet, lipid vesicle cell size / expansion and overall tissue morphology showed characteristics of non-alcoholic steatohepatitis (NASH) under H&E staining, while the cells and liver tissues of rats fed a high-fat / high-cholesterol diet containing DDA were significantly closer to normal liver histological features. Similarly, when the liver tissues were stained with Oil Red (ORO) to demonstrate the presence or absence of fat deposits, obvious fat deposits were observed in the liver tissues of rats fed a high-fat / high-cholesterol diet, while the liver tissues of rats fed the same high-fat / high-cholesterol diet containing low doses of DDA had a normal or near-normal appearance under the microscope.

[0082] Similarly, when tissue sections were stained with Sirius red to indicate liver collagen, a marker of fibrosis, the results again clearly showed that rats fed a high-fat / high-cholesterol diet had significantly increased fibrosis compared to rats whose diets contained low concentrations of DDA. While not wishing to be bound by any particular theory or hypothesis, the inventors hypothesize that low levels of DDA inhibit the transdifferentiation of hepatic stellate cells into fibroblasts that produce extracellular matrix proteins, including collagen, perhaps by protecting them from damage by reactive oxygen species (ROS). Therefore, it should be understood that low doses of DDA have a significant hepatoprotective effect in the presence of a high-fat / high-cholesterol diet, even though they clearly do not contribute meaningfully to caloric intake.

[0083] Previous experimental data suggest that DDA has a regulatory effect on metabolism when it makes a significant contribution to caloric intake (about 15%; equivalent to a daily DDA intake of about 40 g in the human diet). In fact, such large amounts of DDA provide an important source for the production of acetyl-CoA, succinyl-CoA and ATP. Therefore, any metabolic effect of the above amounts (about 1% of caloric intake) cannot be reasonably expected based on such high DDA amounts. However, if Figure 2 The results of this study suggest that low-dose DDA does have a profound effect on glycemic control even in the presence of a high-fat / high-cholesterol diet.

[0084] Based on these unexpected results, the inventors sought to determine whether DDA also has an effect on oxidative stress resilience, protection from DNA damage under oxidative stress, and whether DDA has a beneficial effect on epigenetic modifications (particularly acetylation through SIRT) and mitochondrial biogenesis. Considered from a different perspective, DDA is also thought to affect processes associated with health maintenance during aging and / or during oxidative damage.

[0085] To this end, the inventors used endothelial cells (EOMA cells) and hepatocytes (AML-12 cells) in vitro, and quantified various markers that responded when the cells were exposed to environmental challenges in the presence and absence of low concentrations of DDA. Unless otherwise stated, the DDA concentration in the in vitro experiments was 5 micrograms per microliter. More specifically, the inventors measured p-H2AX protein levels as a marker of DNA damage, PGC-1α protein levels as a marker of mitochondrial biogenesis, NAMPT enzyme levels as a potential marker of NAD+ production, and total antioxidant capacity as a marker of cell health. In addition, the inventors also measured overall SIRT activity as a measure of all SIRT enzyme activity, in particular SIRT1 enzyme levels as a marker of autophagy and various beneficial processes associated with a calorie-restricted diet, and SIRT3 levels as a marker of mitochondrial function and lifespan.

[0086] The antioxidant activity in hepatocytes was detected, and the exemplary results are shown in Figure 5 As shown. It is easy to see that the data show that 6 hours of DDDA treatment (in the presence of hydrogen peroxide) maintained the total antioxidant capacity of the cells (p = 0.001). The same trend was also evident after 24 hours of treatment in the presence of hydrogen peroxide, although it did not reach a significant level (N = 5 to 6 plates per treatment). Therefore, at least under acute conditions, DDA (also referred to herein as DDDA) was observed to have potent antioxidant activity after 6 hours, indicating that DDA provides significant protection and supports cell health.

[0087] In other experiments, the overall SIRT activity of hepatocytes was also tested, and exemplary results are shown in Figure 6 As shown. In this case, the data show that 6 hours of DDDA treatment (in the presence of hydrogen peroxide) increased global SIRT activity in a statistically significant manner (p<0.001). The same trend was also evident after 24 hours of treatment in the presence of hydrogen peroxide (p=0.065), although it did not reach significant levels (N=5 to 6 plates per treatment). Therefore, at least under acute conditions, DDA again significantly increased global SIRT activity, demonstrating improved stress resilience, autophagy, and extended lifespan.

[0088] The inventors also evaluated the activity of DDA on energy metabolism, in particular on mitochondrial health and / or mitochondrial biogenesis. The next protein was the known marker of mitochondrial biogenesis, PGC-1α, and exemplary results are shown in Figure 7As shown. In this case, the data show that after 6 hours, DDDA increased PGC1a levels (p=0.001). Notably, this pattern was reversed after 24 hours of treatment (N=5 to 6 plates per treatment). In summary, these data suggest that the rapid upregulation of this marker induced by DDDA may lead to negative feedback, in this case (after 24 hours of treatment) the marker returned to baseline. This finding is not entirely unexpected, as PGC-1α is a transcriptional coactivator and is therefore tightly regulated. Therefore, the data suggest that DDDA can produce a strong positive stimulation of mitochondrial biogenesis.

[0089] To evaluate the effect of DDDA on energy metabolism, in particular on NAD+ synthesis, the inventors also tested the effect of DDDA on NAMPT in hepatocytes. Figure 8 Exemplary results are shown. As can be seen from the figure, the data show that after 6 hours of DDDA treatment, NAMPT enzyme levels were significantly increased (p = 0.001; N = 5 to 6 plates per treatment). It is worth noting that this pattern was reversed after 24 hours of treatment. Figure 7 These data suggest that the rapid upregulation of this marker induced by DDDA may have led to a negative feedback loop, in which case (after 24 hours of treatment) this marker returned to baseline. Thus, DDDA could have a potential stimulatory effect on NAMPT enzyme regulation, thereby affecting NAD+ levels.

[0090] In other experiments, the inventors also investigated whether DDDA has a stimulatory effect on selected SIRT proteins. More specifically, the inventors tested the effects of DDDA on SIRT3 and SIRT1, and the exemplary results are shown in Table 1. Fig. 9 and Fig.10 As shown. Fig. 9 As can be seen, the data showed that SIRT3 protein levels were significantly increased after 24 hours of exposure to DDDA (p = 0.028). Fig.10 The reason why the overall SIRT activity of cells treated with DDDA for 24 hours showed an upward trend (p = 0.065) was observed in the results. N = 5 to 6 plates for each treatment. Fig.10 As shown, the data indicate that SIRT1 levels showed an increasing trend after 6 hours of exposure to DDDA (p=0.127). However, other than this trend, no other significant observations were observed. N=5 to 6 plates per treatment.

[0091] Finally, the inventors also investigated whether DDDA has a protective effect on peroxide-induced DNA damage, and the exemplary results are shown in Fig.11In this case, it can be easily seen that a trend of reduced DNA damage was observed after 6 hours of exposure to DDDA (p = 0.068), which is consistent with Figure 5 N = 5 to 6 plates per treatment.

[0092] In another series of experiments, the inventors also wanted to confirm whether DDDA has a regulatory effect in endothelial cells using the same markers and experimental conditions as above.

[0093] Regarding antioxidant capacity, Fig.12 Exemplary results are described. As can be seen from the data, after 24 hours of exposure to DDDA (in the presence of hydrogen peroxide), the total antioxidant capacity of the cells was maintained (p=0.001). These data confirm and reiterate the results found in hepatocytes, so it is necessary to study how DDDA protects against oxidative stress in vivo. N=5 to 6 plates per treatment.

[0094] The overall SIRT activity was detected in endothelial cells, and the exemplary results are shown in Fig.13 As shown. In this case, the data showed that overall SIRT activity was significant after 6 hours (in the presence of hydrogen peroxide) and 24 hours (in the absence of hydrogen peroxide) exposure to DDDA (p=0.03 and p=0.044, respectively). These data again confirm and reiterate the results found in hepatocytes and demonstrate the need to study how DDDA affects SIRT activity in vivo. N=5 to 6 plates per treatment.

[0095] Fig.14 Exemplary results for PGC-1α are shown. It is noteworthy that while PGC-1α was affected by exposure to DDDA, endothelial cells did not show statistically significant differences (N=5 to 6 plates per treatment). On the other hand, when endothelial cells were exposed to DDDA, there were significant differences in NAMPT enzyme levels, such as Fig.15 As shown in the example. In this case, the data show that 6 hours of DDDA treatment increased NAMPT enzyme levels (p = 0.018; N = 5 to 6 plates per treatment). Similar to hepatocytes, these data strongly suggest that DDDA has a potential effect on NAMPT enzyme regulation and NAD+ levels.

[0096] Regarding specific SIRT proteins, the inventors tested SIRT3, and exemplary results are shown in Fig.16 In this case, exposure to DDDA resulted in a strong and dramatic increase in SIRT3, followed by a significant decrease after 24 hours, indicating that SIRT3 expression is tightly regulated. Nevertheless, the 6-hour data in this case could explain why Fig.13Upregulation was observed in the global SIRT activity of cells treated with DDDA for 24 hours in 5% paraformaldehyde (p=0.044). N=5 to 6 plates per treatment.

[0097] Finally, the inventors also evaluated DNA damage in endothelial cells after H2O2-induced oxidative damage, and the exemplary results are shown in Fig.17 These data indicate that 6 hours of DDDA treatment numerically reduced DNA damage, although the p value was > 0.100. These data are in principle consistent with the antioxidant data in endothelial cells and the DNA damage and antioxidant data in hepatocytes. N = 5 to 6 plates per treatment.

[0098] Based on its beneficial safety and solubility characteristics and its significant antioxidant potential, the inventors further hypothesized that oral administration of dodecanedioic acid (e.g., in the form of a sodium salt) could prevent and reverse NASH attacks by reducing liver oxidative stress. To this end, the inventors conducted two independent studies in rats to understand whether dodecanedioic acid (DODA) could prevent NASH (Study 1) and / or reverse NASH (Study 2). In the first study, DODA was administered with a high-fat, high-cholesterol diet for 4 weeks, while in the second study, rats were first fed a high-fat, high-cholesterol diet for 9 weeks to induce NASH, and then DODA was administered for 4 weeks to evaluate its possible reversal. In both studies, the presence of NASH was confirmed by liver histology. In addition, the inventors used primary hepatocytes and HSCs to study the role of DODA in the activation of hepatic stellate cells.

[0099] Animal studies

[0100] Study Design: All animal procedures were approved by the Institutional Animal Care Committee of the Catholic University of Rome. Fig.18 The study design is summarized in Panels A and B of .

[0101] Study 1: Twenty adult Wistar rats aged 8 to 10 weeks were enrolled in the study. The rats were housed in individual cages at 22°C with a 12-h light cycle and free access to food and water. The rats were fed a high-fat, high-cholesterol diet (44% carbohydrates, 14% protein, 42% fat + 0.2% cholesterol) (Mucedola, Milan, IT) with or without 1 (wt / vol)% sodium salt of dodecanedioic acid dissolved in water for 4 weeks ( Fig.18 , Figure A). Body weight and food / water intake were monitored weekly.

[0102] Study 2: Twenty adult Wistar rats aged 8 to 10 weeks were enrolled in the study. The rats were housed in individual cages at 22°C with a 12-h light cycle and free access to food and water. The rats were fed a high-fat, high-cholesterol diet (44% carbohydrates, 14% protein, 42% fat + 0.2% cholesterol) (Mucedola, Milan, IT). After nine weeks of the diet, the rats were randomly assigned to one of the following groups: four weeks of a high-fat, high-cholesterol diet or four weeks of a high-fat, high-cholesterol diet and 1 (wt / vol)% sodium salt of dodecanedioic acid dissolved in water ( Fig.18 , Figure B). Body weight and food / water intake were monitored weekly.

[0103] Oral Glucose Tolerance Test (OGTT): At the end of the study, all animals underwent an OGTT. After an overnight fast, rats received a 50% D-glucose solution (1 g / kg body weight) by oral gavage. Blood samples were collected by tail bleeding and collected in EDTA tubes. All blood samples were immediately centrifuged and the plasma was divided into appropriate subsamples and stored at -20°C for further analysis. Blood glucose was measured at 0, 20, 40, 60, 80, 100 and 120 minutes, while plasma insulin was measured at 0, 60 and 120 minutes. Blood glucose levels were detected by a glucometer (Accu-Chek, Roche Diagnostics Division, Grenzacherstrasse, CH). Plasma insulin was measured by ELISA (EMD Millipore Corporation, Billerica, MA) with a sensitivity of 0.1 ng / ml and intra- and inter-plate precisions of 1.9% and 7.6%, respectively.

[0104] Histology: On the day of sacrifice, fresh liver sections were excised, embedded in cryosection embedding medium (OCT), and snap frozen in liquid nitrogen. Biopsies were cut using a cryostat (5 μm) and slides were stored at -20°C until analysis.

[0105] Hematoxylin and eosin staining was used to evaluate hepatic steatosis. Slides were fixed with 95% ethanol for 10 min, stained with hematoxylin for 1 min, washed with distilled water, stained with eosin for 30 s, and cleared in two changes of pure ethanol and two changes of xylene.

[0106] Oil Red O was used to assess intracellular lipid accumulation. Slides were fixed with 4% formalin overnight and stained with Oil Red O solution for 1 hour. Counterstaining was performed using hematoxylin solution.

[0107] Liver fibrosis was identified using Sirius red. The slides were fixed with 4% formalin for 10 minutes, stained with direct red 80 for 1 hour, washed with acidified water, and dehydrated in 3 changes of absolute ethanol. After a brief transparency in xylene, the slides were embedded in a resin medium. Images were taken using an optical microscope (Leica DM2000, Wetzlar, DE). All reagents used for histological analysis were obtained from Sigma-Aldrich (St. Louis, MO).

[0108] In vitro experiments

[0109] Primary hepatocytes: Hepatocytes were isolated by a two-step collagenase perfusion method (6). Briefly, the inferior vena cava (IVC) was cannulated using a 24-gauge 3 / 4-inch angiocatheter (BD), and the portal vein was cut. The liver was perfused via the IVC with 100 mL of liver perfusion medium (Invitrogen) at 37°C, followed by perfusion with 100 mL of type IV collagenase (Sigma-Aldrich, St. Louis, MO) in Hank's balanced salt solution (HBSS, containing calcium and magnesium; GIBCO). After liver digestion, it was dissected out and cut into small pieces, then passed through a 100 μm filter (Falcon). Stem cells were separated from non-parenchymal cells (NPCs) by low-speed centrifugation (50 g × 5 min) and further purified by Percoll gradient centrifugation (50 vol / vol%, Sigma).

[0110] Nile Red: Cells were cultured in DMEM containing 10% FBS for 24 hours. Before stimulation, cells were incubated in serum-free DMEM medium overnight. To assess lipid droplet accumulation, primary hepatocytes were stimulated for 24 hours with complete DMEM medium supplemented with palmitic acid (0.4 mM) and with or without 1 (weight / volume)% sodium salt of dodecanedioic acid. After stimulation, cells were stained with Nile Red (100 ng / mL) for 45 minutes. The stained cells were used for immunofluorescence to quantify the deposition of lipid droplets. Nuclear staining was performed using DAPI, lipid droplet images were taken using a confocal microscope Nikon A1 RHD25, and images were analyzed using NIS-Elements imaging software.

[0111] Palmitic acid treatment and conditioned medium preparation: A 100 mM palmitate stock solution was prepared in 0.1 mM NaOH by heating to 70°C. A 10 (wt / vol)% FFA-free BSA (Sigma) solution was prepared in ddH2O and maintained in a 55°C water bath. A 10 mM FFA / 1% BSA solution was obtained by complexing the appropriate amount of palmitate stock solution with 10% BSA at 55°C for 30 minutes. The above solution was then cooled to 25°C, filter sterilized, and stored at -20°C until use. Primary hepatocytes were grown in DMEM supplemented with palmitate (0.4 mM). After 24 hours, CM was clarified by centrifugation at 6000 g to remove cell debris, sterile filtered with a 0.45 μm pore size membrane filter, and stored in aliquots at -20°C until use.

[0112] Hepatic stellate cells: Primary hepatic stellate cells were isolated from Wistar rats as described previously (7). Briefly, the rat peritoneum was surgically opened under anesthesia, and the liver was perfused via the IVC with 0.5 mM EGTA, after which the portal vein was cut and the upper end of the IVC was clamped. Two minutes later, the liver was perfused with a pronase (Roche, Basilea, CH) solution for 5 minutes, followed by a collagenase-B (110888831001, Roche) solution for 7 minutes. The liver was removed, minced in a pronase / collagenase / DNase I (Roche, Basilea, CH) solution for 24 minutes, and then passed through a 70 μm cell strainer. The hepatocytes were centrifuged and washed twice in Grignard balanced salt solution (GBSS), and then HSCs were separated by density gradient using iohexol (Histodenz) (Sigma-Aldrich, St. Louis, MO) solution. After centrifugation, HSCs at the interface were collected. Cells were cultured in DMEM containing 10% FBS for 48 hours. To induce fibrogenic activation and mitochondrial oxidative stress, primary HSCs were incubated with conditioned medium obtained from steatotic primary hepatocytes for 3 days (8). HSC activation was assessed by flow cytometry to evaluate the protein expression of α-smooth muscle actin (α-SMA) and type I collagen α1 (COL1A1). α-SMA antibody and COL1A1 antibody were obtained from ThermoFisher scientific (Waltham, MA). Flow cytometric analysis was performed using CytoFlex (Beckman Coulter, Brea, CA), and data analysis was performed using Kaluza software (Beckman Coulter, Brea, CA).

[0113] Statistical analysis: Due to the relatively small number of animals and because many variables were not normally distributed, the inventors used nonparametric tests. To compare the results between the two groups, the inventors used the Mann-Whitney U test. Repeated measures analysis of variance was used to compare blood glucose levels and plasma insulin levels during the OGTT. Unless otherwise stated, data are expressed as mean ± SEM. Statistical significance was set at P < 0.05 (two-tailed).

[0114] result

[0115] DODA administration prevents the onset of insulin resistance and NASH: To test the hypothesis that DODA can prevent the development of diet-induced insulin resistance and NASH, the inventors added 1 (weight / volume)% DODA to the drinking water and administered it together with a high-fat-high-cholesterol diet for 4 weeks. Rats that were not administered DODA but were fed a high-fat-high-cholesterol diet served as a control group.

[0116] When compared with the control group, rats treated with DODA showed decreased blood glucose concentrations and plasma insulin concentrations during an oral glucose tolerance test ( Fig.19 , Figures A and B). Consistently, the DODA group showed a reduction in hepatic insulin resistance as assessed by HOMA-IR ( Fig.19 , Figure C). Histological analysis of liver markers of NASH showed that DODA treatment reduced hepatic steatosis, neutral lipid deposition, and fibrosis ( Fig. 20 , Figures A to F).

[0117] Together, these data suggest that DODA treatment can protect against diet-induced insulin resistance and NASH.

[0118] DODA administration reverses insulin resistance and NASH: To evaluate whether DODA can reverse the development of diet-induced insulin resistance and NASH, rats were first fed a high-fat, high-cholesterol diet for 9 weeks to develop insulin resistance and NASH. After 9 weeks of dietary treatment, DODA was administered for 4 weeks to evaluate the reversal of insulin resistance and NASH. Rats that were not administered DODA but were fed a high-fat, high-cholesterol diet served as a control group.

[0119] DODA treatment resulted in a decrease in blood glucose and plasma insulin concentrations during an oral glucose tolerance test ( Fig.21 , Panels A and B) and reversed insulin resistance as assessed by HOMA-IR ( Fig.21 , Figure C). Histological analysis showed that DODA treatment reversed the effects of diet-induced NASH by reducing hepatic steatosis, neutral lipids, and fibrosis ( Fig. 22 , Figures A to F).

[0120] These results suggest that DODA treatment can reverse diet-induced insulin resistance and NASH.

[0121] DODA-induced HSC apoptosis contributes to the regression of liver fibrosis: Previous studies have shown that the reversal of liver fibrosis leads to a decrease in fibroblasts, and this decrease is associated with increased fibroblast apoptosis. In addition, inducing fibroblast apoptosis by pharmacological methods accelerated fibrosis regression, suggesting that apoptosis has a causal role in this process.

[0122] To investigate the effect of DODA treatment on HSC, the main fibrogenic cell type in the liver, the inventors used conditioned medium (CM) from steatotic hepatocytes to induce HSC activation in the presence or absence of 1 (weight / volume)% DODA. Two days after isolation, rat primary HSCs were exposed to CM from palmitate-treated hepatocytes for 3 days and then incubated with DODA for 24 hours. Fig.23 Shown are exemplary results showing the accumulation of lipid droplets in primary hepatocytes in vitro by Nile red staining of (0.4 mM) palmitate-treated primary hepatocytes incubated in the presence or absence of 1 (wt / vol) % DODA.

[0123] Subsequently, protein expression of two established HSC activation markers, type I collagen (COLA1A) and α-smooth muscle actin (αSMA), was determined by flow cytometric analysis. HSCs exposed to CM from steatotic hepatocytes combined with DODA exhibited lower expression of COLA1A and α-SMA when compared to HSCs not incubated with DODA (9.18% vs. 25.15%) ( Fig.24 , Figures A and B). Next, the inventors analyzed the effect of DODA on HSC apoptosis. Propidium iodide staining and flow cytometry evaluation showed that HSCs treated with CM from steatotic hepatocytes together with DODA showed increased cell death (16.16% vs. 8.39%) ( Fig.24 , Figures C and D).

[0124] Further testing can be performed to evaluate the effects of the envisioned compounds and compositions on metabolism, the gut microbiome, and aging, as detailed below.

[0125] Metabolism: The contemplated compositions can be administered to healthy subjects or subjects suffering from or diagnosed with metabolic disorders such as dyslipidemia, loss of insulin sensitivity, prediabetes, type 2 diabetes, obesity, fatty liver (NASH). It should also be noted that such subjects may have a normal average daily caloric intake or have dietary behavior characteristics of overnutrition (see, e.g., J Gerontol A Biol Sci Med Sci. 2021 Sep 13; 76(10): 1714-1725). Thus, one or more of the following biomarkers will be tracked on an acute (e.g., T0, 30 minutes, 60 minutes, 90 minutes, 120 minutes, 180 minutes, 240 minutes) and long-term (e.g., T0, 1 day, 3 days, 7 days, 14 days, 21 days, 30 days) basis: fasting / average, postprandial glucose levels and insulin levels, HbA1c, HOMA-IR, triglycerides, total / HDL / oxLDL / LDL cholesterol, lipid particle size, homocysteine, FGF21 expression, SIRT1 expression, body weight, BMI, visceral fat, serum ALT levels, AST levels, GST levels, BUN levels, creatinine levels, ketone body levels, and blood pressure levels.

[0126] Intestinal microbiome: A human intestinal microbial simulation ecosystem (Simulator of the Human Intestinal Microbial Ecosystem, SHIME: see, for example, Verhoeckx K, Cotter P, López-Expósito I et al., ed. "The Impact of Food Bioactives on Health: in vitro and ex vivo models". Cham (CH): Springer; Chapter 27 of 2015) can be used. Advantageously, this in vitro model reduces the impact of other physiological processes that may interfere with the effects of polyamines on the microbiota. However, in the case where in vivo conditions are preferably observed, it should be understood that fecal samples and 16S rRNA sequencing can be used to track the microbiome, as is known in the art. Therefore, microbiome detection will reveal changes in species / families / orders of microorganisms (e.g., increased abundance of Firmicutes, decreased abundance of Bacteroides) and changes in the overall diversity of microorganisms. Furthermore, other parameters that can be obtained from such in vivo and in vitro tests include in particular the quantification of short chain fatty acids (SCFA), butyrate-producing bacteria or bifidobacteria-producing bacteria, and ketone bodies such as (hydroxy)butyrate, acetate, acetoacetate, propionate in the intestine.

[0127] The aging process can also be followed quantitatively by detecting a variety of markers that are generally associated with caloric restriction, and particularly contemplated markers include Sirtuin 1 activation, inhibition of insulin / insulin growth factor signaling, etc. (see, e.g., Cell. 2011 Sep 2; 146(5):682-95).

[0128] Efficacy of dodecanedioic acid treatment in preventing and reversing NASH

[0129] In the United States alone, the number of NAFLD cases is expected to grow from 83 million in 2015 to 101 million by 2030, with 27% of cases meeting criteria for NASH. As disease prevalence rises, so too does the number of individuals with both cirrhosis and end-stage liver disease requiring liver transplantation.

[0130] Nonalcoholic steatohepatitis (NASH) is a proinflammatory state that leads to activation of hepatocytes, Kupffer cells (KC), and hepatic stellate cells (HSC). Although the exact cause of NAFLD is still unclear, recent studies have shown that increased mitochondrial oxidation rates in the liver can lead to increased reactive oxygen species (ROS) formation and promote the progression of NAFLD to NASH by activating hepatic stellate cells (HSC). ROS-activated HSC undergo phenotypic conversion and deposit excessive extracellular matrix, thereby altering the normal liver architecture and leading to liver fibrosis.

[0131] The histological hallmark of NASH is liver fat accumulation, which is usually associated with increased fatty acid delivery, enhanced de novo lipogenesis (DNL), and reduced lipid deposition through fatty acid oxidation. Several clinical studies have shown that the DNL rate in NASH is elevated, accounting for approximately 20% to 30% of fat accumulation in the liver, compared to approximately 5% to 10% in the physiological state, indicating that DNL plays an integral role in the progression of NASH.

[0132] Cytosolic citrate is a key precursor and regulator of de novo fatty acid synthesis and is considered an important metabolite linking glucose metabolism and lipid metabolism. In fact, citrate inhibits phosphofructokinase (PFK), thereby reducing glycolytic flux and promoting polymerization, which activates acetyl-CoA carboxylase (ACC), the enzyme that catalyzes the rate-limiting step in DNL. The Na+-coupled dicarboxylate transporter NaCT (gene SLC13A5) from the SLC13 family mediates the transport of citrate into cells and plays an important role in determining the cytosolic citrate concentration.

[0133] SLC13a5 knockout (KO) mice exhibited improved glycemic control, which could be attributed to the inhibition of glucose production. Moreover, SLC13a5 KO mice fed a high-fat diet (HFD) exhibited a decrease in body weight and hepatic lipid concentrations compared to their wild-type counterparts. Furthermore, dicarboxylates may be able to inhibit NaCT-mediated cellular citrate uptake in vitro and in vivo. Therefore, inhibition of NaCT may be a beneficial strategy for the treatment of metabolic diseases and NASH.

[0134] Currently, there are no FDA-approved drug treatments for NAFLD. In recent years, dicarboxylic acids (DA) have attracted great interest in their potential health benefits due to their wide range of therapeutic possibilities. Unlike homologous fatty acids, DA is soluble in water in the form of salts and has been shown to be safe for both experimental animals and humans. Dodecanedioic acid (referred to herein as C12 or DDDA, these terms are used interchangeably throughout the disclosure), which belongs to the family of straight-chain dicarboxylic acids, is β-oxidized to CO2 and H2O by forming acetyl-CoA and succinyl-CoA. The inventors studied whether oral administration of the sodium salt of dodecanedioic acid can prevent and / or reverse NASH attacks. The inventors envision that C12 can inhibit NaCT by reducing citrate uptake, thereby alleviating ectopic fat accumulation in the liver.

[0135] To this end, the inventors conducted two independent studies in rats to understand whether C12 can protect (Study 1) and / or reverse (Study 2) NASH. In the first study, C12 was administered for 4 weeks together with a high-fat-high-cholesterol diet, while in the second study, rats were first fed a high-fat-high-cholesterol diet for 9 weeks to form NASH, and then C12 was administered for another 4 weeks to evaluate its reversal effect. In both studies, the presence of NASH was assessed by liver histology. Finally, the inventors also conducted two in vitro studies to investigate the role of C12 in the activation of primary human hepatic stellate cells and to understand whether C12 could reduce citrate uptake in primary human hepatocytes by reducing the expression of the citrate transporter NaCT.

[0136] method

[0137] Animal studies, study design

[0138] exist Fig.25 The study design is summarized in Panels A and B of .

[0139] Study 1: Twenty adult Wistar rats aged 8 to 10 weeks were enrolled in the study. The rats were housed in individual cages at 22°C with a 12-h light cycle and free access to food and water. The rats were fed a high-fat, high-cholesterol diet (44% carbohydrates, 14% protein, 42% fat + 0.2% cholesterol) with or without 1% sodium salt of dodecanedioic acid dissolved in water for 4 weeks ( Fig.25 , Figure A). Body weight and food / water intake were monitored weekly.

[0140] Study 2: Twenty adult Wistar rats aged 8 to 10 weeks were enrolled in the study. The rats were housed in individual cages at 22°C with a 12-h light cycle and free access to food and water. The rats were fed a high-fat-high-cholesterol diet (44% carbohydrates, 14% protein, 42% fat + 0.2% cholesterol). After 9 weeks of the diet, the rats were randomly assigned to one of the following groups: 4 weeks of high-fat-high-cholesterol diet or 4 weeks of high-fat-high-cholesterol diet and 1% sodium salt of dodecanedioic acid dissolved in water ( Fig.25 , Figure B). Body weight and food / water intake were monitored weekly.

[0141] Oral Glucose Tolerance Test (OGTT): At the end of the study, all animals underwent an OGTT. After an overnight fast, all rats received a 50% D-glucose solution (1 g / kg body weight) by oral gavage. Blood samples were collected by tail bleeding and collected in EDTA tubes. All blood samples were immediately centrifuged and the plasma was divided into appropriate subsamples and stored at -20°C for further analysis. Blood glucose and plasma insulin were measured at 0, 20, 40, 60, 80, 100 and 120 minutes. Blood glucose levels were measured by a glucometer. Plasma insulin was measured by ELISA with a sensitivity of 0.1 ng / ml and intra- and inter-plate precision of 1.9% and 7.6%, respectively.

[0142] Histology: On the day of sacrifice, fresh liver sections were excised, embedded in cryosection embedding medium (OCT), and snap frozen in liquid nitrogen. Biopsies were cut using a cryostat (5 μm) and slides were stored at -20°C until analysis.

[0143] Hematoxylin and eosin staining was used to assess hepatic steatosis. Slides were fixed with 95% ethanol for 10 min, stained with hematoxylin for 1 min, washed with distilled water, stained with eosin for 30 s, and cleared in two changes of pure ethanol and two changes of xylene.

[0144] Oil Red O was used to assess intracellular lipid accumulation. Slides were fixed with 4% formalin overnight and stained with Oil Red O solution for 1 hour. Counterstaining was performed using hematoxylin solution.

[0145] Liver fibrosis was identified using Sirius red. Slides were fixed with 4% formalin for 10 min, stained with direct red 80 for 1 h, washed with acidified water, and dehydrated in 3 changes of absolute ethanol. After a brief clearing in xylene, the slides were embedded in resin medium. Images were taken using an optical microscope. All reagents used for histological analysis were obtained from Sigma-Aldrich.

[0146] Quantitative real-time PCR analysis

[0147] Total RNA was extracted from human primary hepatocytes using the RNeasy Plus Mini Kit according to the instructions provided by the company. A small aliquot (3 μl) of the obtained total RNA was taken for qualitative and quantitative control by using microdrop. The qualitative and quantitative evaluation of individual samples was determined using dedicated software. Total RNA was reverse transcribed into cDNA by using iScript RT. SYBR Green gene expression assay was performed according to the manufacturer's instructions using iQ TMThe PCR was performed using SYBR Green Supermix and CFX96 Touch real-time PCR detection system. To this end, the following primer pairs were used: solute carrier family 13 member 5 (SLC13A5) (forward 5'AGAGGCAGTGGTAGTCGTGT 3' (SEQ ID NO: 1) and reverse 5'TCCCCTTTAGCCCTTGTTCC 3' (SEQ ID NO: 2)), diacylglycerol O-acyltransferase 1 (DGAT1) (forward 5'CTACAGGGACTGGTGGAATGC 3' (SEQ ID NO: 3) and reverse 5'AGCAGGAGTAGGCCCCATAG 3' (SEQ ID NO: 4)), fatty acid synthase (FASN) (forward 5'GAATCCGCACAGGCTACCAA 3' (SEQ ID NO: 5) and reverse 5'CTGGGCTTCACCATCACCAT 3' (SEQ ID NO: 6)), carnitine palmitoyltransferase 1A (CPT1A) (forward 5'TGGGGAAGAGACAGACACCA 3' (SEQ ID NO: 3' (SEQ ID NO: 7) and reverse 5'ATCGTGGTAGAGCCAGACCT 3' (SEQ ID NO: 8)) and acetyl-CoA carboxylase (ACC1) (forward 5'CCACAACTACCATCACGCCT 3' (SEQ ID NO: 9) and reverse 5'CAGGAACTCAGAAGCCCAGAA 3' (SEQ ID NO: 10)). mRNA expression levels were normalized with β2-microglobulin (forward 5'AGGACTGGTCTTTCTATCTCTTGT 3' (SEQ ID NO: 11); and reverse 5'ACCTCCATGATGCTGCTTACA 3' (SEQ ID NO: 12)) and quantification of relative gene expression was calculated using the 2-ΔCT (comparative threshold) method, expressed as a percentage relative to baseline.

[0148] In vitro experiments

[0149] Isolation of primary rat hepatocytes: Hepatocytes were isolated by a two-step collagenase perfusion method. Briefly, the inferior vena cava (IVC) was cannulated using a 24-gauge 3 / 4-inch angiocatheter, and the portal vein was cut. The liver was perfused via the IVC with 100 mL of liver perfusion medium at 37°C, followed by perfusion of the liver with 100 mL of type IV collagenase in Hank's balanced salt solution (HBSS, containing calcium and magnesium; GIBCO). After liver digestion, it was dissected out and cut into small pieces, then passed through a 100 μM filter (Falcon). Stem cells were separated from non-parenchymal cells (NPCs) by low-speed centrifugation (50 g × 5 minutes) and further purified by Percoll gradient centrifugation (50 vol / vol%, Sigma).

[0150] Nile Red: Cells were cultured in DMEM containing 10% FBS for 24 hours. Before stimulation, cells were incubated in serum-free DMEM medium overnight. To assess lipid droplet accumulation, primary hepatocytes were stimulated for 24 hours using complete DMEM medium supplemented with palmitic acid (0.4 mM) and with or without 1 (weight / volume)% sodium salt of dodecanedioic acid. After stimulation, cells were stained with Nile Red (100 ng / mL) for 45 minutes. The stained cells were used for immunofluorescence to quantify the deposition of lipid droplets. Nuclear staining was performed using DAPI, lipid droplet images were taken using a confocal microscope Nikon A1 RHD25, and images were analyzed using NIS-Elements imaging software.

[0151] Palmitic acid treatment and conditioned media preparation: Prepare a 100 mM palmitate stock solution in 0.1 mM NaOH by heating to 70°C. Prepare a 10% (w / v) FFA-free BSA solution in ddH2O and maintain in a 55°C water bath. A 10 mM FFA / 1% BSA solution is obtained by complexing the appropriate amount of palmitate stock solution with 10% BSA at 55°C for an additional 30 minutes. The above solution is then cooled to 25°C, filter sterilized, and stored at -20°C until use.

[0152] Primary rat hepatocytes were grown in DMEM supplemented with palmitate (0.4 mM). BSA-treated cells without FFA (0.4 wt / vol%) served as controls. After 24 h, CM was clarified by centrifugation at 6000 g to remove cell debris, sterile filtered with a 0.45 μm pore size membrane filter, and stored in aliquots at -20 °C until use.

[0153] Isolation of primary rat hepatic stellate cells: Primary hepatic stellate cells were isolated from Wistar rats. The rat peritoneum was surgically opened under anesthesia, and the liver was perfused with 0.5 mM EGTA via the inferior vena cava (IVC), after which the portal vein was cut and the upper end of the IVC was clamped. After 2 minutes, the liver was perfused with a pronase solution for 5 minutes and then with a collagenase-B solution for 7 minutes. The liver was removed, minced in a pronase / collagenase / DNase I (10104159001, Roche) solution for 24 minutes, and then passed through a 70 μm cell filter. The hepatocytes were centrifuged and washed twice in Grignard balanced salt solution (GBSS), and then density gradient separation of HSCs was performed using an iohexol solution. After centrifugation, HSCs at the interface were collected. The cells were cultured in DMEM containing 10% FBS for 48 hours. To induce fibrogenic activation and mitochondrial oxidative stress, primary HSCs were incubated for 3 days with conditioned medium obtained from steatotic primary hepatocytes.

[0154] HSC activation was assessed by flow cytometry to evaluate the protein expression of α-smooth muscle actin (α-SMA) and type I collagen α1 (COL1A1). α-SMA antibody and COL1A1 antibody were obtained from Thermo Fisher scientific. Flow cytometry analysis was performed using CytoFlex and data analysis was performed using Kaluza software.

[0155] Isolation of human primary hepatocytes: Tissue obtained during percutaneous liver biopsy was diced (<3 mm) and washed in HBSS to remove excess blood. The tissue was then transferred to a tube containing preheated EGTA buffer (HBSS, 0.5 mM EGTA, 0.5% fatty acid-free bovine serum albumin (BSA)) and shaken (100 rpm) for 10 minutes in a 37°C water bath with a shaker. After three washes, to remove residual blood and EGTA, the tissue was placed in preheated digestion buffer (HBSS, 0.05% collagenase IV, 0.5% fatty acid-free BSA, 10 mM CaCl2) and shaken (100 rpm) for 10 minutes in a 37°C water bath with a shaker. The digested tissue was filtered through a 100 μm cell strainer, and the remaining tissue was digested again in fresh digestion buffer (20). The cell suspension was combined and centrifuged at 80 g for 5 minutes at 4°C, and the supernatant was discarded. Cells were grown to confluence and used for citrate uptake analysis.

[0156] In vitro citrate uptake: Primary human hepatocytes were incubated for 30 minutes in the presence or absence of sodium salt of dodecanedioic acid (0.1% w / v, 0.25% w / v, 0.5% w / v, 1% w / v, 1.5% w / v). After the incubation step, citrate was added at a final concentration of 150 μM for 40 minutes. At the end of stimulation, citrate uptake was assessed using a commercially available Citrate Assay Kit and data were analyzed using a Varioskan LUX multi-function microplate reader.

[0157] In vitro palmitic acid stimulation: Primary human hepatocytes were stimulated with palmitic acid (0.4 mM) for 24 h in the presence or absence of sodium salt of dodecanedioic acid (1 w / v %). At the end of stimulation, gene expression of de novo lipogenesis, fatty acid β-oxidation, and SLC13A5 was assessed by quantitative real-time PCR analysis.

[0158] Deuterated water for de novo lipogenesis assessment: Cells were incubated with palmitic acid (0.4 mM) for 24 h and incubated with or without sodium salt of dodecanedioic acid (1 weight / volume %) for 24 h. Cell culture medium was enriched with 10% deuterated water to assess de novo lipid synthesis and gluconeogenesis. Cell extracts and culture medium samples were snap frozen in liquid nitrogen and stored at -80°C for further analysis.

[0159] Statistical analysis: Due to the relatively small number of animals and because many variables were not normally distributed, nonparametric tests were used. To compare the results between the two groups, we used the Mann-Whitney U test. Blood glucose levels and plasma insulin levels during the OGTT were compared using repeated measures analysis of variance. Unless otherwise stated, data are expressed as mean ± SEM. Statistical significance was set at P < 0.05 (two-tailed).

[0160] result

[0161] C12 administration prevents the onset of insulin resistance and NASH: To test the hypothesis that C12 can prevent the development of diet-induced insulin resistance and NASH, we administered 1 (weight / volume)% C12 in drinking water together with a high-fat-high-cholesterol diet for 4 weeks. Rats that were not administered C12 but were fed a high-fat-high-cholesterol diet served as a control group.

[0162] When compared with the control group, C12-treated rats showed decreased blood glucose concentrations and plasma insulin concentrations during an oral glucose tolerance test ( Fig.26 , Figures A and B). Consistently, in the C12 group, hepatic insulin resistance assessed by HOMA-IR was alleviated ( Fig.26, Figure C). Histological analysis of liver markers of NASH showed that C12 treatment reduced hepatic steatosis, neutral lipid deposition, and fibrosis ( Fig. 27 , Panels A to F). Together, these data suggest that C12 treatment can prevent diet-induced insulin resistance and NASH.

[0163] C12 administration reverses insulin resistance and NASH: To evaluate whether C12 can reverse the development of diet-induced insulin resistance and NASH, rats were fed a high-fat-high-cholesterol diet for 9 weeks to develop insulin resistance and NASH. After 9 weeks of dietary treatment, C12 was administered for 4 weeks to evaluate the reversal of insulin resistance and NASH. Rats that were not administered C12 but were fed a high-fat-high-cholesterol diet served as a control group. C12 treatment resulted in a decrease in blood glucose concentrations and plasma insulin concentrations during an oral glucose tolerance test ( Fig.28 , Panels A and B) and reversed insulin resistance as assessed by HOMA-IR ( Fig.28 , Figure C). Histological analysis showed that C12 treatment counteracted the effects of diet-induced NASH by attenuating hepatic steatosis, neutral lipid accumulation, and fibrosis ( Fig.29 , Panels A to F). These results suggest that C12 treatment can reverse diet-induced insulin resistance and NASH.

[0164] C12-induced HSC apoptosis contributes to the regression of liver fibrosis: Previous studies have shown that reversal of liver fibrosis leads to a decrease in fibroblasts, and this decrease is associated with increased fibroblast apoptosis. In addition, induction of fibroblast apoptosis by pharmacological methods accelerated fibrosis regression, suggesting that apoptosis has a causal role in this process. To explore the effects of C12 treatment on HSCs, the main fibrogenic cell type of the liver, we used conditioned medium (CM) from steatotic rat primary hepatocytes in the presence or absence of 1 (wt / vol)% C12 to induce HSC activation. Two days after isolation, rat primary HSCs were exposed to CM from palmitate-treated hepatocytes for 3 days and then incubated with C12 for 24 hours. Subsequently, protein expression of two established HSC activation markers, type I collagen (COLA1A) and α-smooth muscle actin (αSMA), was determined by flow cytometric analysis. HSCs exposed to CM from steatotic hepatocytes combined with C12 exhibited lower expression of COLA1A and α-SMA (9.18% vs. 25.15%) when compared to HSCs not incubated with C12 ( Fig.30, Figures A and B). Next, we analyzed the effect of C12 on HSC apoptosis. HSC treated with CM from steatotic hepatocytes together with C12 showed increased cell death (16.16% vs. 8.39%) as assessed by propidium iodide staining and flow cytometry ( Fig.30 , Figures C and D). Meanwhile, C12-treated rats showed decreased expression of fibrosis-related genes (αSMA, COLA1A, and TGFβ) when compared with the control group ( Fig.30 , Figure E).

[0165] C12 reduces gene expression of the citrate transporter SLC13A5, thereby inhibiting citrate uptake: To test the hypothesis that C12 can inhibit citrate uptake, human primary hepatocytes were incubated with a fixed concentration of citrate (150 μM) in the presence or absence of C12 (0.1 vol / wt% to 1.5 vol / wt%). When compared to untreated cells, cells treated with 1 vol / wt% C12 and 1.5 vol / wt% C12 showed a significant reduction in citrate uptake ( Fig.31 , Figure A). In addition, human hepatocytes stimulated with 1% (v / w) C12 in combination with palmitic acid (0.4 mM) exhibited a significant decrease in gene expression of the citrate transporter SLC13A5 when compared to cells treated with palmitic acid (0.4 mM) alone ( Fig.31 , Figure B).

[0166] C12 reduces de novo lipogenesis and increases fatty acid oxidation in vitro and in vivo: To test the hypothesis that C12 can affect de novo lipogenesis and fatty acid β-oxidation, human primary hepatocytes were stimulated with palmitic acid (0.4 mM) in the presence or absence of 1 vol / wt% C12. We observed a decrease in lipid droplet deposition in human primary hepatocytes stimulated with 1 vol / wt% C12 in combination with palmitic acid (0.4 mM) when compared to cells treated with palmitic acid (0.4 mM) alone ( Fig.32 At the same time, we observed that the three key enzymes involved in de novo lipogenesis (ACC1, DGAT, and FASN) were significantly decreased, and the key enzyme involved in fatty acid β-oxidation (CPT1A) was significantly increased in primary human hepatocytes treated with 1% (v / w) C12 and palmitic acid (0.4 mM) when compared with cells treated with palmitic acid (0.4 mM) alone ( Fig.32 , Figures C and D). Similar results were observed in our in vivo experiments. In fact, when compared with the control group, C12-treated rats showed a decrease in key enzymes involved in de novo lipogenesis (ACC1, DGAT, and FASN) and a significant increase in a key enzyme in fatty acid β-oxidation (CPT1A) ( Fig.33, Panels A and B). In addition, C12-treated rats showed decreased gene expression of the citrate transporter SLC13A5 when compared with the control group ( Fig.33 , Panel C). The data from in vivo study 1 and in vivo study 2 were pooled together.

[0167] In some embodiments, the numerals for describing and claiming the amount, properties, such as concentration, reaction conditions, etc., of the expression components of certain embodiments of the present invention should be understood to be modified by the term "about" in some cases. Therefore, in some embodiments, the numerical parameters listed in the written description and the appended claims are approximate values, which can vary according to the desired properties sought to be obtained by a particular embodiment. The statement of the numerical range herein is intended only as a brief method for individually pointing out each individual value falling within the range. Unless otherwise specified herein, each individual value is incorporated into this specification as if it were individually pointed out herein.

[0168] As used herein, the term "administering" a pharmaceutical composition or drug refers to both direct and indirect administration of a pharmaceutical composition or drug, wherein direct administration of a pharmaceutical composition or drug is typically performed by a health care professional (e.g., physician, nurse, etc.), and wherein indirect administration includes the step of providing or making available the pharmaceutical composition or drug to the health care professional for direct administration (e.g., by injection, infusion, oral delivery, topical delivery, etc.). It should also be noted that the term "predicting" a condition, susceptibility to disease development, or response to a planned treatment is meant to encompass the act of predicting or predicting (but not treating or diagnosing) a condition, susceptibility, and / or response, including a subject's rate of progression, improvement, and / or duration of the condition.

[0169] All methods described herein can be performed in any suitable order, unless otherwise specified herein or the context is clearly contradictory. The use of any and all examples or exemplary language (e.g., "such as" or "for example") provided for certain embodiments herein is intended only to better illustrate the present invention, rather than to limit the scope of the present invention as claimed otherwise. Any language in the specification should not be construed to indicate that any unclaimed element is essential to the implementation of the present invention.

[0170] As used in this specification and throughout the claims that follow, plural references are not used unless the context clearly indicates otherwise. Furthermore, as used in this specification, the meaning of "in" includes "in" and "on", unless the context clearly indicates otherwise. Furthermore, as used herein, the term "coupled to" is intended to include direct coupling (where two elements coupled to each other are in contact with each other) and indirect coupling (where at least one additional element is located between the two elements), unless the context indicates otherwise. Therefore, the terms "coupled to" and "coupled with" are used as synonyms.

[0171] It should be obvious to those skilled in the art that, in addition to those modifications already described, there can be more modifications without departing from the inventive concept of this article. Therefore, except for the scope of the appended claims, the subject matter of the present invention is not limited. In addition, when interpreting the specification and claims, all terms should be interpreted in the broadest possible manner consistent with the context. In particular, the terms "comprise" and "comprising" should be interpreted as indicating elements, components or steps in a non-exclusive manner, indicating that the indicated elements, components or steps can exist, or be utilized, or be combined with other elements, components or steps that are not explicitly cited. When the specification or claims relate to at least one of something selected from A, B, C ... and N, the text should be interpreted as requiring only one element in the group, rather than A plus N, or B plus N, etc.

Claims

1. A liver protection composition comprising: A combination of a nutritionally or pharmaceutically acceptable carrier and a medium chain dicarboxylic acid; The therapeutically effective unit dose of the medium chain dicarboxylic acid provides no more than 5% of the standard daily caloric intake of a mammal.

2. The composition of claim 1, wherein the composition is formulated for oral administration.

3. The composition according to claim 2, wherein the composition is formulated as a ready-to-use drink or a solid supplement or powder.

4. The composition according to any one of the preceding claims, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

5. A composition according to any one of the preceding claims, wherein the therapeutically effective unit dose provides equal to or less than 3% of the standard daily caloric intake of a mammal.

6. A composition according to any one of the preceding claims, wherein the therapeutically effective unit dose provides equal to or less than 2% of the standard daily caloric intake of a mammal.

7. A composition according to any one of the preceding claims, wherein the therapeutically effective unit dose provides equal to or less than 1% of the standard daily caloric intake of a mammal.

8. The composition according to any one of the preceding claims, wherein the therapeutically effective unit dose comprises equal to or less than 5 g of medium chain dicarboxylic acid.

9. The composition according to any one of the preceding claims, wherein the therapeutically effective unit dose comprises equal to or less than 3 g of medium chain dicarboxylic acid.

10. The composition according to any one of the preceding claims, wherein the therapeutically effective unit dose comprises equal to or less than 1 g of a medium chain dicarboxylic acid.

11. The composition according to any one of the preceding claims, wherein the composition further comprises an additional hepatoprotective agent.

12. The composition according to claim 11, wherein the other hepatoprotective agent is silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvate derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theophylline and / or methyl macrocarpon.

13. The composition of any one of the preceding claims, wherein the therapeutically effective dose reduces the risk or progression of liver inflammation, liver steatosis and / or liver fibrosis in non-alcoholic steatohepatitis (NASH).

14. A composition according to any one of the preceding claims, wherein the therapeutically effective dose reduces postprandial glucose peak and / or postprandial total blood glucose AUC.

15. A composition according to any of the preceding claims, wherein the therapeutically effective dose stimulates mitochondrial biogenesis, increases SIRT levels, increases NAMPT levels, increases intracellular NAD+ levels, maintains antioxidant capacity and / or reduces DNA damage.

16. A method of reducing the risk or progression of liver inflammation, liver steatosis and / or liver fibrosis in non-alcoholic steatohepatitis (NASH) in a subject, comprising: administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof; wherein said therapeutically effective dose provides no more than 5% of said individual's standard daily caloric intake.

17. The method of claim 16, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

18. The method according to any one of claims 16 to 17, wherein the individual is a human.

19. The method of any one of claims 16 to 18, wherein the therapeutically effective dose is administered orally.

20. The method of any one of claims 16 to 19, wherein the therapeutically effective dose provides equal to or less than 3% of the standard daily caloric intake of a mammal.

21. The method of any one of claims 16 to 19, wherein the therapeutically effective dose provides equal to or less than 1% of a mammal's standard daily caloric intake.

22. The method of any one of claims 16 to 19, wherein the therapeutically effective dose comprises equal to or less than 5 g of medium chain dicarboxylic acid.

23. The method of any one of claims 16 to 19, wherein the therapeutically effective dose comprises equal to or less than 3 g of medium chain dicarboxylic acid.

24. The method of any one of claims 16 to 24, wherein the composition further comprises an additional hepatoprotectant.

25. The method of claim 24, wherein the other hepatoprotective agent is silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvate derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theophylline and / or methylcrocarpine.

26. The method of any one of claims 16 to 25, wherein administration of the therapeutically effective dose reduces postprandial glucose peak and / or postprandial total blood glucose AUC.

27. The method of any one of claims 16 to 26, wherein administration of the therapeutically effective dose stimulates mitochondrial biogenesis, increases SIRT levels, increases NAMPT levels, increases intracellular NAD+ levels, maintains antioxidant capacity, and / or reduces DNA damage.

28. A method for regulating blood sugar without affecting body weight, comprising: administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof; wherein the therapeutically effective amount provides no more than 5% of the standard daily caloric intake of a mammal; and The regulation of blood glucose is the reduction of postprandial glucose peak and / or postprandial total blood glucose AUC.

29. The method of claim 28, wherein the medium chain dicarboxylic acid is formulated for oral administration.

30. The method of claim 28, wherein the medium chain dicarboxylic acid is formulated as a ready-to-use drink or solid supplement or powder.

31. The method of any one of claims 28 to 30, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

32. The method of any one of claims 28 to 31, wherein the therapeutically effective dose provides equal to or less than 3% of the standard daily caloric intake of a mammal.

33. The method of any one of claims 28 to 31, wherein the therapeutically effective dose comprises equal to or less than 3 g of medium chain dicarboxylic acid.

34. The method of any one of claims 28 to 33, wherein the administration further stimulates mitochondrial biogenesis, increases SIRT levels, increases NAMPT levels, increases intracellular NAD+ levels, maintains antioxidant capacity, and / or reduces DNA damage.

35. The method of any one of claims 28 to 34, wherein the administration further reduces the risk or progression of liver fibrosis in non-alcoholic steatohepatitis (NASH).

36. The method according to any one of claims 28 to 35, wherein the regulation of blood glucose is a reduction in postprandial glucose peak and postprandial total blood glucose AUC.

37. A method of increasing the resilience and / or lifespan of a cell, comprising: The cells are exposed to a medium chain dicarboxylic acid for a period of time and in an amount effective to stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+, maintain antioxidant capacity and / or reduce DNA damage.

38. The method of claim 37, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

39. The method of any one of claims 37 to 38, wherein the cells are exposed in vivo following oral administration of the medium chain dicarboxylic acid.

40. The method of any one of claims 37 to 39, wherein the cells are exposed for at least 6 hours.

41. A method of preventing or reducing the severity of nonalcoholic steatohepatitis (NASH) in a subject, comprising: administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof; wherein the therapeutically effective dose prevents non-alcoholic steatohepatitis (NASH) in the subject or reduces the severity of non-alcoholic steatohepatitis (NASH) in the subject.

42. The method of claim 41, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid or a pharmaceutically acceptable salt thereof or a nutritionally acceptable salt thereof.

43. The method of any one of claims 41 to 42, wherein the individual is a human.

44. The method of any one of claims 41 to 43, wherein the therapeutically effective dose is administered orally.

45. The method of any one of claims 41 to 44, wherein the therapeutically effective dose provides equal to or less than 5% of an individual's standard daily caloric intake.

46. ​​The method of any one of claims 41 to 44, wherein the therapeutically effective dose provides equal to or less than 3% of an individual's standard daily caloric intake.

47. The method of any one of claims 41 to 44, wherein the therapeutically effective dose comprises equal to or less than 5 g of medium chain dicarboxylic acid.

48. The method of any one of claims 41 to 44, wherein the therapeutically effective dose comprises equal to or less than 3 g of medium chain dicarboxylic acid.

49. The method of any one of claims 41 to 48, wherein the therapeutically effective dose also reduces the risk or progression of liver inflammation and / or liver fibrosis.

50. The method of any one of claims 41 to 48, wherein the therapeutically effective dose also reduces insulin resistance.

51. A method of treating nonalcoholic steatohepatitis (NASH) in a subject, comprising: administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof; wherein the therapeutically effective dose reduces lipid deposits in the liver of an individual diagnosed or suspected of having nonalcoholic steatohepatitis (NASH).

52. The method of claim 51, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid or a pharmaceutically acceptable salt thereof or a nutritionally acceptable salt thereof.

53. The method of any one of claims 51 to 52, wherein the individual is a human.

54. The method of any one of claims 51 to 53, wherein the therapeutically effective dose is administered orally.

55. The method of any one of claims 51 to 54, wherein the therapeutically effective dose provides equal to or less than 5% of an individual's standard daily caloric intake.

56. The method of any one of claims 51 to 54, wherein the therapeutically effective dose provides equal to or less than 3% of an individual's standard daily caloric intake.

57. The method of any one of claims 51 to 54, wherein the therapeutically effective dose comprises equal to or less than 5 g of medium chain dicarboxylic acid.

58. The method of any one of claims 51 to 54, wherein the therapeutically effective dose comprises equal to or less than 3 g of medium chain dicarboxylic acid.

59. The method of any one of claims 51 to 58, wherein the therapeutically effective dose also reduces the risk or progression of liver inflammation and / or liver fibrosis.

60. The method of any one of claims 51 to 58, wherein the therapeutically effective dose also reduces insulin resistance.

61. A liver protection composition comprising: A combination of a nutritionally or pharmaceutically acceptable carrier and a medium chain dicarboxylic acid; Wherein the composition is formulated for oral administration, it is therapeutically effective to prevent or treat non-alcoholic steatohepatitis (NASH) in a subject who ingests the composition.

62. The composition of claim 61, wherein the composition is formulated as a solid.

63. The composition of claim 61, wherein the composition is formulated to provide 0.05 g to 5.0 g of medium chain dicarboxylic acid as a daily dose.

64. The composition of any one of claims 61 to 64, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid or a pharmaceutically acceptable salt thereof or a nutritionally acceptable salt thereof.

65. The composition of any one of claims 61 to 64, further comprising at least one other hepatoprotectant, optionally selected from silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvate derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theophylline and / or methyl-macrocarpine.

66. A method of reversing liver inflammation, liver steatosis and / or liver fibrosis in a subject with non-alcoholic steatohepatitis (NASH), comprising: administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof; wherein said therapeutically effective dose provides no more than 5% of said individual's standard daily caloric intake.

67. The method of claim 66, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

68. The method of any one of claims 66 to 67, wherein the individual is a human.

69. The method of any one of claims 66 to 68, wherein the therapeutically effective dose is administered orally.

70. The method of any one of claims 66 to 69, wherein the therapeutically effective dose provides equal to or less than 3% of the standard daily caloric intake of a mammal.

71. The method of any one of claims 66 to 69, wherein the therapeutically effective dose provides equal to or less than 1% of a mammal's standard daily caloric intake.

72. The method of any one of claims 66 to 69, wherein the therapeutically effective dose comprises equal to or less than 5 g of medium chain dicarboxylic acid.

73. The method of any one of claims 66 to 69, wherein the therapeutically effective dose comprises equal to or less than 3 g of medium chain dicarboxylic acid.

74. The method of any one of claims 66 to 73, wherein the composition further comprises an additional hepatoprotectant.

75. The method of claim 74, wherein the other hepatoprotectant is silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvate derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theophylline and / or methylcrocarpine.

76. A method for preventing hepatocellular carcinoma, comprising: A therapeutically effective dose of a medium chain dicarboxylic acid is administered to a subject in need thereof.

77. The method of claim 76, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid or a pharmaceutically acceptable salt thereof or a nutritionally acceptable salt thereof.

78. The method of any one of claims 76 to 77, wherein the individual is a human.

79. The method of claim 78, wherein the subject has nonalcoholic steatohepatitis (NASH) or nonalcoholic fatty liver disease (NAFLD).

80. The method of any one of claims 76 to 79, wherein the therapeutically effective dose is administered orally.

81. The method of any one of claims 76 to 80, wherein the therapeutically effective dose provides equal to or less than 5% of an individual's standard daily caloric intake.

82. The method of any one of claims 76 to 80, wherein the therapeutically effective dose provides equal to or less than 3% of an individual's standard daily caloric intake.

83. The method of any one of claims 76 to 80, wherein the therapeutically effective dose comprises equal to or less than 5 g of a medium chain dicarboxylic acid.

84. The method of any one of claims 76 to 80, wherein the therapeutically effective dose comprises equal to or less than 3 g of medium chain dicarboxylic acid.

85. The method of any one of claims 76 to 84, wherein the therapeutically effective dose also reduces chronic subacute inflammation.

Images