A phage composite preparation, its preparation method and application

A tobacco composition with controlled nicotine release enhances user satisfaction and reduces health risks by delivering nicotine effectively through a vaporizable aerosol, addressing the challenges of smokeless tobacco products.

CN119563657BActive Publication Date: 2025-07-15CHINA TOBACCO HUNAN IND CORP
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411858397.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-17
Publication Date
2025-07-15
Estimated Expiration
2044-12-17

AI Technical Summary

Technical Problem

Among the existing methods for prevention and control of tobacco green wilt, there are few bacteriophage resources, single functions, narrow cleavage spectrum and short effective period, resulting in unsatisfactory prevention and control of phage preparations, which affects the promotion and application of phage preparations in tobacco disease prevention and control.

Method used

The phage complex preparations are adopted, including the phage La1, bio-drug agent (Bacillus vegetarian and Bacillus subtilis) and guanine-coated preparations, and the prevention and treatment effect of tobacco diseases is improved through the release and effect of different active ingredients.

Benefits of technology

It significantly improves the prevention and treatment effect of tobacco green wilt, expands the antibacterial spectrum, improves the continuous cropping barriers of tobacco, promotes tobacco growth, and significantly improves tobacco yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119563657B_ABST
    Figure CN119563657B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of phages, and particularly relates to a phage composite preparation, a preparation method thereof, and an application thereof. The phage composite preparation includes: phage active particles in a multi-layer structure, the phage active particles being phage particles, and the active ingredient in the phage active particles being the Ralstonia solanacearum phage La1 with a preservation number of CCTCC NO: M 20242370. The phage composite preparation further includes: biocontrol agent active particles, the first active layer of which mainly consists of a biocontrol agent and a filler, and the second active layer is a phage perforin layer. The phage composite preparation has a broad antibacterial spectrum, has a broad-spectrum control effect on various tobacco diseases, can improve tobacco continuous cropping obstacles, significantly promote the growth of tobacco, has a long effective period, and is beneficial to the improvement of tobacco yield and quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of bacteriophages, and in particular to a bacteriophage compound preparation, a preparation method and an application thereof. Background Art

[0002] As an important economic crop, tobacco has a wide planting area and distribution region. However, as the years of tobacco cultivation increase, the soil environment for tobacco cultivation deteriorates, the soil nutrient supply becomes unbalanced, tobacco diseases occur frequently, and the scope of infection expands, resulting in a decline in tobacco yield and quality.

[0003] Among tobacco diseases, bacterial wilt is a common and highly prevalent disease, severely impacting tobacco quality and yield. The pathogen is Ralstonia solanacearum, a soil-borne pathogen widely distributed worldwide, with host plants belonging to over 50 families and 200 genera. Tobacco bacterial wilt is characterized by rapid onset and rapid spread. After infection, tender tissues at the top of the plant, such as young and newly grown leaves, wilt. Before the leaves turn yellow and dry, the plant rapidly dehydrates, wilts, and withers. Symptoms of bacterial wilt are characterized by wilting at noon, returning to normal in the morning and evening, and repeated episodes of wilting progressively worsen until the plant dies. Infected tobacco plants experience a blackening of the vascular structures of the stems and leaves. The pathogen then invades the cortex and pith, resulting in the appearance of characteristic black streaks.

[0004] At present, the prevention and control methods of tobacco bacterial wilt include chemical control and biological control. Among them, chemical control is the use of chemical fungicides to control the bacterial wilt pathogen. However, there are problems such as environmental pollution and the easy production of drug-resistant pathogens. Therefore, biological control methods that are safer and conducive to sustainable development are receiving more and more attention.

[0005] Bacteriophages, due to their high specificity, safety, and pollution-free properties, have also been gradually developed and applied to the prevention and treatment of tobacco bacterial wilt. However, currently available phage resources for Ralstonia solanacearum are limited, and they suffer from a number of issues, including relatively limited functionality, a narrow lysis spectrum, a short shelf life in the field, and suboptimal control effectiveness. These issues significantly hinder the widespread application of phage preparations in tobacco disease prevention and control.

[0006] Therefore, the existing technology needs to be further improved. Summary of the Invention

[0007] In view of this, the present invention provides a phage compound preparation, a preparation method and an application thereof. The phage compound preparation greatly improves the control effect of the phage compound preparation on tobacco bacterial wilt through the synergistic combination of Ralstonia solanacearum phage and biocontrol bacteria, and also improves tobacco continuous cropping disorders.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a bacteriophage composite preparation, comprising bacteriophage active particles;

[0010] The bacteriophage active particles include Ralstonia pesudosoanacearum phage La1 with a deposit number of CCTCC NO: M 20242370.

[0011] In some specific embodiments of the present invention, the above-mentioned bacteriophage composite preparation further comprises active particles of biocontrol agents;

[0012] The biocontrol agent active granules are provided with at least two active layers, including a first active layer located in the core and a second active layer located in the outer layer;

[0013] The first active layer includes a biocontrol agent, and the second active layer is a bacteriophage perforin layer;

[0014] The biocontrol bacteria agent comprises Bacillus velez with a preservation number of CGMCC 1.7398 and Bacillus subtilis with a preservation number of CGMCC 1.7724.

[0015] In some specific embodiments of the present invention, the above-mentioned phage complex formulation further comprises a guanine-coated formulation;

[0016] The core of the guanine-coated preparation is biochar particles adsorbed with guanine, and the outer layer is an ethyl cellulose coating layer.

[0017] In some specific embodiments of the present invention, the amino acid sequence of the bacteriophage perforin in the bacteriophage perforin layer of the bacteriophage complex preparation is SEQ ID NO: 2.

[0018] In some specific embodiments of the present invention, the nucleic acid encoding the bacteriophage perforin in the bacteriophage perforin layer of the bacteriophage complex formulation has a sequence of SEQ ID NO: 1.

[0019] In some specific embodiments of the present invention, the method for preparing the bacteriophage perforin in the bacteriophage perforin layer of the bacteriophage composite preparation comprises the following steps:

[0020] Perforin cloning: The bacteriophage perforin gene was amplified, digested, and ligated into the vector PET-28a. The ligation product was transformed into E. coli, and positive clones were identified and screened.

[0021] Construction of recombinant perforin-expressing bacteria: Extract the recombinant plasmid, transform it into Escherichia coli expression bacteria, and screen to obtain recombinant perforin-expressing bacteria;

[0022] Induced expression and purification of perforin: The recombinant expression bacteria were induced to express, and the supernatant was extracted after centrifugal fermentation. The protein was purified using a His tag protein purification kit to obtain a crude extract of phage perforin.

[0023] The present invention also provides a method for preparing the above-mentioned phage composite preparation, comprising mixing the phage active particles, the biocontrol agent active particles and the guanine coating preparation in a ratio of (2~3):(2~3):1 to obtain the phage composite preparation.

[0024] In some specific embodiments of the present invention, the ratio of the bacteriophage active particles, the biocontrol agent active particles and the guanine coating preparation in the above preparation method is 2:2:1, 2:3:1, 3:2:1 or 3:3:1.

[0025] In some specific embodiments of the present invention, the preparation method of the bacteriophage active particles of the above preparation method comprises the following steps:

[0026] S1-1, mixing the phage culture solution with a protective agent to obtain a phage mixed solution;

[0027] S1-2, dropping the phage mixture into a CaCl2 solution to solidify, to obtain phage microspheres, washing and then mixing with a chitosan solution, reacting for 15 min, 20 min, 25 min or 30 min, washing with water, and freeze-drying to obtain phage active particles.

[0028] In some specific embodiments of the present invention, the preparation method of the biocontrol agent active particles of the above preparation method comprises the following steps:

[0029] S2-1. Using organic fertilizer as a carrier, adding 85 mL, 90 mL, 95 mL, 100 mL, 105 mL, 110 mL or 115 mL of the bacterial solution including the Bacillus Velez and the Bacillus subtilis per kilogram, adding a protective agent at an addition amount of 0.5%, 1%, 1.5% or 2%, fermenting, and then mixing with an auxiliary agent and a filler, adjusting the moisture content to 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25%, granulating, and low-temperature drying to obtain the second active layer;

[0030] S2-2, spraying a solution containing bacteriophage perforin protein uniformly on the surface of the second active layer, and then spraying a sodium alginate solution and a carboxymethyl chitosan solution simultaneously on the surface of the second active layer to obtain the biocontrol agent active particles.

[0031] In some specific embodiments of the present invention, the preparation method of the guanine coated preparation of the above preparation method includes: mixing the guanine solution and adsorbent particles, drying to obtain guanine adsorbent particles, and coating with ethyl cellulose to obtain the guanine coated preparation.

[0032] The present invention also provides the use of the above-mentioned phage complex preparation or the phage complex preparation prepared by the above-mentioned preparation method in any of the following items:

[0033] (i) Prevention and control of tobacco diseases;

[0034] (ii) Improve tobacco continuous cropping problems;

[0035] (iii) promoting tobacco growth;

[0036] (iv) Improve tobacco stress resistance.

[0037] In some specific embodiments of the present invention, the tobacco diseases used above include: at least one of tobacco bacterial wilt, tobacco black shank, tobacco brown spot, tobacco root black rot, tobacco anthrax, and tobacco powdery mildew.

[0038] The phage composite preparation of the present invention and its preparation method and application have the following effects:

[0039] 1. The present invention provides a bacteriophage composite formulation and its preparation method. The bacteriophage composite formulation utilizes one or more of three active particles to work synergistically. The active phage particles utilize a newly isolated Ralstonia pesudosoanacearum phage La1. This phage exhibits excellent specific lytic activity against Ralstonia solanacearum, excellent stability, a long outdoor shelf life, and good compatibility with other active ingredients, effectively synergizing with other active ingredients to exert antibacterial effects.

[0040] The active particles of the biocontrol agent utilize the synergistic effect of the bacteriophage perforin on the outer layer and the biocontrol bacteria inside to achieve a better antibacterial effect. The outer layer perforin is first released in the tobacco root environment carrying pathogens. The perforin first acts on the pathogens in the environment (such as Ralstonia solanacearum, etc.). After forming holes on the pathogens, it is more conducive to the subsequent release of bacteriophages and / or biocontrol bacteria to further lyse the pathogens, thereby improving their lysis efficiency and helping to expand their lysis spectrum.

[0041] The guanine in the guanine coating preparation releases the fastest, and is first gradually released at the roots of tobacco. Guanine continues to act on tobacco, constantly stimulating its disease resistance. Then, the active ingredients in the above-mentioned bacteriophage active particles and biocontrol agent active particles are also released and directly act on pathogens. The above-mentioned multiple active ingredients cooperate with each other and exert synergistic effects from different angles, thereby improving the prevention and control effect of tobacco against diseases, especially the effect on tobacco bacterial wilt is particularly significant.

[0042] 2. This phage complex exhibits excellent antibacterial activity against a wide range of tobacco pathogens, encompassing a broad spectrum of activity. It can also alleviate tobacco cropping problems by degrading phenolic acids, significantly promoting tobacco growth and improving both yield and quality. Furthermore, the phage complex exhibits a long duration of action, lasting up to six months, significantly reducing the frequency of application.

[0043] Biological Deposit Description

[0044] Biological material: Ralstonia solanacearum phage La1, classification name: Ralstonia phage, deposited in China Center for Type Culture Collection on October 29, 2024, the collection center address is: Wuhan University, Wuhan, China; the deposit number is CCTCC NO: M 20242370. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0046] Figure 1 shows the electron microscope photograph of bacteriophage La1;

[0047] Figure 2 Shown are the results of temperature stability test of bacteriophage La1;

[0048] Figure 3 Shows the pH stability of bacteriophage La1. DETAILED DESCRIPTION

[0049] The present invention discloses a phage composite preparation and its preparation method and application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be noted in particular that all similar replacements and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0050] In a first aspect, the present application provides a phage complex preparation, comprising: phage active particles, wherein the active ingredient in the phage active particles is Ralstonia pesudosoanacearum phage La1 with a deposit number of CCTCC NO: M 20242370.

[0051] Optionally, the preparation method of the bacteriophage active particles is:

[0052] (1) Adding a protective agent to the phage culture solution, mixing uniformly, and then preparing a freeze-dried powder; the protective agent is prepared from the following ingredients: resistant starch, calcium carbonate, and sodium alginate;

[0053] (2) The phage mixture was then dropped into a CaCl2 solution for solidification to obtain phage microspheres; washed with deionized water; mixed evenly with a 5% chitosan solution and reacted for 20 min, washed again with water, and freeze-dried to obtain phage microcapsules.

[0054] The phage La1 was deposited in the China Center for Type Culture Collection, Wuhan University on October 29, 2024. The deposit address is Room 211, China Center for Type Culture Collection, Wuhan University, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M 20242370.

[0055] This phage was isolated from tobacco soil in Weifang, Shandong Province. According to the International Committee on Taxonomy of Viruses (ICTV) classification, the phage's morphology conforms to the family Caudoviridae, making it a short-tailed phage. This phage exhibits excellent temperature and acid-base stability and exhibits excellent lytic activity against various tobacco pathogens, particularly Ralstonia solanacearum.

[0056] In other aspects, the present application also provides an active particle of a biocontrol agent, which is also provided with a first active layer located in the core and a second active layer located in the outer layer. The first active layer is mainly a biocontrol agent, and the second active layer is a bacteriophage perforin layer.

[0057] The microorganisms used in the biocontrol agent are a combination of Bacillus velez with a public preservation number of CGMCC 1.7398 and Bacillus subtilis with a public preservation number of CGMCC 1.7724.

[0058] Optionally, in the bacteriophage active particles, the preparation method of the biocontrol agent is: using organic fertilizer as a carrier, adding 100 mL of bacterial solution per kilogram, adding a protective agent (maltodextrin) at an addition amount of 1%, and fermenting twice for 7 days to obtain the biocontrol agent.

[0059] Optionally, the bacterial solution is a combination of Bacillus velezensis with a deposit number of CGMCC 1.7398 and Bacillus subtilis with a deposit number of CGMCC 1.7724, preferably, the ratio of the two is 1: 1. The setting of the bacteriophage perforin is the same as above.

[0060] Optionally, in the bacteriophage active particles, the protein sequence of the bacteriophage perforin is shown as SEQ ID NO: 2.

[0061] Perforin is a hydrophobic membrane protein with high charge and carboxyl terminal domains that is expressed by late transcription of bacteriophages and has a molecular weight of approximately 7.6 kDa. Perforin will assemble into oligomers within a specific time, forming non-specific transmembrane channels in the cell membrane, thereby damaging the cell membrane and releasing intracellular lytic enzymes, which in turn cause bacterial death or even lysis. Perforin can aggregate on the cell membrane within 1 hour and initiate cell membrane damage. The integrity of the cell membrane is destroyed, leading to an imbalance in intracellular osmotic pressure and protein loss. This is why, when used in vitro, perforin can cause cell death without the use of lytic enzymes. The fatal cause of bacterial loss of vitality is the holes formed by perforin on the cell membrane. Perforin is effective against G + and G - All showed good antibacterial effect. Experiments have shown that bacteriophage perforin has a wider lysis spectrum based on its working principle mentioned above.

[0062] In the above-mentioned active particles of the biocontrol agent, the perforin as the outer layer is first gradually released into the tobacco root environment carrying pathogens to be treated. The perforin first acts on the pathogens in the environment (such as Ralstonia solanacearum). After forming holes in the pathogens, it is more conducive to the lytic enzymes secreted by the biocontrol bacteria subsequently released into the environment to enter the interior of the pathogens, thereby more efficiently achieving the lysis of the pathogens, improving their lysis efficiency, and helping to expand their lysis spectrum.

[0063] Optionally, the preparation method of the tobacco Ralstonia solanacearum perforin is:

[0064] (1) Cloning of the perforin gene: amplify the bacteriophage perforin gene, digest it with enzymes, and ligate it to the vector PET-28a. The ligation product is then transformed into Escherichia coli, and positive clones are identified and screened.

[0065] (2) Construction of recombinant perforin-expressing bacteria: Extract the recombinant plasmid, transform it into Escherichia coli expression bacteria, and screen to obtain recombinant perforin-expressing bacteria;

[0066] (3) Induced expression and purification of perforin: Induce the recombinant expression bacteria to express, extract the supernatant after centrifugal fermentation, and purify the protein using a His tag protein purification kit to obtain a crude extract of phage perforin.

[0067] Furthermore, the phage complex preparation provided in the present application includes: the aforementioned phage complex preparation and the aforementioned biocontrol agent active particles.

[0068] Still more preferably, the bacteriophage complex preparation includes, in addition to the aforementioned bacteriophage complex preparation and the aforementioned biocontrol agent active particles, a guanine-coated preparation, wherein the core is a biochar particle adsorbed with guanine and the outer layer is an ethyl cellulose coating layer.

[0069] Optionally, the preparation method of the guanine coating preparation is: mixing the guanine solution and the adsorbent (biochar) particles, and obtaining guanine adsorption particles after drying; then placing the guanine adsorption particles into a coating machine, and then atomizing ethyl cellulose to coat the guanine adsorption particles to obtain the third active particles.

[0070] The present application discloses that guanine does not have a direct antibacterial effect on pathogens (such as Ralstonia solanacearum), but it can inhibit the reproduction of pathogens in plants by stimulating plant immune activity, thereby exerting a tobacco disease prevention and control effect.

[0071] After the above-mentioned phage compound preparation is applied to the tobacco field, as guanine is gradually released at the roots of the tobacco, guanine continues to act on the tobacco, constantly stimulating the disease resistance of the tobacco. Then, the active ingredients in the above-mentioned phage active particles and biocontrol agent active particles are also released and directly act on the pathogens. The above-mentioned multiple active ingredients cooperate with each other and exert synergistic effects from different angles, thereby improving the prevention and control effect of tobacco against diseases, especially the effect on tobacco bacterial wilt is particularly significant.

[0072] In a second aspect, the present application further provides a method for preparing the above-mentioned phage composite preparation, wherein the phage composite preparation comprises phage active particles, and the method for preparing the phage active particles comprises the following steps:

[0073] S1-1. Add a protective agent to the phage culture solution, mix well, and prepare a freeze-dried powder; the protective agent is prepared from the following ingredients: resistant starch, calcium carbonate, and sodium alginate;

[0074] S1-2. The phage mixture was then dropped into a CaCl2 solution for solidification to obtain phage microspheres; washed with deionized water; and then mixed evenly with a 5% chitosan solution for reaction for 20 minutes. The mixture was washed with water again and freeze-dried to obtain phage microcapsules.

[0075] Preferably, in the method for preparing the bacteriophage composite preparation, the bacteriophage composite preparation is a mixture of bacteriophage active particles and biocontrol agent active particles, and the method for preparing the biocontrol agent active particles is:

[0076] S2-1. Using organic fertilizer as a carrier, 100 mL of bacterial solution was added per kilogram, and a protective agent was added at a rate of 1%. After fermentation for 7 days twice, a preliminary bacterial inoculum was obtained. The preliminary bacterial inoculum was mixed with an auxiliary agent, sodium carboxymethyl cellulose, and a filler, kaolin, and pulverized. The moisture content was adjusted to 15-25%. The mixture was then added to a three-in-one centrifugal extrusion and rounding granulation equipment for granulation, and then low-temperature drying was performed to prepare core layer particles.

[0077] S2-2. A layer of crude bacteriophage perforin protein extract solution is evenly sprayed on the surface of the core layer particles, and then properly dried; sodium alginate and carboxymethyl chitosan solutions are then evenly sprayed on the surface of the core layer particles to obtain biocontrol agent active particles coated with a perforin protein layer.

[0078] Preferably, based on the above, the phage complex preparation also includes a guanine-coated preparation, and its preparation method is: mixing the guanine solution and the adsorbent (biochar) particles, and obtaining guanine adsorbed particles after drying; then placing the guanine adsorbed particles into a coating machine, and then atomizing ethyl cellulose to coat the guanine adsorbed particles to obtain the guanine-coated preparation.

[0079] In a third aspect, the present application also provides the use of the above-mentioned phage complex preparation in preventing and controlling tobacco diseases.

[0080] Optionally, the tobacco diseases include: tobacco bacterial wilt, tobacco black shank, tobacco brown spot, tobacco root black rot, tobacco anthracnose and tobacco powdery mildew.

[0081] Experimental results show that the above-mentioned phage complex preparation has excellent antibacterial effects on the pathogens of tobacco bacterial wilt, tobacco black shank disease, tobacco brown spot disease, tobacco root black rot, tobacco anthrax and tobacco powdery mildew. The phage complex preparation can be used to prevent and control diseases caused by infection with these pathogens.

[0082] Fourthly, this application also provides the use of the aforementioned bacteriophage complex formulation in alleviating tobacco continuous cropping problems. Experimental results demonstrate that the bacteriophage complex formulation can effectively degrade phenolic acids (such as ferulic acid, p-hydroxybenzoic acid, vanillic acid, and syringic acid) in the soil. These phenolic acids increase in soil content after crop rotation and are toxic to tobacco growth. Therefore, the degradation of phenolic acids can significantly alleviate tobacco continuous cropping problems, contributing to improved tobacco yield and quality.

[0083] Fifthly, this application also provides the use of the aforementioned phage complex formulation for promoting tobacco growth and improving tobacco stress resistance. Experimental results demonstrate that the fresh weight, plant height, stem diameter, and leaf area of ​​both fresh and continuous tobacco treated with the phage complex formulation were significantly increased, demonstrating that the phage complex formulation has a growth-promoting effect on tobacco and can significantly increase tobacco yield.

[0084] The sequence information involved in the present invention is as follows:

[0085] Perforin gene:

[0086] ATGACAAATGCGCTGCACGACGTTGCAAATGAGGCCGCGAACGCCTCGCCACCGCTGGCGATGACAAATGCGCTGCACGACGTTGCAAATGAGGCCGCGAACGCCTCGCCACCGCTGGCGGTCTACACGCTGGTGCAGATCATCATCCTGGTGCGCGACCGCATCGTCCGGCCGCGCCGCGAGGCTCGCGATGCCGACCCCAGCGAATCCGCGTAA (SEQ ID NO: 1);

[0087] Perforin protein:

[0088] MTNALHDVANEAANASPPLAVVGLHFAGVTLNDVVLILTAVYTLVQIIILVRDRIVRPRREARDADPSESA (SEQ ID NO: 2).

[0089] It should be understood that the expression "one or more of" includes individually each of the items recited after the expression and various combinations of two or more of the recited items, unless otherwise apparent from the context and usage. The expression "and / or" in conjunction with three or more recited items should be understood to have the same meaning, unless otherwise apparent from the context.

[0090] The terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, e.g., not excluding other unrecited elements or steps, unless otherwise specifically stated or understood from the context.

[0091] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the application remains operable. Additionally, two or more steps or actions may be performed simultaneously.

[0092] The use of any and all examples or exemplary language such as "for example" or "including" herein is intended only to better illustrate the present application and does not limit the scope of the present application. No language in this specification should be construed as indicating any non-claimed element is essential to the practice of the present application.

[0093] In addition, the numerical ranges and parameters used to define this application are approximate values. The relevant numerical values ​​in the specific examples have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual testing methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, amounts, values, and percentages used in this disclosure are modified by the word "about." As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.

[0094] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present invention are all common commercial products and can be purchased from the market.

[0095] The present invention will be further described below with reference to the embodiments.

[0096] Example 1: Isolation and purification of bacteriophage and determination of biological characteristics

[0097] 1. Isolation and purification of bacteriophage

[0098] The bacteriophage was sampled and isolated from the soil of a tobacco plantation in Weifang City, Shandong Province, where bacterial wilt occurred.

[0099] A small amount of soil sample was taken and added to an appropriate amount of broth culture medium, and 12 strains of Ralstonia solanacearum were added. The mixture was placed in a shaking culture at 28°C and 220 rpm / min for 12 h, centrifuged at 11000 rpm for 5 min, and then filtered with a 0.22 μm sterile microporous filter membrane to obtain phage proliferation liquid; the phage proliferation liquid was diluted 10 times, and the appropriate gradient phage dilution liquid was mixed with 12 strains of Ralstonia solanacearum at a ratio of 1:1. After incubation at 28°C for 5 min, 200 μL of the mixture was drawn and placed on the upper agar layer. After mixing, it was quickly poured onto the lower agar plate, shaken and placed flat until the culture medium solidified. After incubation in a 28°C incubator for 4-6 h, a double-layer plate with phage plaque formation was obtained.

[0100] A single plaque was picked from the double-layer agar medium where plaques were formed and placed in 1 mL of NB broth in a shaker at 28°C, 220 rpm / min, for approximately 30 minutes to obtain a phage extract. The phage extract was then mixed with the corresponding R. solanacearum growth medium at a 1:1 ratio and incubated at 28°C for 5 minutes. 200 μL of the extract was then placed on the upper agar plate, mixed thoroughly, and quickly poured onto the lower agar plate. The plate was shaken and placed flat until the medium solidified. After incubation inverted at 37°C for 4–6 hours, another double-layer plate with plaques was obtained. A single plaque was picked from the double-layer medium where plaques were formed using sterile forceps and placed in 1 mL of NB broth. The extract was then incubated in a shaker at 28°C, 220 rpm / min, for approximately 30 minutes to obtain a phage extract. This procedure was repeated three times to obtain the purified phage extract.

[0101] The phage with the highest titer and high UV stability was selected from the isolated tobacco Ralstonia solanacearum phages. The phage formed clear plaques with no halo around them and clearly visible edges on double-layer agar plates, with a diameter of approximately 1.2 mm.

[0102] Observation of the phage under an electron microscope revealed that the phage has a polyhedral head structure and a non-contractile tail. The head diameter is 56-64 nm and the tail length is about 10 nm. According to the classification method of the International Committee on Taxonomy of Viruses (ICTV), the phage morphology of the present application conforms to the characteristics of the Caudophagidae family and belongs to a short-tailed phage. It is named: Ralstonia pesudosoanacearum phage La1.

[0103] 2. Temperature and pH stability of Ralstonia solanacearum phage La1

[0104] (1) Experimental methods:

[0105] A. Temperature stability test: 3.00×10 10 The growth medium of Ralstonia solanacearum phage was incubated at 40°C, 50°C, 60°C, 70°C, and 80°C, with triplicate samples prepared for 20, 40, and 60 minutes, respectively. After the incubation period, the samples were immediately cooled in an ice bath. The phage titer at different temperatures was then measured using a double-layer plate assay. A phage thermostability curve was plotted, with temperature as the abscissa and the logarithm of phage titer as the ordinate.

[0106] B. pH stability test: 4.5 mL of NB broth of different pH values ​​(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13) were added to three sterile test tubes. The test tubes were then placed in a 37°C water bath. After the temperature stabilized, 500 μL of 3.00×10 10 Mix the phage proliferation solution at 100 PFU / mL and incubate in a 30°C water bath for 1, 2, or 3 hours. Immediately after incubation, add an appropriate amount of 1 mol / L HCl or NaOH to the mixture to adjust its pH to approximately 7. Dilute the mixture 10-fold and determine the titer using an appropriate dilution gradient. Set up three replicates for each pH value. Plot a phage pH stability curve with pH as the horizontal axis and the logarithm of phage titer as the vertical axis.

[0107] (2) Experimental results and analysis

[0108] A. The results are as follows Figure 2 As shown in the figure, the titer of phage La1 was relatively stable after 60 min at a temperature between 40℃ and 70℃; it still remained active after 60 min at 80℃, with the titer maintained at 10 7 PFU / mL, and still maintains a high activity. This shows that the Ralstonia solanacearum phage La1 has strong heat resistance and can adapt to higher temperature environments.

[0109] B. The results are as follows Figure 3 As shown, the titer of phage La1 is maintained at 10 in the range of pH 2.0 to 12.0. 10 PFU / mL, the activity is stable; after 3 h at pH 3.0, the titer remains at 10 8 PFU / mL; after 1 h at pH 13.0, the titer of the phage was 10 8 PFU / mL, and still maintains high activity; therefore, phage La1 has strong stability in a wide pH range and can adapt to a wide range of strong acid and strong alkaline environments.

[0110] Example 2: Preparation of tobacco Ralstonia solanacearum bacteriophage perforin

[0111] 1. Experimental methods

[0112] 1.1 Gene cloning and vector construction of the tobacco phage perforin from Ralstonia solanacearum

[0113] (1) Perforin gene cloning

[0114] The perforin gene with gene bank number PP405626.1 was analyzed and selected as the target gene on NCBI, and the sequence is shown in SEQ ID NO: 1.

[0115] A pair of amplification primers were designed based on the above gene sequence, and the phage proliferation fluid was extracted as an amplification template. The target gene perforin gene sequence was amplified using this sequence, which was then enzymatically digested and ligated to the vector PET-28a that had undergone the same enzymatic digestion. The ligation product (recombinant plasmid) was transformed into DH5α competent Escherichia coli, and positive clones were identified and screened by PCR.

[0116] (2) Expression of perforin in recombinant bacteria

[0117] The recombinant plasmid was extracted from the culture medium of the positive clone, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) competent cells, and then single colonies that were successfully transformed were selected.

[0118] A single colony of the recombinant expression bacteria was inoculated into LB medium containing Km and cultured at 37°C with shaking until OD 600 At a concentration of about 0.6-0.8, add 10 μL of IPTG and induce expression at 26°C with shaking overnight. The culture medium of the recombinant bacteria transformed with an empty plasmid was used as a control.

[0119] All bacterial liquids were collected and centrifuged. After removing the supernatant, the bacteria were collected and resuspended with PBS. The bacteria were then ultrasonically disrupted. After centrifugation at 4°C, the supernatant was collected and analyzed by SDS-PAGE electrophoresis to detect whether the recombinant perforin protein was expressed.

[0120] (3) Purification of perforin

[0121] After ultrasonic lysis, centrifuge the recombinant protein at 4°C. Collect the supernatant and purify it using a His-tag protein purification kit. Refer to the instructions for the appropriate kit for specific methods. The purified protein is then subjected to electrophoresis for purity analysis.

[0122] 2. Experimental results and analysis

[0123] The experimental results showed that the recombinant perforin protein was successfully expressed in recombinant E. coli. The purified perforin protein was lyophilized and stored at low temperatures for subsequent experiments.

[0124] Example 3: Preparation of a phage complex preparation

[0125] 1. The bacteriophage complex preparation includes the following components:

[0126] (1) Preparation of bacteriophage active particles:

[0127] S1-1. Add a protective agent to the phage culture solution, mix well, and prepare a freeze-dried powder; the protective agent is composed of the following ingredients: resistant starch and calcium carbonate;

[0128] Preparation method: add phage fermentation liquid (10 8 PFU / ml) was added with resistant starch at a final concentration of 5-10 g / mL and calcium carbonate at 2-4 g / mL, and stirred evenly on a magnetic stirrer. Then, sodium alginate at a final concentration of 3-4 g / mL was added to the mixture of phage and protective agent, and stirred thoroughly to obtain a phage mixture.

[0129] S1-2. The phage mixture was then dropped into a CaCl2 solution for solidification to obtain phage microspheres; washed with deionized water; and then mixed evenly with a 5% chitosan solution for reaction for 20 minutes. The mixture was washed with water again and freeze-dried to obtain phage microcapsules.

[0130] In this embodiment, the bacteriophage used is bacteriophage La1.

[0131] (2) Preparation of active granules of biocontrol agents:

[0132] S2-1. Using organic fertilizer as a carrier, add 100 mL of bacterial solution per kilogram, and add a protective agent (maltodextrin) at a volume percentage of 1%. Ferment twice every 7 days, stirring and aerating daily, and controlling the fermentation temperature below 50°C. After the completion of composting, naturally air-dry to a moisture content of about 20% to obtain a preliminary bacterial inoculum. 2% of the auxiliary agent sodium carboxymethyl cellulose and 10% of the filler kaolin are added to the preliminary bacterial inoculum, mixed, and crushed to adjust the moisture content to 20%. The mixture is then added to a centrifugal extrusion and rounding three-in-one granulation equipment for granulation, and then low-temperature drying is performed to prepare core layer particles.

[0133] S2-2. A layer of 10% bacteriophage perforin protein crude extract solution is evenly sprayed on the surface of the core layer particles, and then properly dried; then 6% sodium alginate and 10% carboxymethyl chitosan solutions are evenly sprayed on the surface of the core layer particles at the same time to obtain biocontrol agent active particles coated with a perforin protein layer.

[0134] The contents of the above unspecified ingredients are expressed in percentage by mass.

[0135] The organic fertilizer was purchased from Shandong Lilihui Biotechnology Co., Ltd.

[0136] The microorganisms used in the bacterial solution are a combination of Bacillus velezensis (CGMCC 1.7398) and Bacillus subtilis (CGMCC 1.7724), both of which are publicly available, in a 1:1 ratio. These microorganisms were purchased from the China General Microbiological Culture Collection Center (CGMCC).

[0137] (3) Preparation of guanine-coated preparations

[0138] A 1% (mass volume percentage) guanine solution and biochar particles as an adsorbent are mixed at a mass ratio of 1:10, and after drying, guanine adsorption particles are obtained; the guanine adsorption particles are then placed in a coating machine, and ethyl cellulose is atomized and coated on the guanine adsorption particles to obtain a guanine coating preparation.

[0139] The atomization coating method is as follows: add ethyl cellulose to 100 parts by weight of an ethanol solution (volume fraction of 80%), heat and stir at 70°C and a rotation speed of 500 r / min to dissolve, then spray at 80°C and a rotation speed of 12 r / min at a flow rate of 40 kg / min, heat and rotate until the spraying is completed and no ethanol is left.

[0140] Finally, the three active particles are mixed at a mass ratio of 2:2:1, immersed in molten microcrystalline wax and taken out immediately to avoid damage due to external influences.

[0141] Example 4: Growth of Ralstonia solanacearum on a culture medium containing guanine

[0142] 1. Experimental methods

[0143] Different concentrations of guanine were added to NA culture medium to obtain NA culture medium with guanine concentrations of 10 ng / mL and 100 ng / mL. Ralstonia solanacearum was then inoculated into the culture medium and placed upside down in a 28°C incubator for 2 days.

[0144] 2. Experimental results and analysis

[0145] The results showed that guanine had no effect on the growth of Ralstonia solanacearum on the culture medium, indicating that it could not directly inhibit the growth of the pathogen. However, subsequent experiments showed that guanine inhibited the proliferation of the pathogen in tobacco.

[0146] Comparative Examples 1 to 6

[0147] The differences between Comparative Examples 1 to 6 and Example 3 are shown in the following table. The parameters and preparation methods in the comparative examples other than those in the table are specifically referred to Example 3, and the specific settings are as follows:

[0148] Table 1: Settings of phage complex preparations in various comparative examples (units in the table are: parts by mass)

[0149]

[0150] Effect Example 1: The control effect of bacteriophage compound preparation on various tobacco diseases

[0151] The potting method was used to determine the control effects of the phage composite formulation of Example 3 and the formulations of Comparative Examples 1 to 6 on the following five tobacco diseases:

[0152] Ralstonia solanacearum; Phytophthoranicotianae; Alternaria alternata (Fr.) Keissler; Thielaviopsis basicola; Colletotrichum micotianae Averna.

[0153] The details are as follows:

[0154] (1) Experimental methods

[0155] ①. Potted plant test on the prevention and control of tobacco bacterial wilt

[0156] Select 5-7 leaf K326 tobacco seedlings and set up experimental group, positive control group and negative control group respectively, with 50 tobacco seedlings of the same growth in each group. 600 =0.15 pathogenic solanacearum solution was used for root irrigation, with 8 mL of bacterial solution per tobacco seedling, and the negative control group was irrigated with the same amount of sterile water.

[0157] Five days later, the experimental group continued to apply 10 g / plant of the bacteriophage compound to the roots after root irrigation and an appropriate amount of water, while the control group continued to apply the same amount of sterile water to the roots. After 10 days of incubation, the onset of disease was observed and recorded.

[0158] The investigation and classification standards for tobacco bacterial wilt are carried out in accordance with the national standard "Grading and Investigation Methods for Tobacco Diseases and Insect Pests" (GB / T23222-2008), and the diseased plant rate and disease index are investigated respectively. The symptom classification standards are:

[0159] Level 0: The whole plant is disease-free;

[0160] Level 1: There are occasional chlorotic spots on the stem, or less than 1 / 2 of the leaves on the diseased side wilt;

[0161] Level 3: There are black streaks on the stem, but not exceeding 1 / 2 of the stem height, or 1 / 2 to 2 / 3 of the leaves on the diseased side are withered;

[0162] Level 5: Black streaks on the stem exceed 1 / 2 of the stem height but do not reach the top of the stem, or more than 2 / 3 of the leaves on the diseased side wilt;

[0163] Level 7: Black streaks on the stem reach the top of the stem, and all leaves of the diseased plant wilt;

[0164] Level 9: The diseased plants are basically dead;

[0165] Calculation formula:

[0166] Incidence rate = number of diseased plants / total number of plants surveyed × 100%;

[0167] Disease index = ∑(number of diseased plants at each level × representative value of each level) / total number of plants surveyed × highest representative value × 100;

[0168] Prevention and treatment effect (%) = (disease index of control group - disease index of treatment group) / disease index of control group × 100%.

[0169] At the same time, the tobacco seedlings of Example 3 were measured for indicators such as soluble sugar and malondialdehyde content (a marker of cell senescence) using a spectrophotometer. A control group (not receiving the phage complex preparation) was also included. Each experiment was repeated three times. The data were analyzed for significance of differences using SAS data processing software and plotted.

[0170] Soluble sugars help plant cells maintain water balance, increase cell osmotic pressure, and protect cell membranes. Plants accumulate soluble sugars when exposed to stress. High soluble sugar levels attract small insects that feed on the leaves and can also transmit viral diseases. Therefore, soluble sugar content is an important indicator of a plant's stress resistance. When plant organs age or suffer damage under stress, membrane lipid peroxidation often occurs. Malondialdehyde is the final decomposition product of membrane lipid peroxidation. Therefore, the lower the MDA content, the better the plant's condition and stress resistance. Therefore, soluble sugars and MDA, as markers of cellular aging, can reflect tobacco's stress resistance. Therefore, this effect example uses measurements of these two indicators to reflect changes in tobacco's stress resistance.

[0171] ② Experiment on the prevention and treatment of tobacco black shank in potted plants

[0172] The experimental method refers to the method ① and the OD 600 = 0.12 of tobacco phytophthora liquid was used for root irrigation. Five days later, the experimental group continued to apply 10 g / plant of phage compound preparation to the roots and added appropriate amount of water, while the control group continued to irrigate the roots with the same amount of sterile water.

[0173] Tobacco black shank symptoms are graded as follows:

[0174] Level 0: no disease;

[0175] Level 1: The lesion area accounts for less than 5% of the entire leaf area;

[0176] Level 3: The lesion area accounts for 5% to 10% of the entire leaf area;

[0177] Level 5: The lesion area accounts for 11% to 25% of the entire leaf area;

[0178] Level 7: The lesion area accounts for 26% to 50% of the entire leaf area;

[0179] Level 9: The area of ​​lesions accounts for more than 50% of the total leaf area.

[0180] ③Experiment on controlling tobacco root black rot in potted plants

[0181] The experimental method was similar to that of method ①. The tobacco seedlings were inoculated with the pathogen by irrigating the roots with the fungus solution. Five days later, the experimental group continued to apply 10 g / plant of the bacteriophage compound preparation to the roots and applied an appropriate amount of water. The control group irrigated the roots with the same amount of sterile water.

[0182] The incidence was investigated with reference to the standard GB / T23222-2008.

[0183] ④ Experiment on controlling tobacco anthracnose in potted plants

[0184] The experimental method was similar to that of method ①. Tobacco seedlings were inoculated with tobacco anthracnose pathogens by irrigating the roots. Five days later, the experimental group continued to apply 10 g / plant of the bacteriophage compound preparation to the roots and applied an appropriate amount of water. The control group irrigated the roots with the same amount of sterile water.

[0185] The incidence was investigated with reference to the standard GB / T23222-2008.

[0186] ⑤ Potted tobacco brown spot disease control experiment

[0187] The experimental method was based on method ①. The tobacco seedlings were inoculated with the pathogen by irrigating the roots with the Alternaria solution. Five days later, the experimental group continued to apply 10 g / plant of the bacteriophage compound preparation to the roots and applied an appropriate amount of water. The control group irrigated the roots with the same amount of sterile water.

[0188] The incidence was investigated with reference to the standard GB / T23222-2008.

[0189] (2) Experimental results and analysis

[0190] (a) The experimental results in Table 2 demonstrate that the phage complex formulation of the present application exhibits significant control efficacy against five tobacco diseases caused by the pathogens Ralstonia solanacearum, Phytophthora nicotianae, Alternaria alternata (Fr.) Keissler, Thielaviopsis basicola, and Colletotrichum micotianae Averna. The highest efficacy against tobacco bacterial wilt was 98%. This demonstrates the broad antibacterial spectrum of this phage complex formulation and its promising application in the simultaneous control of multiple tobacco diseases.

[0191] Table 2: Control effects of each group on various tobacco diseases

[0192]

[0193] (b) As shown in Table 3, compared with the control group, the soluble sugar and malondialdehyde contents of the tobacco in Example 3 were significantly reduced, which can reduce the probability of tobacco being infected by pathogens. This shows that the stress resistance of the experimental group treated with the phage composite preparation of the present application is significantly improved.

[0194] Table 3: Determination of soluble sugar and malondialdehyde content in tobacco of Example 3

[0195]

[0196] Effect Example 2: Effect of bacteriophage complex preparation on improving tobacco continuous cropping disorder

[0197] Determination of the ability to degrade phenolic acids: The content of phenolic acids (such as ferulic acid, p-hydroxybenzoic acid, vanillic acid, and syringic acid) in the soil increases after crop rotation, which is toxic to tobacco growth. Therefore, this example analyzes whether the phage complex formulation provided in this application has a degradative effect on phenolic acids.

[0198] (1) Experimental methods

[0199] Set up multiple processing groups as follows, and the processing methods for each treatment are as follows:

[0200] Experimental Group 1: The phage complex prepared in Example 3 was added to the first crop soil that had not been used for tobacco cultivation;

[0201] Control group 1: Add an equal amount of sterile water to the first crop soil that had not been planted with tobacco;

[0202] Experimental Group 2: The phage complex prepared in Example 3 was added to the soil of tobacco planted for three years;

[0203] Control group 2: Add an equal amount of sterile water as a blank control to the soil of tobacco planted for 3 years.

[0204] After 10 days of treatment, 50 g of soil samples were mixed and extracted with 150 ml of ethyl acetate by ultrasonic extraction. After standing overnight, the soil samples were evaporated and redissolved in 700 μL of methanol. The changes in phenolic acid content in the soil were detected by HPLC under the same detection conditions as above.

[0205] (2) Experimental results:

[0206] Table 4: Degradation effect of phage complex preparation on phenolic acids in tobacco rhizosphere

[0207]

[0208] Effect Example 3: The growth-promoting effect of bacteriophage complex preparation on tobacco

[0209] (1) Experimental methods

[0210] This experimental study used the bacteriophage complex formulation prepared in Example 3. Four treatment groups were set up using the same setup as in Experimental Example 2. Soil from each treatment group was placed in pots (25 cm diameter, 28 cm height, 20 cm base diameter) and tobacco seedlings were planted. Once the seedlings were viable, 10 g of the bacteriophage complex formulation was applied to the roots of the seedlings in each treatment group and watered. This treatment was repeated every 15 days for a total of three treatments. During this growth period, no fertilizers or pesticides were applied to the tobacco seedlings.

[0211] On the 10th day after all treatments were completed, the plant height, stem diameter, middle leaf area and maximum leaf length × width of the tobacco seedlings in each treatment group were observed and recorded.

[0212] (2) Experimental results and analysis

[0213] Table 5: Effects of phage complex preparations on tobacco growth promotion in the regular and continuous cropping

[0214]

[0215] From the above results, it can be seen that compared with the control group, the tobacco treated with the phage compound preparation has been significantly improved in terms of plant height, stem thickness, middle leaf area and maximum leaf length × width, regardless of whether it is regular or continuous cropping. This shows that the phage compound preparation has a growth-promoting effect on tobacco seedlings and has a significant effect on improving tobacco continuous cropping obstacles.

[0216] Effect Example 4: Determination of the duration of efficacy of phage complex preparations

[0217] (1) Experimental methods

[0218] A tobacco base in Weifang, where moderate tobacco bacterial wilt was present, was selected. Two treatment groups were set up in the experimental field: experimental group, comparative example a, and comparative example b, with 40 tobacco seedlings in each group. The experimental group used the bacteriophage compound preparation prepared in Example 3, with 10 g of the bacteriophage compound preparation applied to the roots of each tobacco seedling. The comparative example a group used 10 mL of phage culture solution (concentration of 10 8 PFUs / mL), and comparative example b used the same amount of phage active particles (10 9 PFU), other settings were the same as the experimental group. On the 30th, 60th, 90th, and 180th day of observation, the control effect was statistically analyzed according to the investigation and grading standards for tobacco bacterial wilt in Effect Example 1.

[0219] (2) Experimental results and analysis

[0220] As shown in Table 6, root irrigation with a phage compound formulation in tobacco fields can greatly reduce the incidence of tobacco bacterial wilt disease. The control effect reaches 95% on the 30th day. In addition, the phage compound formulation has a long lasting effect, and its control effect is still maintained at 90% on the 90th day. The control effect is significantly higher than that of comparative example b and much higher than that of comparative example a.

[0221] This shows that the phage compound preparation can play a long-term preventive and control role in tobacco wilt in the field.

[0222] Table 6: Determination of the efficacy of the phage complex preparation in the experimental group (%)

[0223]

[0224] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A phage complex preparation, characterized in that, It includes phage active particles, biocontrol agent active particles, and guanine coating preparations; The phage active particle includes the phage with the preservation number of CCTCC NO: M 20242370 ( Ralstonia phage); The biocontrol agent active particles are provided with at least two active layers, including a first active layer located at the core and a second active layer located at the outer layer; The first active layer includes a biocontrol agent, and the second active layer is a phage perforin layer; The biocontrol bacterial agent includes Bacillus velezensis with the preservation number of CGMCC 1.7398 ( Bacillus velezensis ), and Bacillus subtilis with the preservation number of CGMCC 1.7724 ( Bacillus subtilis ); The core of the guanine coating preparation is biochar particles adsorbed with guanine, and the outer layer is an ethyl cellulose coating layer; The mass ratio of the phage active particles, the biocontrol agent active particles, and the guanine coating preparation is (2-3):(2-3):

1.

2. The phage complex preparation according to claim 1, characterized in that, The amino acid sequence of the phage perforin in the phage perforin layer is SEQ ID NO:

2.

3. The preparation method of the phage complex preparation according to claim 1, characterized in that It includes mixing the phage active particles, the biocontrol agent active particles, and the guanine coating preparation according to the mass ratio of (2-3):(2-3):1 to obtain the phage composite preparation.

4. The preparation method according to claim 3, characterized in that, The preparation method of the phage active particles includes the following steps: S1-1. Mix the phage culture solution with a protective agent to obtain a phage mixed solution; S1-2. Drop the phage mixed solution into a CaCl2 solution for solidification to obtain phage microspheres. After washing, mix with a chitosan solution, react, wash with water, and freeze-dry to obtain phage active particles.

5. The preparation method according to claim 3, characterized in that, The preparation method of the biocontrol agent active particles includes the following steps: S2-1. Mix organic fertilizer, a bacterial solution containing the Bacillus velezensis and the Bacillus subtilis, and a protective agent, ferment, then mix with an auxiliary agent and a filler, granulate, and dry at low temperature to obtain the second active layer; S2-2. Uniformly spray a solution containing phage perforin protein on the surface of the second active layer, and then spray the sodium alginate solution and the carboxymethyl chitosan solution on the surface of the second active layer at the same time to obtain the biocontrol agent active particles.

6. The preparation method according to claim 3, wherein The preparation method of the guanine coating preparation includes: mixing a guanine solution and adsorbent particles, drying to obtain guanine adsorption particles, and coating with ethyl cellulose to obtain the guanine coating preparation.

7. The application of the phage composite preparation according to claim 1 or 2 or the phage composite preparation prepared by the preparation method according to any one of claims 3 to 6 in any of the following items: (i). Preventing and controlling tobacco diseases; (ii). Improving tobacco continuous cropping obstacles; (iii). Promoting tobacco growth; (iv). Improving the stress resistance of tobacco; The tobacco diseases include: At least one of tobacco bacterial wilt, tobacco black shank, tobacco brown spot, tobacco black root rot, and tobacco anthracnose.

Citation Information

Patent Citations

  • Bacteriophage and probiotic coupled fermentation microecological preparation and preparation method thereof

    CN111925995A

  • Ralstonia solanacearum bacteriophage and compound preparation containing same

    CN117946980A