Rhodotorula mucilaginosa and application thereof in fermentation of cider

By using acid-resistant Rhodotorula glutinis strain CXY1113 in mixed fermentation with Saccharomyces cerevisiae, the problem of excessive malic acid in cider was solved, thus improving the quality and flavor of the cider.

CN119570644BActive Publication Date: 2026-05-29DALIAN POLYTECHNIC UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411651825.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-19
Publication Date
2026-05-29
Estimated Expiration
2044-11-19

AI Technical Summary

Technical Problem

Existing yeast strains are unable to effectively degrade malic acid, resulting in excessively high levels of organic acids in apple wine, which affects its taste and flavor.

Method used

A strain of Rhodotorula mucilaginosa CXY1113, isolated from naturally fermented cider, was used. This strain is tolerant of acidic environments and utilizes malic acid as a carbon source to reduce the malic acid content. It is then co-fermented with Saccharomyces cerevisiae.

Benefits of technology

It significantly reduces the content of malic acid, acetic acid and succinic acid in cider, enhances the brightness and antioxidant capacity of the cider, increases the content of volatile flavor compounds, and improves the taste and flavor of cider.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570644B_ABST
    Figure CN119570644B_ABST
Patent Text Reader

Abstract

The application discloses a strain of Rhodotorula mucilaginosa and application of the strain in cider fermentation, and belongs to the technical field of microbial fermentation. The Rhodotorula mucilaginosa CXY1113 is obtained by separation from natural fermentation cider, the strain can tolerate low-pH acidic environment, can utilize malic acid as a carbon source, and reduce the content of malic acid. Compared with single fermentation of Saccharomyces cerevisiae, the application of the Rhodotorula mucilaginosa CXY1113 in cider production can improve the brightness of fruit wine, enhance the antioxidant activity, reduce the content of malic acid, acetic acid and succinic acid in the cider, improve the content of flavor compounds such as ethyl phenylacetate and isoamyl alcohol, the obtained cider has rich and mellow aroma, high quality, coordinated taste, and gives the cider more mellow floral and fruity aroma. The application has important significance for improving the taste and flavor of fruit wine and improving the quality of fruit wine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a strain of Rhodotorula glutinis and its application in apple cider fermentation, belonging to the field of microbial fermentation technology. Background Technology

[0002] Fruit wine is made by pressing fresh fruit into juice and then fermenting it with yeast. It has the flavor of fruit and is a low-alcohol beverage with an alcohol content typically between 7% and 18%. The natural fermentation of fruit wine is a complex process involving the combined action of various microorganisms, with different yeasts playing different roles. The interactions between these yeasts affect the flavor and quality of the fruit wine. Saccharomyces cerevisiae (Saccharomyces cerevisiae) is widely used in fruit wine fermentation. While it helps improve the uniformity of fruit wine quality and prevents spoilage, using Saccharomyces cerevisiae alone can lead to a monotonous composition and a limited aroma. Non-Saccharomyces cerevisiae, although inferior to Saccharomyces cerevisiae in alcohol yield and fermentation characteristics, can release aromatic compounds by secreting enzymes that degrade glycosidic bonds. They can also directly synthesize or adjust flavor components through their own metabolism, resulting in fruit wines with fragrant aromas and a prominent body. Currently, using co-fermentation with Saccharomyces cerevisiae and non-Saccharomyces cerevisiae to improve the flavor of fruit wine is a hot research topic.

[0003] The organic acid content in fruit wine is determined by many factors. A small amount of organic acid can make fruit wine mellow and refreshing, but too much can degrade its flavor and quality, leaving a sour taste in the mouth. Currently, there are three methods for reducing the acidity of fruit wine: physical, chemical, and biological. Physical methods have a long natural cycle and low efficiency. Chemical methods may use acid-reducing agents that can cause imbalances in the wine, failing to meet consumers' demands for natural, green, and chemical-free products. Biological methods not only have no impact on the quality of fruit wine but also utilize the metabolism of microorganisms, resulting in superior acid-reducing effects and gradually becoming a hot topic in acid-reducing research both domestically and internationally. Therefore, finding more efficient acid-reducing microorganisms and screening strains with excellent acid-reducing characteristics has become an important trend in current acid-reducing methods.

[0004] Chinese patent CN115786144B discloses an unusual strain of *V. wickerham* yeast and its application in reducing acidity and fixing color in blueberry wine. During blueberry wine fermentation, this strain catalyzes the decarboxylation of hydroxycinnamic acid in the juice to form the corresponding vinylphenol. The vinylphenol further combines with anthocyanins to generate more stable pyranoanthocyanins, thus fixing the color of the blueberry wine while preventing unpleasant sourness and off-flavors. Chinese patent CN117247850A uses an acid-resistant strain of *Pichia kudriezvichi*, which can tolerate a minimum pH of 2.0 and can increase the ester content in high-acidity fruit wines, resulting in a richer aroma and more harmonious taste. However, these strains cannot degrade malic acid and therefore cannot be used in cider fermentation.

[0005] Apples contain a large amount of organic acids, with malic acid being the most abundant, exceeding 74%. High concentrations of malic acid negatively impact the flavor of fruit wine, resulting in a sour, astringent, and rough taste, and a noticeable bitterness. Because existing winemaking strains cannot effectively degrade malic acid, the resulting fermented apple wine has a high content of organic acids, primarily malic acid, significantly diminishing its flavor and taste. Therefore, providing a strain capable of degrading malic acid and tolerating acidic environments for use in the winemaking process is of great significance. Summary of the Invention

[0006] To address the aforementioned problems, this invention provides an acid-resistant Rhodotorula glutinis strain that can reduce malic acid content, and its application in mixed fermentation with Saccharomyces cerevisiae to improve the quality of cider.

[0007] This invention is achieved through the following technical solution:

[0008] This invention provides a strain of Rhodotorula glutinis isolated from naturally fermented cider, with accession number CDMCC No: 64464. The Rhodotorula glutinis strain involved in this invention was deposited on March 28, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0009] In one embodiment, the red yeast has the following properties:

[0010] (1) Separated from naturally fermented cider;

[0011] (2) It can tolerate an acidic environment with a pH of 3;

[0012] (3) It can use malic acid as a carbon source to reduce the content of malic acid.

[0013] When this strain of Rhodotorula glutinis is co-fermented with Saccharomyces cerevisiae, it can reduce the content of malic acid and acetic acid, increase the total phenol content and antioxidant capacity of the cider, and enhance the content of flavor compounds such as isoamyl acetate, hexyl acetate, phenethyl acetate and isoamyl alcohol in the cider, giving it floral and fruity aromas and making the typical aroma of the cider more prominent.

[0014] The present invention provides a microbial agent containing the aforementioned Rhodotorula glutinis CXY1113.

[0015] In one embodiment, the inoculum comprises Rhodotorula glutinis CXY1113 or contains Rhodotorula glutinis CXY1113 and its fermentation supernatant.

[0016] Preferably, the Rhodotorula glutinis CXY1113 in the fermentation agent exists in the form of live bacteria.

[0017] In one embodiment, the amount of Rhodotorula glutinis CXY1113 in the bacterial agent is not less than 1×10⁻⁶. 6 CFU / mL or 1×10 6 CFU / g.

[0018] This invention provides a method for preparing the fermentation agent, the method comprising the step of culturing Rhodotorula glutinis CXY1113 to obtain a bacterial culture:

[0019] (1) Pick a single colony of Rhodotorula glutinis CXY1113 and inoculate it into 10mL of YPD medium. Then, shake and culture at 28-30℃ and 200-250rpm for 24h to obtain bacterial solution A.

[0020] (2) Subsequently, bacterial culture A was inoculated into 50mLYPD medium and cultured with shaking at 28-30℃ and 200-250rpm for 24h to obtain bacterial culture B;

[0021] (3) After centrifuging the bacterial solution B at 8000 rpm for 10 min, collect the bacterial cells and dilute the bacterial cells with 0.9% (w / v) sodium chloride aqueous solution to prepare a bacterial suspension.

[0022] Preferably, the culture is carried out at 28°C.

[0023] The present invention provides a product containing the aforementioned Rhodotorula glutinis CXY1113 or the aforementioned inoculum.

[0024] In one embodiment, the product includes, but is not limited to, fruit wine.

[0025] This invention provides a method for preparing cider by adding the aforementioned Red Yeast CXY1113 and Saccharomyces cerevisiae to a substrate containing apple juice for fermentation.

[0026] In one embodiment, the initial soluble solids (SSC) concentration of the apple juice is 20%. o Brix.

[0027] In one embodiment, brewing yeast and the fermenting agent are added before the cider fermentation process.

[0028] Preferably, the concentration of the brewing yeast in the initial fermentation system is 1×10⁻⁶. 6 ~10 7 CFU / mL.

[0029] In one embodiment, the inoculation method of the Rhodotorula glutinis CXY1113 and Saccharomyces cerevisiae is to inoculate them simultaneously or to inoculate Rhodotorula glutinis CXY1113 first and then inoculate Saccharomyces cerevisiae 72 hours later.

[0030] Preferably, the brewing yeast and the red yeast rice CXY1113 are inoculated simultaneously.

[0031] Preferably, the fermentation ratio of brewing yeast to the red yeast CXY1113 is 1:1.

[0032] The present invention also provides the application of the aforementioned Rhodotorula glutinis CXY1113 or the aforementioned inoculum in the preparation of cider.

[0033] The present invention also provides the application of the aforementioned Red Yeast CXY1113 or the aforementioned inoculant in enhancing the content of flavor substances in cider, wherein the flavor substances include one or more of isoamyl acetate, hexyl acetate, phenethyl acetate or isoamyl alcohol.

[0034] The Rhodotorula mucilaginosa strain used in this application has been widely used in food, for example, a strain of Rhodotorula mucilaginosa isolated from a local winemaking region in China. Its β-glucosidase extract showed good tolerance under winemaking conditions. The effect of mixing it with Saccharomyces cerevisiae in the fermentation of Ecolly dry white wine was studied, and the results showed that mixed fermentation improved citrus, sweet fruit, sour fruit, berry, and floral aroma characteristics (Wang XC, Li AH, Dizy M, et al. Evaluation of aroma enhancement for “Ecolly” dry white wines by mixed inoculation of selected Rhodotorula mucilaginosa and Saccharomyces cerevisiae[J]. Food Chemistry, 2017, 228: 550-559). Meanwhile, studies have shown that *Rhodotorula glutinis* is one of the common microorganisms found on apple peels and is also the dominant microorganism on apple peels in Liaoning Province (Wei J, Niu C, Liu B, et al. Identification and characterization of epiphytic yeasts on apples in China[J]. Rsc Advances, 2017, 7(71): 44766-44772). Other studies have also screened *Rhodotorula glutinis* strains from high-salt, low-temperature soy sauce mash, which have shown a certain effect on enhancing the flavor of soy sauce (Wang Jingwen, Zhao Mouming, Chen Tao, et al. Screening, identification and fermentation characteristics of functional yeasts in high-salt, low-temperature soy sauce mash[J]. Food Science, 2021, 42(22): 91-97). In addition, a strain of *Rhodotorula glutinis* isolated and purified from the air of a strong-aroma baijiu brewing workshop produced ethanol and ethyl hexanoate as its dominant products, along with small amounts of aromatic components such as higher alcohols, esters, and phenols (Huang Zhiguo, Peng Sijie, Li Hao, et al., Isolation, Identification and Growth Characteristics of Yeasts in the Air of a Strong-Aroma Baijiu Brewing Workshop [J] Food and Machinery, 2021, 37(03):7-11). The overall results indicate that *Rhodotorula glutinis* is a safe strain suitable for food and fruit wine production.

[0035] Beneficial effects:

[0036] This invention isolates a strain of Rhodotorula glutinis CXY1113 from naturally fermented cider. The Rhodotorula glutinis CXY1113 can tolerate an acidic environment with a pH of 3 and can utilize malic acid as a carbon source. In a culture medium with malic acid as the sole carbon source, it can reduce malic acid by 62%, and in a culture medium with malic acid and glucose as dual carbon sources, it can reduce malic acid by 28%. It can also reduce the content of malic acid during cider fermentation, with a degradation rate of 8%.

[0037] This invention uses a combination of *Rhodotorula glutinis* CXY1113 and *Saccharomyces cerevisiae* as a fermenting agent to prepare cider. Compared to fermentation with *Saccharomyces cerevisiae* alone, the combined use of *Rhodotorula glutinis* CXY1113 and *Saccharomyces cerevisiae* can increase the brightness of the cider by more than 10%, enhance its antioxidant activity, increase its DPPH free radical scavenging capacity by more than 4 times, and increase the total phenolic content to more than 1.9 times that of apple juice. Furthermore, it can reduce the content of malic acid, acetic acid, and succinic acid in the cider, with acetic acid content reduced by more than 2 times and succinic acid content reduced by up to 1.5 times.

[0038] The apple cider prepared by combining *Rhodotorula glutinis* CXY1113 and *Saccharomyces cerevisiae* exhibited a DPPH free radical scavenging capacity of 87.50% and an ABTS scavenging capacity of 94.73%, comparable to unfermented apple juice. The flavonoid and total phenolic contents were 0.119 and 0.086 mg / mL, respectively, significantly higher than those of apple juice. Furthermore, compared to apple juice, the resulting apple cider showed a significantly lower organic acid content and an increased content of flavor compounds such as phenethyl acetate and isoamyl alcohol, resulting in a more harmonious taste and a richer floral and fruity aroma. While retaining the nutritional components and antioxidant activity of apple juice, this significantly improved the quality of the fermented fruit wine.

[0039] Therefore, the red yeast CXY1113 provided by this invention is of great significance for improving the taste and flavor of fruit wine and enhancing its quality.

[0040] Preservation of biological materials

[0041] The Rhodotorula mucilaginosa yeast CXY1113 provided by this invention was deposited on March 28, 2024, at the Guangdong Provincial Center for Microbial Culture Collection (CDMCC) with accession number CDMCC No: 64464. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. Attached Figure Description

[0042] Figure 1 The growth curves of various yeast strains in a medium with pH=3 are shown.

[0043] Figure 2 This is a statistical chart showing the weight loss of apple juice fermentation broth during the fermentation process;

[0044] Figure 3 This is a statistical chart showing the consumption of soluble solids (SSC) in apple juice fermentation broth during the fermentation process.

[0045] Figure 4 A statistical chart showing the organic acid content of apple juice and cider. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0047] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field; unless otherwise specified, the reagents and materials used in the following embodiments are all commercially available. The Saccharomyces cerevisiae CGMCC 2.3854 involved in the following comparative examples was purchased from the China General Microbiological Culture Collection Center.

[0048] All the culture media used in this invention are prepared using conventional methods.

[0049] The culture medium used in this invention is prepared as follows:

[0050] (1) Malic acid medium: 1 g / L yeast extract, 2 g / L peptone, 1 g / L malic acid, autoclave for 20 min, then pour into plates.

[0051] (2) YPD-malic acid medium: 1 g / L yeast extract, 2 g / L peptone, 1 g / L malic acid, 2 g / L glucose, autoclave for 20 min, then pour into plates.

[0052] (3) Acid-resistant screening medium: YPD liquid medium, pH adjusted to 3 with phosphoric acid, autoclaved for 20 min, and then poured into plates.

[0053] Example 1: Screening and Identification of Strains

[0054] 1. Isolation and purification of strain CXY1113

[0055] (1) Samples were taken periodically from the apple juice fermentation broth (0d, 2d, 4d, 6d, 8d), diluted sequentially, and 100 μL of each dilution was spread onto YPD agar medium (purchased from Qingdao High-Tech Park Haibo Biotechnology Co., Ltd.) supplemented with ampicillin sodium. The samples were incubated at 28℃ for 24-72 h. Single colonies exhibiting typical yeast characteristics were selected for microscopic examination. These colonies were then streaked onto YPD agar medium, and the streaking was repeated twice to purify the strains. Fourteen non-saccharifying yeasts were screened out during the natural fermentation of apple wine. These strains were cryopreserved and further screened.

[0056] One of the strains was *Rhodotorula mucilaginosa*, named *Rhodotorula mucilaginosa* CXY1113. The 26S rDNA sequence of strain CXY1113 was amplified and sequenced, and the sequencing results are shown in SEQ ID NO: 1. It was identified as *Rhodotorula mucilaginosa*.

[0057] The sequence is as follows:

[0058] CGCGCTTCACAGCATCCTTCGTGTGAAGAAGGTCGAAACCCCCGCCAAAGGCACA

[0059] CTTCGCGTTTCCTTCAGTCCCCCAAGATGTATCCAGCAGAGAGCTATAACACAGCCGAA

[0060] ACTGCTACCTTCTCTCTACCATTATCCATCCCGGAAAACTGATGCTGGCCTGCAAACCGA

[0061] TTGCTCGGCAAGCAAGTCTGACTTCAAGCGTTTCCCTTCCAACAATTTCACGTACTGTTA

[0062] ACTCCTTTCCAAAGTGCTTTTCATCTTTCCCTCACGGTACTTGTTCGCTATCGGTCTCTC

[0063] GCCAATATTTAGCTTTAGATGGAATTTACCACCCAATTTGAGCTGCATTCCCAAACAACT

[0064] CGACTCTTCGAAAATGTATCACAAAGCGCTGGGCGTCCGCACCATATACGGGGGTCTCA

[0065] CCACTATGCCGCTGTATTCCAACAGACTTGTGTGCGGTCCAACGCGGAAAACATTTCTAG

[0066] AGATTACAACTCGGACACCGAAGGTGCCAGATTATAAATTTGAGCTCTTCCCGCTTCGCT

[0067] CGCCGCTACTAGGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTATTGGGATTATGCAA;

[0068] The aforementioned Rhodotorula mucilaginosa CXY1113 was deposited on March 28, 2024, at the Guangdong Provincial Center for Microbial Culture Collection (CDMCC No.: 64464), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0069] Example 2: Characteristics of Rhodotorula glutinis CXY1113

[0070] 1. Screening is carried out step by step in the order of initial screening for malic acid reduction performance → secondary screening for malic acid reduction performance → screening for acid resistance performance in order to obtain yeast strains that have both malic acid reduction and acid resistance characteristics.

[0071] 2. Initial screening of acid-lowering strains: using 1.0 × 10⁻⁶... 7 Fourteen non-Saccharomyces cerevisiae strains were inoculated into malic acid medium at a CFU / mL inoculum and cultured at 28℃ for 6 days. The total acid content after fermentation was determined using the titration method of GB / T 12456-2021. 1 mL of sample was diluted to volume in a 100 mL volumetric flask. A few drops of 1% phenolphthalein-ethanol solution were added to 20 mL of the diluted sample, and the solution was titrated with standardized NaOH solution until a faint red color appeared that did not fade within 30 seconds. This was considered the titration endpoint. The volume of NaOH standard solution consumed was recorded, and the total acid content was calculated. The total acid degradation rate was calculated as the initial screening indicator.

[0072]

[0073] In the formula: C0 is the concentration of malic acid before degradation; C1 is the concentration of malic acid after degradation. In the malic acid medium, all 14 non-Saccharomyces cerevisiae strains grew well, and 11 of them had good acid-reducing ability, with a total acid degradation rate of over 60%, which led to subsequent re-screening experiments.

[0074] 3. Secondary screening of acid-lowering strains: according to 1.0×10 7 Eleven non-Saccharomyces cerevisiae strains initially selected were inoculated into malic acid-YPD medium at an inoculum volume of CFU / mL and cultured at 28°C for 6 days. The total acid content was measured after fermentation, and the total acid degradation rate was calculated as an indicator of acid reduction in the secondary screening. The main difference between the secondary screening medium and the primary screening medium is that the secondary screening medium contains glucose; yeast preferentially utilizes glucose as a carbon source compared to malic acid. The secondary screening experiment reflects the ability of the selected strains to degrade malic acid in the presence of both glucose and malic acid. During the secondary screening, four non-Saccharomyces cerevisiae strains exhibited good acid reduction capabilities, with total acid degradation rates exceeding 20%. The acid reduction capabilities were ranked as follows: Zygosacchariformis CXY1117 > Rhodotorula glutinis CXY1113 = Candida albicans CXY1104 > Pichia pastoris CP09.

[0075] The degradation rate of malic acid by the Rhodotorula glutinis CXY1113 was 62% in malic acid medium and 28% in YPD-malic acid medium.

[0076] 4. Acid resistance screening: The non-Saccharomyces yeasts selected in the secondary screening were subjected to acid resistance testing at a concentration of 1.0 × 10⁻⁶. 7 CFU / mL inoculum was inoculated into acid-tolerant selection medium and incubated at 28°C for 3 days. OD was measured every 12 hours. 600nm All four non-Saccharomyces cerevisiae strains grew well in low pH environments and exhibited strong acid tolerance. The acid tolerance ranking was: Rhodotorula glutinis CXY1113 > Candida albicans CXY1104 > Pichia pastoris CP09 > Zygomyces CXY1117.

[0077] Example 3: Evaluation of the effect of mixed fermentation of Rhodotorula glutinis CXY1113 and Saccharomyces cerevisiae on improving the quality of cider.

[0078] In the following examples, the Rhodotorula glutinis CXY1113 is abbreviated as Rh, and the comparative Saccharomyces cerevisiae CGMCC 2.3854 is abbreviated as Sc.

[0079] In the following examples, to evaluate the role of Rhodotorula glutinis CXY1113 in cider, fresh Shandong Fuji apples were selected, juiced, filtered, and sterilized for later use. Cider fermentation was divided into the following groups: Rh-Sc (inoculated with 10... 6 Simultaneous inoculation with CFU / mL Rhodotorula glutinis CXY1113 for 10 6 CFU / mL Saccharomyces cerevisiae in 200mL apple juice), Rh-Sc-72 (inoculated first 10... 6 CFU / mL Rhodotorula glutinis CXY1113 was added to 200 mL of apple juice, and after 72 hours, it was inoculated into 10 cells. 6 CFU / mL Saccharomyces cerevisiae) and Sc (inoculated at 10 6 (CFU / mL of brewer's yeast was added to 200mL of apple juice). The fermentation temperature was 28℃, and the fermentation time was 11 days.

[0080] During the fermentation of fruit wine, yeast uses sugars in the system for growth, reproduction, and alcoholic fermentation. The faster the sugar is consumed, the more CO2 is produced. Therefore, the fermentation rate of this yeast was studied by detecting the changes in soluble solids and CO2 during the fermentation process.

[0081] 1. Changes in the fermentation rate of cider

[0082] During fermentation, samples were taken daily to measure the soluble solids content and CO2 loss. For example... Figure 2As shown, Rh-Sc exhibited the highest cumulative CO2 loss (20.88 ± 0.07 g), significantly higher than the comparative Sc (18.47 ± 0.76 g). Furthermore, throughout the fermentation process, the CO2 loss rate of Rh-Sc was consistently higher than that of the comparative Sc, while Rh-Sc-72 showed the lowest CO2 loss. The results for SSC were consistent with the CO2 loss results. Figure 3 As shown, all cider fermentation could be completed in 11 days. During fermentation, the consumption rate of SSC was Rh-Sc > that of the comparative Sc. The soluble solids content of Rh-Sc-72 changed slowly in the first 3 days, but on the 4th day, after Sc inoculation, the soluble solids content of Rh-Sc-72 decreased rapidly.

[0083] 2. Physicochemical properties of cider

[0084] After fermentation, the cider was centrifuged at 8000 rpm for 10 min, and the supernatant was collected for pH, titratable acid, glucose, and color determination. pH was measured using a pH meter. Total acid (calculated as malic acid) was determined according to GB / T 15038-2006. Glucose content was determined using a biochemical sensor. Color values ​​(L, a, b) were measured using a colorimeter.

[0085] As shown in Table 1, the three groups of cider showed significant differences in color, with L* values ​​(brightness) ranging from 0 (black) to 100 (white). The L* values ​​of the mixed-culture fermentation groups Rh-Sc and Rh-Sc-72 were significantly higher than those of the control group Sc, increasing by more than 10%, indicating that their cider was brighter and lighter in color, thus improving their visual appeal. The glucose content of Rh-Sc was significantly lower than that of the other groups, indicating that its fermentation was more thorough.

[0086] Table 1. Test results of physicochemical properties of apple juice and cider

[0087] Apple juice Sc Rh-Sc Rh-Sc-72 pH 4.01±0.06 3.91±0.17 4.05±0.03 3.97±0.04 Titratable acid (g / L) <![CDATA[2.02±0.01 b ]]> <![CDATA[3.12±0.02 a ]]> <![CDATA[2.72±0.02 a ]]> <![CDATA[2.84±0.04 a ]]> Glucose (mg / L) NA <![CDATA[4.2±0.17 a ]]> <![CDATA[2.4±0.26 c ]]> <![CDATA[2.9±0.06 b ]]> L* NA <![CDATA[78.45±3.23 b ]]> <![CDATA[87.42±2.37 a ]]> <![CDATA[87.01±0.41 a ]]> a* NA <![CDATA[1.86±0.75 a ]]> <![CDATA[-0.5±0.17 b ]]> <![CDATA[-0.06±0.15 b ]]> b* NA <![CDATA[25.46±3.63 a ]]> <![CDATA[12.88±0.62 b ]]> <![CDATA[15.42±1.10 b ]]>

[0088] 3. Organic acid content in apple juice and cider

[0089] Organic acids were determined by high-performance liquid chromatography (HPLC) (Agilent 1220 Infinity II system, Agilent Technologies Inc., Palo Alto, CA, USA). A ZORBAX-SB C18 column (5 μm, 4.6 × 250 mm) and a UV detector (210 nm) were used. The sample injection volume was 20 μL. The flow rate was 1.0 mL / min. Mobile phase A was diammonium hydrogen phosphate buffer (0.01 mol / L, pH = 2.8), and mobile phase B was methanol solution. The elution gradient was 98:2 (v / v). Organic acid standard curve and determination of organic acid content in samples: Six concentrations of organic acid (malic acid, acetic acid, tartaric acid, succinic acid, and citric acid) were prepared at 50 ppm, 62.5 ppm, 83.3 ppm, 125 ppm, 250 ppm, and 500 ppm. These were filtered through a 0.22 μm filter before injection. A standard curve was plotted based on concentration and peak area, with three parallel trials for each sample. Cider samples were first filtered through a 0.22 μm filter, then diluted with Wahaha purified water to a certain ratio, shaken to mix, and 20 μL of the sample was injected for analysis.

[0090] Changes in organic acid content, such as Figure 4 As shown, malic acid is the most abundant organic acid in apple juice (2169.10 mg / L), possessing a strong and sharp taste. The malic acid content of the mixed-culture fermented apple cider was significantly lower than that of apple juice and Sc (2043.18 mg / L). The malic acid contents of Rh-Sc and Rh-Sc-72 were 1990.47 mg / L and 1958.00 mg / L, respectively, a reduction of more than 8%. This indicates that the addition of Rhodotorula glutinis CXY1113 can effectively reduce the malic acid content. This result may be due to the interaction between Rhodotorula glutinis and Saccharomyces cerevisiae during fermentation, leading to a decrease in malic acid content. The acetic acid content of apple juice was 214.07 mg / L, and the mixed-culture fermentation group could reduce the acetic acid content to below 151 mg / L. After fermentation, the lactic acid content was significantly increased, reaching above 3999 mg / L.

[0091] 4. Antioxidant activity of fruit juice and cider

[0092] The method for determining total phenols was in accordance with GB / T 8313-2008. The method for determining total flavonoids was in accordance with GB / T 5009.124-2003. The free radical scavenging abilities of DPPH and ABTS were determined according to patent CN109125164A.

[0093] As shown in Table 2, the total phenolic and total flavonoid contents of apple cider were significantly higher than those of apple juice. Rh-Sc-72 had the highest total phenolic content (0.092 mg / mL). The DPPH scavenging capacity of apple juice was 87.84%, while that of Rh-Sc was 87.50%, more than four times that of the control group Sc (20.99%). Patent CN109125164A discloses a strain of *Rhododendron simsii*, which, when added to black goji berry fermentation pulp, resulted in a total flavonoid content of 0.034 mg / mL and increased the DPPH scavenging rate to a maximum of 60%. In this invention, the group with added *Rhododendron simsii* achieved a total flavonoid content of over 0.119 mg / mL and a DPPH scavenging rate of up to 87.50%.

[0094] Table 2 Results of Antioxidant Activity Detection of Apple Juice and Cider

[0095]

[0096] 5. Volatile flavor compounds in fruit juice and cider

[0097] Flavor compounds were determined using a 7890B-5977A gas chromatography-mass spectrometry (GC-MS) system. Chromatographic column: HP-5MS (30m × 0.25mm × 0.25μm); injection temperature: 250℃; mode: splitless; carrier gas: high-purity helium; flow rate: 1mL / min; injection port temperature: 250℃; column temperature program: 35℃ for 1 min, ramp to 80℃ at 10℃ / min, hold for 2 min, ramp to 170℃ at 8℃ / min, hold for 2 min, then ramp to 220℃ at 10℃ / min, hold for 1 min, and finally ramp to 240℃ at 8℃ / min, hold for 1 min. MS parameters: EI mode, electron energy 70eV; ion source temperature: 230℃; quadrupole temperature: 150℃; full scan mode; mass scan range: m / z 30–350 μm. Add 2 mL of sample and 20 μL of 400 mg / L internal standard (2-octanol) to the headspace extraction vial. Incubate at 60 °C for 20 min, extract for 20 min, and desorb at the injection port for 10 min. Based on the detection results of volatile flavor compounds, compare the spectral results with the data from the standard mass spectrometry library (NIST 17) for qualitative analysis, and calculate the content of volatile flavor compounds using the internal standard method.

[0098] The aroma of fruit wine depends on the multiple interactions between volatile flavor compounds and all chemical components. In addition to classifying, describing, and statistically analyzing volatile flavor compounds, relative odor activity value (rOAV) analysis should be performed to explore key aroma compounds in depth; substances with rOAV > 1.0 are key aroma compounds in fruit wine. As shown in Table 3, there are 13 key aroma compounds. Rh-Sc cider increased the content of isoamyl acetate, hexyl acetate, phenethyl acetate, and isoamyl alcohol, imparting floral and fruity aromas to the cider. These results indicate that co-inoculation fermentation of *Rhodotorula glutinis* CXY1113 and *Saccharomyces cerevisiae* can improve the aroma concentration and complexity of cider.

[0099] Table 3. GC-MS Detection Results of Apple Juice and Cider

[0100]

[0101] In summary, this invention provides a strain of Rhodotorula mucilaginosa CXY1113, which was deposited at the Guangdong Provincial Microbial Culture Collection Center on March 28, 2024, with accession number CDMCC NO: 64464. The Rhodotorula mucilaginosa CXY1113 exhibits good acid resistance and can utilize malic acid as a carbon source to reduce its content. When this strain is mixed with Saccharomyces cerevisiae for fermentation, it can reduce the content of malic acid, acetic acid, and succinic acid, improve the brightness and antioxidant activity of the fruit wine, and increase the content of volatile flavor compounds, including one or more of isoamyl acetate, hexyl acetate, phenethyl acetate, and isoamyl alcohol. Fermenting apple cider using the Rhodotorula mucilaginosa CXY1113 results in an enhanced flavor, producing a clear, bright apple cider with a rich aroma and harmonious taste.

[0102] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A strain of Rhodotorula glutinis ( Rhodotorula mucilaginosa CXY1113, characterized in that, The aforementioned Rhodotorula glutinis was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 28, 2024, with accession number CDMCC No: 64464.

2. A microbial agent, characterized in that, The inoculum includes Rhodotorula glutinis CXY1113 as described in claim 1.

3. The microbial agent as described in claim 2, characterized in that, In the bacterial agent, the amount of Rhodotorula glutinis CXY1113 is not less than 1×10⁻⁶. 6 CFU / mL or 1×10 6 CFU / g.

4. A method for preparing cider, characterized in that, The red yeast CXY1113 of claim 1 or the inoculum of claim 2 or 3, along with brewer's yeast, are added to apple juice for fermentation.

5. The method as described in claim 4, characterized in that, In the substrate, the inoculation concentration of the Rhodotorula glutinis CXY1113 is (1×10⁻⁶). 6 )~(1×10 7 ) CFU / mL; the inoculation concentration of the brewer's yeast is (1×10⁻⁶ CFU / mL). 6 )~(1×10 7 CFU / mL; ferment at 18~28℃ for at least 10 days.

6. Cider prepared by the method of claim 4 or 5.

7. The application of the Rhodotorula glutinis CXY1113 according to claim 1 or the inoculum according to claim 2 or 3 in the preparation of cider, characterized in that, The Rhodotorula glutinis CXY1113 of claim 1 or the inoculum of claim 2 or 3 is simultaneously inoculated with Saccharomyces cerevisiae.

8. The application of the Rhodotorula glutinis CXY1113 according to claim 1 or the inoculum according to claim 2 or 3 in enhancing the content of flavor compounds in cider, characterized in that, The yeast CXY1113 of claim 1 or the inoculum of claim 2 or 3 is simultaneously inoculated with brewer's yeast; the flavor substances include one or more of isoamyl acetate, hexyl acetate, phenethyl acetate or isoamyl alcohol.

Citation Information

Patent Citations

  • An abnormal Wickham yeast strain and its application in acid reduction and color fixation of blueberry wine

    CN115786144B

  • Acid-resistant pichia kudriavzevii GAAS-JG-1 and application thereof in preparation of high-acidity fruit fermented wine

    CN117247850A

  • Selenium-rich rhodotorulamucilaginosa FXY-7 strain, culture method thereof and application thereof to shrimp feed additive

    CN105420128A

  • Lyceum ruthenicum fermentation original liquor and preparation method thereof

    CN109125164A