Phosphoketolase mutants from Bifidobacterium adolescentis and their applications in metabolite production

Abstract

The present invention belongs to the fields of genetic engineering and enzyme engineering, and discloses a phosphoketolase mutant derived from Bifidobacterium adolescentis and its application in the production of metabolites. The present invention uses a site-directed mutagenesis method to mutate the 480th histidine of the phosphoketolase PKT derived from Bifidobacterium adolescentis to lysine, significantly improving the enzyme activity of the phosphoketolase. This effectively solves the problem of the current low catalytic performance of phosphoketolase on fructose-6-phosphate. The enzyme has been successfully applied to the fermentation production of bacitracin, ectoine, and γ-aminobutyric acid, providing a new approach to improving the production level of metabolites.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and enzyme engineering, and specifically relates to a phosphoketolase mutant derived from Bifidobacterium adolescentis and its application in the production of metabolites. The metabolites involved include but are not limited to antibiotics (such as bacitracin) and amino acid derivatives derived from acetyl-CoA (such as tetrahydropyrimidine and γ-aminobutyric acid). Background Art

[0002] Bacitracin is a non-ribosomal peptide antibiotic with the advantages of strong antibacterial properties, a broad antimicrobial spectrum, and low resistance to drug resistance. It is widely used in the field of feed additives and veterinary medicine. Ectoin and γ-aminobutyric acid are two typical aspartic acid and glutamic acid derivatives derived from acetyl-CoA, respectively, and play an important role in the food, pharmaceutical, and chemical industries. Currently, bacitracin, ectoin and γ-aminobutyric acid are mainly produced by microbial fermentation. In recent years, with the rapid development of genetic engineering technology, researchers have used genetic engineering methods to genetically modify host strains and successfully improved the production level of metabolites.

[0003] In the microbial glycolysis pathway, 1 mol of glucose is degraded to produce 2 mol of pyruvate, which is then catalyzed by the pyruvate dehydrogenase system to produce 2 mol of acetyl-CoA and release 2 mol of CO2. This carbon loss is not only detrimental to the efficient synthesis of metabolites, but also further exacerbates the greenhouse effect, reducing the economic and sustainable development of microbial manufacturing. The phosphoketolase (encoded by the gene fxpK) from Bifidobacterium adolescentis has bifunctional enzyme activity, catalyzing the conversion of fructose-6-phosphate (F6P) to erythrose-4-phosphate (E4P) and acetyl phosphate (AcP), and the conversion of xylulose-5-phosphate (X5P) to glyceraldehyde-3-phosphate (G3P) and AcP. AcP is then catalyzed by phosphotransacetylase to produce acetyl-CoA. Compared with the reaction catalyzed by pyruvate dehydrogenase, the metabolic reaction catalyzed by phosphoketolase does not have carbon atom loss, but microbial fermentation usually uses host strains (including Escherichia coli, Corynebacterium glutamicum and Bacillus licheniformis, etc.) without natural phosphoketolase. Introducing phosphoketolase in these strains can increase the output and conversion rate of metabolites (particularly metabolites derived from acetyl-CoA). However, natural phosphoketolase activity is relatively low, and it is necessary to significantly increase its expression in the host strain to reflect the promotion effect on metabolite synthesis, which limits its application potential. Therefore, it is urgent to develop a phosphoketolase with better catalytic performance. Summary of the Invention

[0004] The object of the present invention is to provide a phosphoketolase mutant derived from Bifidobacterium adolescentis. The amino acid sequence of the phosphoketolase mutant H480K is shown in SEQ ID NO.4.

[0005] Another object of the present invention is to provide the use of the phosphoketolase mutant H480K in the fermentation production of metabolites.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] The applicant mutated the histidine H at position 480 of the wild-type phosphoketolase derived from Bifidobacterium adolescentis (shown in SEQ ID NO.2) to lysine K to obtain the phosphoketolase mutant H480K of the present invention, as shown in SEQ ID NO.4.

[0008] The protection scope of the present invention also includes:

[0009] A fusion protein obtained by fusing the mutant protein described in SEQ ID NO.4 with a protein tag.

[0010] The mutant or fusion protein encoding gene of SEQ ID NO.4.

[0011] An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above-mentioned coding gene.

[0012] The mutant, fusion protein, the mutant or fusion protein encoding gene of SEQ ID NO. 4, the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the encoding gene are used in preparing metabolites.

[0013] A method for improving the activity of phosphoketolase comprises the following steps: performing the following mutation on the phosphoketolase: mutating the 480th histidine H in SEQ ID NO.4 to lysine K.

[0014] A method for preparing metabolites comprises the following steps: preparing the metabolites by culturing the above-mentioned recombinant microorganism.

[0015] In the above-mentioned use or method, preferably, the metabolite is: bacitracin, an amino acid derivative derived from acetyl-CoA;

[0016] In the above-mentioned application or method, preferably, the amino acid derivative derived from acetyl-CoA is ectoine and / or γ-aminobutyric acid.

[0017] The gene encoding the mutant of SEQ ID NO.4 is preferably as shown in SEQ ID NO.3.

[0018] In the above-mentioned applications or methods, preferably, the recombinant microorganism is recombinant Bacillus licheniformis.

[0019] In the above-mentioned use or method, preferably, the Bacillus licheniformis is Bacillus licheniformis DW2.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] The present invention uses site-directed mutagenesis to mutate the histidine at position 480 of the phosphoketolase molecule to lysine (designated mutant H480K in the present invention), significantly improving the enzymatic activity of the phosphoketolase and addressing the current issue of low catalytic efficiency of phosphoketolase on fructose-6-phosphate. The phosphoketolase mutant H480K was integrated and expressed into the genome of Bacillus licheniformis DW2. The resulting recombinant strain exhibited significantly enhanced fermentation production of bacitracin and acetyl-CoA-derived metabolites. Assay results showed that compared to a recombinant strain integrating and expressing wild-type phosphoketolase, the H480K mutant increased the production of bacitracin, ectoine, and gamma-aminobutyric acid by 7.18%, 21.01%, and 23.48%, respectively, demonstrating promising prospects for industrial application. DETAILED DESCRIPTION

[0022] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention. The technical solutions described in the present invention, unless otherwise specified, are conventional solutions in the art; the reagents and materials described, unless otherwise specified, are all from commercial sources.

[0023] The culture medium involved in the following implementation cases is as follows:

[0024] LB liquid medium: yeast powder 5g·L -1 , peptone 10 g·L -1 、NaCl 10g·L -1 , pH 7.0.

[0025] LB solid medium: yeast powder 5g·L -1 , peptone 10 g·L -1 、NaCl 10g·L -1 , agar powder 15g·L -1 .

[0026] TB medium: yeast powder 24g·L -1 , peptone 12 g·L -1 , glycerol 5g·L -1 、K2HPO4·3H2O 16.4g·L -1 、KH2PO4 2.3g·L -1, pH 7.0.

[0027] Bacitracin fermentation medium: corn starch 50g·L -1 , soybean meal 90g·L -1 , light calcium carbonate 5g·L -1 , ammonium sulfate 2g·L -1 , pH 7.2.

[0028] Tetrahydropyrimidine fermentation medium: glucose 20g·L -1 , peptone 5g·L -1 , yeast powder 5g·L -1 、MgSO4·7H2Og·L -1 、(NH4)2SO4 1g·L -1 , pH 7.2.

[0029] γ-aminobutyric acid fermentation medium: glucose 60g·L -1 , peptone 6g·L -1 , yeast powder 12g·L -1 、(NH4)2SO4 6g·L -1 、K2HPO4·3H2O 12.5g·L -1 、KH2PO4 2.5g·L -1 , Trace Metal Mix A9: CoCl2·6H2O 0.4g·L -1 、H3BO4 0.05g·L -1 、ZnSO4·7H2O 0.2g·L -1 、MnSO4·5H2O 1.0g·L -1 、NaMoO4·2H2O 0.2g·L -1 、CuCl·H2O 0.1g·L -1 、FeSO4·7H2O 4.0g·L -1 、AlCl3·6H2O0.1g·L -1 、CaCl2 4.0g·L -1 , pH 7.2.

[0030] Example 1:

[0031] Construction of integration expression plasmid T2-fxpK:

[0032] The gene sequence of phosphoketolase was cloned from Bifidobacterium adolescentis ATCC 15703 using fxpK-F and fxpK-R as primers. The amplified sequence is shown in SEQ ID NO.1, encoding the wild-type phosphoketolase shown in SEQ ID NO.2 (Accession No. NC_008618).

[0033] Using the genome of Bacillus subtilis 168 as a template, the P43 promoter was amplified using primers P43-F and P43-R; the amylase terminator TamyL was amplified using primers TamyL-F and TamyL-R. Using primers P43-F and TamyL-R, the three fragments of P43, fxpK, and TamyL were subjected to SOE-PCR to obtain the fxpK expression element P43-fxpK-TamyL. Using the genome of Bacillus licheniformis DW2 as a template, the upstream homology arm and downstream homology arm of lanp were amplified using primers lanp-AF / AR and lanp-BF / BR, respectively. Using lanp-AF and lanp-BR, the upstream homology arm, P43-fxpK-TamyL, and downstream homology arm were subjected to SOE-PCR to obtain the target gene fragment. Using plasmid T2(2)-ori as a template, T2-T5-F and T2-T5-R were used to amplify the linear vector backbone. After electrophoresis, the PCR products were purified and recovered using a gel extraction kit. The fusion fragment was fused to the linearized vector using the ClonExpress II One-Step Cloning Kit to generate the recombinant plasmid T2-fxpK. The recombinant plasmid T2-fxpK was transformed into competent E. coli DH5α, and positive colonies were selected using LB plates containing kanamycin. After overnight incubation at 37°C in a shaking incubator, the plasmid T2-fxpK was extracted and verified by sequencing.

[0034] Among them, the sequence of the primer is:

[0035] T2-T5-F:GAGCTCGTAGAAAAGATCAAAGG

[0036] T2-T5-R:TCTAGAACTAGTGGATCCCCC

[0037] lanp-AF:GATCTTTTCTACGAGCTCGATTGTCCTTGGCTATGC

[0038] lanp-AR:AAAACATACCACCTATCAACTGTCATTAGCGGAAGC

[0039] P43-F:GCTTCCGCTAATGACAGTTGATAGGTGGTATGTTTT

[0040] P43-R:AATCACCGGGCTTGTCATTTTATATTTTACATAATC

[0041] fxpK-F:GATTATGTAAAATATAAAATGACAAGCCCGGTGATT

[0042] fxpK-R:AATCCGTCCTCTCTGCTCTTTCATTCATTATCTCCGGCTGT

[0043] TamyL-F:ACAGCCGGAGATAATGAATGAAAGAGCAGAGAGGACGGATT

[0044] TamyL-R:TTGACCTCTTAGCGGAGCCGCAATAATGCCGTCGCA

[0045] lanp-BF:TGCGACGCATTATTGCGGCTCCGCTAAGAGGTCAA

[0046] lanp-BR:GGATCCACTAGTTCTAGAAGCACCATTCAAACCCTT

[0047] Example 2:

[0048] Preparation of wild-type phosphoketolase integrated expression strain DW2::fxpK and enzyme activity determination:

[0049] The resulting integrated expression plasmid T2-fxpK was transformed into Bacillus licheniformis DW2. Positive transformants were screened using kanamycin resistance as a selection marker and verified by colony PCR. Correct transformants were subcultured several times at 45°C in the presence of kanamycin. Colony PCR analysis revealed positive single-crossover conjugants that exhibited single crossover between the upstream and downstream homology arms of the expression element P43-fxpK-TamyL and B. licheniformis DW2 genomic DNA. Correct single-crossover strains were inoculated and subcultured several times in a kanamycin-free medium at 37°C. Colony PCR analysis and sequencing confirmed the identification of recombinant B. licheniformis DW2::fxpK harboring the fxpK gene.

[0050] The strain DW2::fxpK was inoculated into 50 mL of LB medium and cultured at 37°C for 12 h. The inoculum was then transferred to TB medium at a 3% inoculum level and cultured at 37°C for 24 h. The cells were collected by centrifugation, washed twice with PBS, and resuspended in 50 mM phosphate buffer (pH 6.8). The cells were disrupted using an ultrasonic disruptor, and the supernatant was collected by centrifugation at 4°C to obtain the crude enzyme solution. 22.5 μL of the crude enzyme solution, 90 mM substrate F6P, and 50 mM potassium dihydrogen phosphate buffer were added, and the total volume was made up to 75 μL with water. The reaction was incubated at 37°C for 30 min, and then 75 μL of hydroxylamine hydrochloride (2 M, pH 6.5) was added to terminate the reaction. Next, 50 μL of trichloroacetic acid, hydrochloric acid, and ferric chloride were added to the reaction system, respectively. After centrifugation, the supernatant was collected and the absorbance at 505 nm was measured using a microplate reader.

[0051] Enzyme activity definition: One unit (U) is the amount of enzyme required to convert the substrate F6P to 1 μmol AcP per minute. Activity assay results indicate that the crude activity of wild-type phosphoketolase PKT is 0.71 U / mL.

[0052] Example 3:

[0053] Phosphoketolase mutant strain DW2::fxpK H480K Preparation and enzyme activity determination:

[0054] Using the site-directed mutagenesis strategy, we designed point mutation primers based on the amino acid site to be mutated, and designed the mutation site H480K into the primer fxpK H480K -AR and fxpK H480K -BF. Using the genome of Bacillus licheniformis DW2::fxpK as a template, fxpK H480K -AF / AR and fxpK H480K -BF / BR primers were used to amplify the upstream homology arm and downstream homology arm. H480K -AF and fxpK H480K -BR upstream homology arm and downstream homology arm SOE-PCR, obtain fusion fragment. Using plasmid T2 (2) -ori as template, T2-H480K-F and T2-H480K-R as primers to amplify to obtain linear vector backbone. Subsequently, according to the method of Example 1 and Example 2, obtain phosphoketolase mutant strain DW2::fxpK H480K .

[0055] strain DW2::fxpK H480K The cells were inoculated into 50 mL of LB medium and cultured at 37°C for 12 h. Subsequently, a 3% inoculum was transferred to TB medium and cultured at 37°C for 24 h. The crude phosphoketolase activity of the recombinant strain was determined according to the method in Example 2.

[0056] The experimental results show that compared with DW2::fxpK, DW2::fxpK H480K The enzyme activity was 1.93 U / mL, which was 2.7 times that of DW2::fxpK.

[0057] Among them, the sequence of the primer is:

[0058] T2-T5-F:GAGCTCGTAGAAAAGATCAAAGG

[0059] T2-T5-R:TCTAGAACTAGTGGATCCCCC

[0060] fK H480K -AF:GATCTTTTCTACGAGCTCCGCACACCGAAAGGCTGGA

[0061] fK H480K -AR:TCCTTCCATCTGTTTTTCGCTCAACTGTTCCGTG

[0062] fK H480K -BF:GAAAAACAGATGGAAGGATTTCTG

[0063] fK H480K -BR:GGATCCACTAGTTCTAGAGCCATCGCGTCCAGTTT.

[0064] Example 4: Bacitracin production performance test of recombinant strains

[0065] The recombinant strains DW2::fxpK and DW2::fxpK obtained in Examples 2 and 3 were H480K The strain DW2 and the control strain were inoculated into 50 mL LB medium and cultured at 37°C for 12 h. A 5% inoculum size was transferred into 20 mL bacitracin fermentation medium and cultured at 37°C for 48 h. The bacitracin production was detected by high performance liquid chromatography.

[0066] Bacitracin production assay: Centrifuge 2 mL of fermentation broth at 12,000 rpm for 10 minutes. Take 400 μL of the fermentation supernatant and add it to 1.6 mL of 50% anhydrous ethanol. Mix thoroughly and centrifuge at 12,000 rpm for 10 minutes. Filter 500 μL of the supernatant through a 0.22 μm pore size filter and place it in a liquid chromatography vial for analysis. HPLC column: Agilent Eclipse Plus C18 (4.6 m × 250 mm, 5 μm); Mobile phase: Mobile phase A (100 mL phosphate buffer mixed with 300 mL distilled water): Mobile phase B (520 mL methanol mixed with 40 mL acetonitrile) = 35:65; Detection conditions: Column temperature 30°C, UV detector wavelength 254 nm, flow rate 1.0 mL / min, injection volume 20 μL, and detection time per sample 15 minutes.

[0067] Liquid chromatography detection results showed that DW2::fxpK H480K The bacitracin production of DW2::fxpK was 839.85 U / mL, which was increased by 7.18% and 18.82% compared with DW2::fxpK and DW2, respectively.

[0068] Example 5: Testing the performance of recombinant strains in producing ectoine

[0069] The episomal expression plasmid pHY-P carrying the ectoine synthase EctABC expression cassette was bacA -ectABC He (Li Xujie, Metabolic Engineering Breeding of Bacillus licheniformis DW2 for Synthesis of Ectohydropyrimidines. Hubei University, 2024) were transformed into DW2, DW2::fxpK and DW2::fxpK H480K The recombinant strain DW2 / pHY-P was obtained. bacA -ectABC He 、DW2::fxpK / pHY-P bacA -ectABC He and DW2::fxpK H480K / pHY-P bacA -ectABC He The above strains were inoculated into 50 mL of LB medium and cultured at 37°C for 12 h. A 3% inoculum was then transferred into 30 mL of ectoine fermentation medium and cultured at 37°C for 60 h. The ectoine production was determined by high performance liquid chromatography.

[0070] Ectohydropyrimidine production assay: Centrifuge 2 mL of fermentation broth at 12,000 rpm for 10 minutes. Filter 500 μL of the supernatant through a 0.22 μm pore size filter and place in a liquid chromatography vial for analysis. The liquid chromatography column used was an Agilent Eclipse Plus C18 (4.6 m × 250 mm, 5 μm) with a mobile phase of 2% acetonitrile. The detection conditions were: column temperature 30°C, UV detector wavelength 210 nm, flow rate 1.0 mL / min, injection volume 10 μL, and single sample detection time 15 minutes.

[0071] Liquid chromatography detection results showed that DW2::fxpK H480K / pHY-P bacA -ectABC He The ectoine production was 240.62 mg / L, which was comparable to that of DW2::fxpK / pHY-P bacA -ectABC He and DW2 / pHY-P bacA -ectABC He Compared with the previous results, the figures were increased by 21.01% and 53.87% respectively.

[0072] Example 6: GABA production performance test of recombinant strains

[0073] The free expression plasmid pHY-P carrying the glutamate decarboxylase expression element 43 -gadB Ec (Wang et al., Int. J. Biol. Macromol., 2023, 233: 123468) were transformed into DW2, DW2::fxpK and DW2::fxpK H480K The recombinant strain DW2 / pHY-P was obtained. 43 -gadB Ec 、DW2::fxpK / pHY-P 43 -gadB Ec and DW2::fxpK H480K / pHY-P 43 -gadB Ec The above strains were inoculated into 50 mL of LB medium and cultured at 37°C for 12 h. A 3% inoculum was then transferred into 20 mL of γ-aminobutyric acid fermentation medium and cultured at 37°C for 60 h. The yield was determined by HPLC.

[0074] GABA production assay: 100 μL of supernatant was added, in order, to 200 μL of 1M Na₂CO₃-NaHCO₃ buffer, 100 μL of 80 g / L dansyl chloride-acetonitrile solution, and 600 μL of distilled water. Mix thoroughly and derivatize at 80°C in the dark for 40 minutes. The reaction was then stopped by adding 100 μL of 10% acetic acid. Finally, centrifuge at 12,000 rpm for 5 minutes. Filter 500 μL of the supernatant through a 0.22 μm pore size filter membrane and place in a liquid chromatography vial for analysis. The chromatographic separation column was an Agilent Zorbax Eclipse Plus C18 (250 mm × 4.6 mm, 5 μm); detection conditions were: UV detector wavelength 254 nm, column temperature 30°C, injection volume 20 μL, flow rate 1 mL / min; mobile phase: mobile phase A was tetrahydrofuran:methanol:50 mM sodium acetate = 5:75:420, mobile phase B was 100% methanol, and the mobile phase gradient was set as shown in the table below.

[0075] Liquid chromatography detection results showed that the recombinant strain DW2::fxpK H480K / pHY-P 43 -gadB Ec The γ-aminobutyric acid production of DW2::fxpK / pHY-P was 1.42 g / L, which was comparable to that of DW2::fxpK / pHY-P 43 -gadB Ec and DW2 / pHY-P 43 -gadB Ec Compared with the previous results, the results showed an increase of 23.48% and 61.36% respectively.

[0076]

Claims

1. A phosphoketolase mutant protein H480K, the amino acid sequence of which is shown in SEQ ID NO.

4.

2. A fusion protein obtained by fusing the mutant protein according to claim 1 with a protein tag.

3. A gene encoding the mutant protein according to claim 1 or the fusion protein according to claim 2.

4. An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell comprising the coding gene according to claim 3.

5. Use of the mutant protein according to claim 1, the fusion protein according to claim 2, the encoding gene according to claim 3, the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell according to claim 4 in preparing metabolites; The metabolites are: bacitracin and / or amino acid derivatives derived from acetyl-CoA, and the amino acid derivatives derived from acetyl-CoA are ectoine and / or γ-aminobutyric acid; The recombinant microorganism is recombinant Bacillus licheniformis.

6. A method for improving the activity of phosphoketolase, comprising the following steps: mutating the phosphoketolase by mutating the histidine H at position 480 of SEQ ID NO. 2 to lysine K.

7. A method for preparing a metabolite, comprising the steps of: preparing the metabolite by culturing the recombinant microorganism according to claim 4; The metabolites are: bacitracin and / or amino acid derivatives derived from acetyl-CoA, and the amino acid derivatives derived from acetyl-CoA are ectoine and / or γ-aminobutyric acid; The recombinant microorganism is recombinant Bacillus licheniformis.

Images