IncRNA and application thereof in improving functions of postmenopausal mesenchymal stem cells

Abstract

The invention provides IncRNA and application thereof in improving functions of postmenopausal mesenchymal stem cells, and belongs to the technical field of biological medicine. The lncRNA ZMYM4-AS1 provided by the invention is proved to be capable of remarkably improving the anti-oxidative stress capability, the multiplication capability, the migration capability and the differentiation capability of the mesenchymal stem cells in the body of the postmenopausal female. The improved cell functions play a crucial role in maintaining and repairing tissue damage, so that a new thought and a new method are provided for treating related diseases. The discovery not only has an important scientific value in the field of basic research, but also has a wide application prospect in clinical application, and is expected to bring a new treatment means to the health of postmenopausal women.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an lncRNA and its application in improving the function of postmenopausal mesenchymal stem cells. Background Art

[0002] Mesenchymal stem cells are a type of multipotent stem cells that have all the common properties of stem cells, namely, self-renewal and multidirectional differentiation capabilities. Mesenchymal stem cells have the function of promoting injury repair and improving the prognosis of various diseases. Mesenchymal stem cells exist from a variety of sources, among which mesenchymal stem cells derived from human endometrium have multidirectional differentiation potential and can promote the regeneration process of host tissues through paracrine signals, and have broad application prospects in the field of tissue repair.

[0003] In the existing technology, young endometrial stem cells (Young-hEMSC) are difficult to obtain, and the source of uterine materials is mainly postmenopausal women around 50 years old. At the same time, mesenchymal stem cells derived from the uterus of the elderly (Old-hEMSC) have the defect of poor regeneration ability. Therefore, improving the regeneration ability of mesenchymal stem cells derived from human endometrium is of great significance to the research of related diseases.

[0004] Currently, there is no effective means to improve the function of postmenopausal mesenchymal stem cells. Summary of the invention

[0005] The purpose of the present invention is to provide an lncRNA and its application in improving the function of postmenopausal mesenchymal stem cells, which has many clinical application prospects.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an lncRNA, and the nucleotide sequence of the lncRNA is shown as SEQ ID NO.1.

[0008] The present invention also provides the use of the above-mentioned IncRNA in improving the regeneration ability of mesenchymal stem cells.

[0009] Preferably, the regenerative ability of mesenchymal stem cells is enhanced by overexpressing the lncRNA.

[0010] The present invention also provides the use of the target gene of the above-mentioned lncRNA in improving the regenerative ability of mesenchymal stem cells, and overexpressing the target gene of the lncRNA in mesenchymal stem cells improves the regenerative ability of mesenchymal stem cells.

[0011] Preferably, the nucleotide sequence of the target gene of the lncRNA is shown as SEQ ID NO.2.

[0012] The present invention also provides an expression box, a recombinant vector or a recombinant virus containing the target gene of the IncRNA.

[0013] The present invention also provides an overexpression recombinant vector, comprising the target gene of the above-mentioned IncRNA and the overexpression vector.

[0014] The present invention also provides the use of the above-mentioned expression cassette, recombinant vector or recombinant virus or overexpression recombinant vector in improving the regeneration ability of mesenchymal stem cells.

[0015] Preferably, the mesenchymal stem cells are mesenchymal stem cells derived from the endometrium of the elderly.

[0016] The present invention also provides the use of the above-mentioned IncRNA in any of the following:

[0017] ① Improve the anti-oxidative stress ability of postmenopausal mesenchymal stem cells;

[0018] ② Improve the cell proliferation ability of postmenopausal mesenchymal stem cells;

[0019] ③ Improve the cell migration ability of postmenopausal mesenchymal stem cells;

[0020] ④ Improve the cell differentiation ability of postmenopausal mesenchymal stem cells.

[0021] Beneficial effects of the present invention:

[0022] The lncRNA ZMYM4-AS1 provided by the present invention has been shown to significantly enhance the anti-oxidative stress ability, proliferation ability, migration ability and differentiation ability of mesenchymal stem cells in postmenopausal women. These improved cell functions play a vital role in maintaining and repairing tissue damage, thereby providing new ideas and methods for treating related diseases. This discovery not only has important scientific value in the field of basic research, but also has broad application prospects in clinical applications, and is expected to bring new treatment methods for the health of postmenopausal women. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The pictures are of cells transfected with ZMYM4-AS1 carrying green fluorescent protein and the results of qPCR verification of its transfection efficiency;

[0024] Figure 2 This is the result diagram of the effect of ZMYM4-AS1 on its anti-oxidative stress ability;

[0025] Figure 3 This is a graph showing the effect of ZMYM4-AS1 overexpression on cell proliferation;

[0026] Figure 4This is a graph showing the effect of ZMYM4-AS1 on cell migration ability. DETAILED DESCRIPTION

[0027] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0028] Example

[0029] The invention provides a lncRNA, the sequence is: GAAAACTCCAGAAACAACCAATACTCATTGGCATACATTAACGGTCTGCAGTCAGCTCTCTTAGTCTCTGTGATGGCTATTGCAAACTTCTGCTGGATTCCTTTAGCCTTGACTATCATCAGTATGAATTGAAGAAACAAGATTGTCCTTTGAACTAAAATCCTGTTCATCCTCATTGTCACTACCAACGACTGGAATTCCTGCAAGATCCCCAGAGTTCAAA AAATAATCATCTTCATCCAGCAATGAATTTTCAGATCCTGTTTGATTCGGCATTCCATAAGACATGCTGTCAAGGGTAGGAGTTAAGTTGTGGTCTATATCTTCAGACATTTCTGTATCCATGATACCACCTTAAAAAGTAAAATACTGTTTAGACAAATGATAGTGCTAAAGATGACCACAATGATAAGGTCAGTCTGGTATTTAACCAAATAAATATTTTTTCAAACAAAA, such as SEQID As shown in NO.1, the subsequent experiments named it lncRNAZMYM4-AS1.

[0030] In vitro experiments were performed to transfect lncRNA ZMYM4-AS1 into cells to evaluate the effects of ZMYM4-AS1 on the anti-apoptosis, anti-oxidative stress, proliferation, migration and differentiation abilities of postmenopausal uterine mesenchymal stem cells.

[0031] Figure 1The pictures of ZMYM4-AS1 with green fluorescent protein after transfection into each group of cells and the results of qPCR verification of its transfection efficiency were used to verify the transfection effect of lncRNA ZMYM4-AS1 in BMSCs, young-EMSCs, and old-EMSCs by qPCR (total RNA was extracted using Trizol reagent (Invitrogen), and the purity and concentration were determined using BioSpectrometer (eppendorf)). The target gene sequence was obtained from the NCBI database, and the corresponding primers were designed using primer5 software. The obtained RNA was reverse transcribed into cDNA using PrimeScriptTM RT kit (Takara). qPCR amplification was performed in LightCycler 480 (Roche, Switzerland), 40 cycles, and the reaction program was set to the first stage: 95 degrees for 30 seconds, the second stage: 95 degrees for 5 seconds, 60 degrees for 34 seconds (collecting signals), 40 cycles, and the third stage: 95 degrees for 15 seconds, 60 degrees for 1 minute, and 95 degrees for 15 seconds. GAPDH was used as a negative control). The results showed that after transfection, the expression level of lncRNA ZMYM4-AS1 in old-EMSCs was significantly increased and higher than that in young-EMSCs and BMSCs.

[0032] The target gene sequence of the lncRNAZMYM4-AS1 is: hsa-miR-615-5p, GGGGGUCCCCGGUGCUCGGAUC, as shown in SEQ ID NO.2.

[0033] In terms of anti-oxidative stress, CCK8 assay was used to inoculate cells of different groups into 96-well plates, with 8,000 cells per well and 4 replicates per group. After the cells adhered to the plate, appropriate concentrations of H 2 O 2 The intervention was terminated after the cells were deformed, and the cell CCK8 test was performed and the results were statistically analyzed. The results showed that after overexpression of lncRNA ZMYM4-AS1, the antioxidant capacity of old-ZMYM4-AS1 was significantly higher than that of the old-NC group.

[0034] At the proliferation level, through CCK8 experiment, cells of different groups were inoculated in 96-well plates, 5000 cells per well, and 4 replicates per group. Cell CCK8 detection was performed at 0h, 24h, 48h and 96h, and the results were statistically analyzed. The results showed that after transfection with lncRNAZMYM4-AS1 overexpression (Construction and transfection of lentiviral vector. Packaged lncRNAZMYM4-AS1 overexpression lentiviral vector and NC lentiviral vector were obtained from GeneCare. All lentiviral vectors were transfected with young-EMSCs, old-EMSCs and BMSCs at MOI=10. Young-EMSCs, old-EMSCs and BMSCs were transfected with 3×10 5 ~5×10 5 Pieces / cm 2 The density was inoculated in T25 flasks (Bote) according to the instructions. When young-EMSCs, old-EMSCs and BMSCs grew to 40%-50% confluence, they were transfected according to the manufacturer's instructions, and the transfection efficiency of the lentivirus was verified by qPCR. The results showed that the cell viability of old-EMSCs increased significantly.

[0035] Scratch test (cells of different groups were cultured in their respective six-well plates. When the cell confluence reached 100%, scratches were made with a pipette tip, washed twice with PBS, and incubated in low serum medium at 37°C for 24 h. Bright field photos were taken with an inverted microscope (Nikon, Japan), and the migration rate was measured and analyzed with ImageJ software. The results showed that the cell migration ability of old-ZMYM-AS1 was significantly higher than that of old-EMSC.

[0036] The above results show that the lncRNA ZMYM4-AS1 provided by the present invention can significantly improve the anti-oxidative stress, proliferation, migration and differentiation abilities of old-EMSCs.

[0037] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An lncRNA, characterized in that The nucleotide sequence of the lncRNA is shown in SEQ ID NO.

1.

2. Use of the lncRNA according to claim 1 in improving the function of postmenopausal mesenchymal stem cells.

3. The use according to claim 2, characterized in that: The regenerative ability of mesenchymal stem cells is enhanced by overexpressing the lncRNA.

4. Use of the target gene of IncRNA according to claim 1 in improving the function of postmenopausal mesenchymal stem cells, characterized in that: The target gene of the lncRNA is overexpressed in mesenchymal stem cells to enhance the regenerative ability of the mesenchymal stem cells.

5. The use according to claim 4, characterized in that: The nucleotide sequence of the target gene of the lncRNA is shown in SEQ ID NO.

2.

6. An expression cassette, recombinant vector or recombinant virus containing the target gene of the lncRNA according to claim 1.

7. An overexpression recombinant vector, characterized in that: It comprises the target gene of the IncRNA according to claim 1 and an overexpression vector.

8. Use of the expression cassette, recombinant vector or recombinant virus according to claim 6 or the overexpression recombinant vector according to claim 7 in improving the function of postmenopausal mesenchymal stem cells.

9. The use according to any one of claims 2 to 5, or the use according to claim 8, characterized in that: The mesenchymal stem cells are mesenchymal stem cells derived from postmenopausal women.

10. Use of the lncRNA according to claim 1 in any of the following: ① Improve the anti-oxidative stress ability of postmenopausal mesenchymal stem cells; ② Improve the cell proliferation ability of postmenopausal mesenchymal stem cells; ③ Improve the cell migration ability of postmenopausal mesenchymal stem cells; ④ Improve the cell differentiation ability of postmenopausal mesenchymal stem cells.

Images