Application of the tomato HB52 gene in regulating salt stress resistance in tomatoes

By overexpressing the HB52 gene in tomatoes, the sodium-potassium balance was regulated, enhancing tolerance to salt stress. This solved the limitation of tomato growth on soil salinization in greenhouses and achieved high-quality enhancement of salt stress resistance.

CN119570805BActive Publication Date: 2025-11-14SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411661095.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-20
Publication Date
2025-11-14
Estimated Expiration
2044-11-20

AI Technical Summary

Technical Problem

Secondary salinization of greenhouse soils severely affects tomato growth and yield, and existing technologies lack effective gene regulation methods to improve tomato salt stress resistance.

Method used

The tomato HB52 gene was amplified by PCR and an overexpression vector was constructed. Agrobacterium-mediated transformation was used to transform tomato plants, enhancing their absorption of potassium ions, reducing the absorption of sodium ions, and increasing the potassium/sodium ratio to enhance their tolerance to salt stress.

Benefits of technology

Tomato plants overexpressing the HB52 gene showed greater tolerance to salt stress, with leaves remaining green and growth status superior to wild-type plants. They exhibited increased potassium ion content, decreased sodium ion content, and a higher potassium/sodium ratio, significantly enhancing their resistance to salt stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570805B_ABST
    Figure CN119570805B_ABST
Patent Text Reader

Abstract

This invention discloses the application of the tomato HB52 gene in regulating salt stress resistance in tomatoes, specifically its role in mediating sodium-potassium ion balance and regulating salt stress resistance in tomatoes, belonging to the field of plant genetic engineering technology. Through transcriptome data analysis, the tomato HB52 gene was located. Overexpression and mutant plants of HB52 were constructed, and salt stress treatment experiments confirmed that HB52 has the function of reducing sodium ion content and increasing potassium ion content. Compared with WT and mutants, HB52 overexpression plants exhibited stronger salt stress tolerance, confirming the function and application of this gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of tomato HB52 in regulating tomato salt stress tolerance. Background Technology

[0002] Soil salinization severely impacts crop yield and quality, with 1 billion hectares of land globally suffering from varying degrees of salinization annually. To ensure year-round production of greenhouse vegetables, producers often overuse chemical fertilizers. Combined with the unique semi-enclosed microclimate of greenhouses, this leads to increasingly pronounced secondary soil salinization, severely inhibiting the normal growth and development of vegetable crops and resulting in a significant decline in yield, quality, and economic benefits. Therefore, salt stress has seriously constrained the high-quality development of greenhouse vegetable production.

[0003] Tomatoes are frequently subjected to various abiotic stresses throughout their growth cycle, among which salt stress is one of the most detrimental, leading to decreased yield and quality. More importantly, greenhouse tomato cultivation currently ranks first in the country among all types of greenhouse vegetable cultivation areas. Secondary soil salinization severely restricts the sustainable and high-quality development of the greenhouse vegetable industry, causing significant harm to the growth and production of greenhouse tomatoes. Therefore, elucidating the response of tomatoes to salt stress and its molecular mechanisms, and identifying key genes that enhance tomato salt stress resistance, has important theoretical and practical significance. Summary of the Invention

[0004] This invention analyzes transcriptome data to obtain a salt stress response gene, HB52. The nucleotide sequence of the coding region (CDS) of the HB52 gene is shown in SEQ ID No. 1, with a sequence length of 540 bp. The protein sequence encoded by this gene is shown in SEQ ID No. 2, encoding 179 amino acids.

[0005] This invention utilizes PCR technology to amplify the HB52 gene from cDNA obtained by reverse transcription of tomato genomic mRNA, and constructs this sequence into gene overexpression vectors such as pFGC1008-HA. Through Agrobacterium-mediated transformation of tomato plants, tomato plants with enhanced salt stress resistance can be obtained. The specific technical solution is as follows:

[0006] The first objective of this invention is to provide the tomato HB52 gene, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0007] The amino acid sequence of the protein encoded by the tomato HB52 gene is shown in SEQ ID No. 2.

[0008] The second objective of this invention is to provide an overexpression vector for the tomato HB52 gene, wherein the overexpression vector is constructed by linking the tomato HB52 gene to the AscI and KpnI restriction sites of the pFGC1008-HA vector.

[0009] A third objective of this invention is to provide the application of the aforementioned tomato HB52 gene or the aforementioned overexpression vector in regulating the sodium and potassium ion uptake capacity of tomatoes.

[0010] Furthermore, overexpression of the HB52 gene in tomatoes enhances the absorption of potassium ions, reduces the absorption of sodium ions, and increases the potassium / sodium ratio in tomatoes.

[0011] The fourth objective of this invention is to provide the application of the aforementioned tomato HB52 gene or the aforementioned overexpression vector in regulating the salt stress tolerance of tomatoes.

[0012] Furthermore, overexpression of the HB52 gene in tomatoes enhances the tolerance of tomato plants to salt stress.

[0013] Furthermore, the application involves overexpressing the HB52 gene in tomatoes to enhance potassium ion absorption and reduce sodium ion absorption, thereby increasing the potassium / sodium ratio in the body and enhancing the tomato's tolerance to salt stress.

[0014] A fifth object of the present invention is to provide a method for improving the tolerance of tomatoes to salt stress, the method comprising the following steps:

[0015] S1. Total RNA was extracted from tomato leaves, and cDNA was obtained by reverse transcription. The tomato HB52 gene shown in SEQ ID No.1 was amplified by PCR using cDNA as a template.

[0016] S2. The PCR product obtained from S1 amplification was ligated into the basic vector by double enzyme digestion, positive clones were screened and sequenced to confirm, and the overexpression vector of the tomato HB52 gene was constructed.

[0017] S3. The overexpression vector of the tomato HB52 gene constructed in S2 was introduced into tomato plants through an Agrobacterium-mediated tomato genetic transformation system.

[0018] Furthermore, S1 was subjected to PCR amplification using primers HB52-F and HB52-R, the sequences of which are as follows:

[0019] HB52-F: 5'-ATGGATTTCTTGAGTTGTCA-3' (SEQ ID No. 3);

[0020] HB52-R: 5'-TCAAGACAAAGATGAAGCAAA-3' (SEQ ID No. 4).

[0021] Furthermore, the basic vector in S2 is pFGC1008-HA, and the overexpression vector of the tomato HB52 gene is pFGC1008-HA-OE.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The transcriptome data of this invention located the transcription factor HB52. Salt stress resistance experiments showed that HB52 can regulate the absorption of sodium and potassium ions by plants; plants overexpressing HB52 have enhanced salt stress tolerance, while HB52 loss-of-function mutants are sensitive to salt stress.

[0024] This invention is the first to discover that overexpression of the HB52 gene in tomatoes regulates the sodium-potassium balance of the plant, increases potassium ion content and decreases sodium ion content, thereby enhancing the resistance of tomatoes to salt stress and promoting high-quality development of tomato production. Attached Figure Description

[0025] Figure 1 Construction of HB52 gene overexpression plants and mutants;

[0026] Figure 2 Salt stress phenotype analysis of HB52 gene overexpression plants and mutants;

[0027] Figure 3 Analysis of salt stress resistance in plants and mutants overexpressing the HB52 gene, including:

[0028] Figure 3 A is the Fv / Fm value.

[0029] Figure 3 B represents the sodium ion content in the xylem sap.

[0030] Figure 3 C represents the potassium ion content in the xylem sap.

[0031] Figure 3 D represents the sodium-potassium ratio in the xylem sap. Detailed Implementation

[0032] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0033] Example 1: Isolation and cloning of the HB52 gene

[0034] Based on the results of previous experimental analysis, the basic sequence of the HB52 gene transcript was obtained. In order to clone the HB52 gene, the applicant used wild-type tomato (Ailsa Craig) and extracted total RNA from tomato leaves using TRIZOL reagent (Invitrogen) (extraction method according to the above TRIZOL reagent instructions). Using the ReverTra Ace qPCR RT Kit (Toyobo), 1 μg of tomato total RNA was reverse transcribed into cDNA.

[0035] Based on the coding sequence of the HB52 gene, PCR amplification was performed using primers HB52-F: 5'-ATGGATTTCTTGAGTTGTCA-3' (SEQ ID No. 3); HB52-R: 5'-TCAAGACAAAGATGAAGCAAA-3' (SEQ ID No. 4) to obtain the full-length coding sequence of the HB52 gene.

[0036] Then, the enzyme was digested and ligated into pFGC1008-HA to obtain the overexpression vector pFGC1008-HB52-HA-OE. Sequencing was performed by Hangzhou Qingke Zixi Biotechnology Co., Ltd., and the sequencing results are shown in SEQ ID NO: 1. The encoded protein sequence is shown in SEQ ID NO: 2. The results show that the cloned sequence is consistent with the sequence published in Solenomics (Solyc02g077590.1).

[0037] The PCR reaction system is as follows:

[0038]

[0039]

[0040] PCR reaction conditions settings:

[0041]

[0042] Example 2: Vector construction of HB52 gene mutant

[0043] The construction of the HB52 mutant material was based on the CRISPR-Cas9 system. The HB52 gene sequence was imported into the online CRISPR-GE database (http: / / skl.scau.edu.cn / targetdesign / ), and a suitable target site, 5'-AAGAACTAGGGTTGCCACCT-3' (SEQ ID No. 5), was selected. Adapter sequences were added before and after the target site, and PCR amplification was performed to obtain the PCR product containing the target site. The purified product was then ligated into the PTX41 vector (purchased from Beijing Huayueyang Biotechnology Co., Ltd.) using a combination of BsaI-HF restriction enzyme and T4 ligase. Sequencing yielded the successfully constructed mutant vector PTX41-HB52.

[0044] Example 3: Construction of HB52 mutant plants and overexpression plants

[0045] 1. The methods for constructing mutant plants and overexpressing plants are as follows:

[0046] First, the positive clones pFGC1008-HB52-HA-OE and PTX41-HB52 vectors obtained in Examples 1 and 2 were sequenced correctly and then used for transformation. Specifically, they were introduced into the tomato variety Ailsa Craig using an Agrobacterium-mediated tomato genetic transformation system. After pre-culture, infection, co-culture, screening for resistant callus, differentiation, rooting, transplanting, and identification, transgenic plants were obtained. Transformation of the pAC004-HB52-HA vector yielded two independent overexpressing tomato plants, numbered HB52-OE-1 and HB52-OE-2. Transformation of the PTX41-HB52 vector yielded two independent mutant plants, numbered hb52-1 and hb52-2. Wild-type Ailsa Craig plants were also used as a control.

[0047] The specific steps are as follows:

[0048] (1) Sowing: Soak several seeds of the tomato variety Ailsa Craig in water for 3-4 hours in advance, then pour out the water and add 75% alcohol for 45 seconds to disinfect, rinse twice with sterile water, add 10% NaClO for 12 minutes (avoid light), wash the seeds five times with sterile water, soak for about two minutes each time, pour out the sterile water, absorb the water slightly, and then transfer them to 1 / 2 MS germination medium for dark culture.

[0049] (2) Cut seedlings for pre-culture: When the seeds germinate and grow to have two mature cotyledons, cut off the leaf tips and leaf bases with scissors, spread the cotyledons on the pre-culture medium, and pre-culture in the dark for about 1-2 days.

[0050] (3) Agrobacterium culture: Agrobacterium LBA4404 (from Shanghai Weidi Biotechnology, a commercial strain) was pre-cultured on YEB solid medium with corresponding resistance selection for two days at a temperature of 28℃; Agrobacterium containing pFGC1008-HB52-HA-OE and PTX41-HB52 plasmids were transferred to YEB liquid medium and cultured on a shaker at 28℃ for 12 hours.

[0051] (4) Agrobacterium infection and co-culture: The suspensions of Agrobacterium containing pFGC1008-HB52-HA-OE and PTX41-HB52 plasmids were adjusted to OD using liquid MS medium. 600 0.2-0.3, gently shake the cotyledons in Agrobacterium suspension for 12-15 min, then transfer them to sterilized filter paper to blot dry, and place them on co-culture medium for 2 days;

[0052] (5) Screening culture: Transfer the cotyledons on the co-culture medium to the screening medium, and change the medium every two weeks until adventitious buds grow from the callus tissue.

[0053] (6) Rooting: Cut off the adventitious buds, remove all the surrounding callus tissue, keep them as intact as possible, and transfer them to the rooting medium (insertion medium) for rooting culture.

[0054] (7) Transplanting: Select healthy plants that have grown roots and transplant them into nutrient soil. After the plants grow normally, conduct an assessment.

[0055] 2. The identification steps for overexpression and mutant plants are as follows:

[0056] (1) DNA extraction: Cut off leaves about 1 cm in size and extract DNA using the CTAB method (formula below). First, heat and extract with 1.5×CTAB extraction solution, then add chloroform and isoamyl alcohol to separate the organic phase. Then, precipitate the DNA with anhydrous ethanol and wash with 75% ethanol to obtain the DNA solution.

[0057] (2) Vector Transformation Identification: To verify whether the pFGC1008-HB52-HA-OE overexpression vector had transformed into plants, qRT-PCR amplification was performed using HB52-specific primers: HB52-F: 5'-ATGGATTTCTTGAGTTGTCA-3' (SEQ ID No. 3); HB52-R: 5'-TCAAGACAAAGATGAAGCAAA-3' (SEQ ID No. 4). PCR reaction conditions were: 94℃ pre-denaturation for 5 min; 94℃ for 30 sec, 60℃ for 30 sec, 72℃ for 1 min, 35 cycles; extension at 72℃ for 5 min. The tomato ACTIN2 gene was used as an internal control, and the relative expression level of the gene was calculated according to the method of (Livak and Schmittgen., 2001). Figure 1 A);

[0058] (1) In order to verify whether the mutant vector PTX41-HB was transformed into the plant, a primer sgRNAhb52-F:5'-ATGGATTTCTTGAGTTGTCAAA-3' (SEQ ID No. 6) was designed before and after sgRNA.

[0059] sgRNAhb52-R:5'-AGGTGGCAACCCTAGTTCTT-3' (SEQ ID No. 7) was amplified by PCR. The PCR product was sequenced by Hangzhou Qingke Zixi Biotechnology Co., Ltd., and the sequence was aligned using BioXM software (V2.7). Two independent hb52 mutants were screened for experimental use. Figure 1 B).

[0060] Example 4 Salt Stress Test

[0061] The steps for treating salt stress are as follows:

[0062] When the HB52 gene overexpressing plants, hb52 mutant plants and wild-type plants grew to five leaves and one heart, each seedling was watered with 200 ml of ddH2O containing 200 mM NaCl every other day until the treatment was completed. The stress treatment lasted for 7 days.

[0063] Plants overexpressing the HB52 gene, hb52 mutant plants, and wild-type tomato plants served as blank controls. After salt stress treatment, these plants were compared with a control group grown under the same conditions but without salt stress treatment. The differences in various performance characteristics between HB52 transgenic plants, hb52 mutant plants, wild-type plants, and untreated plants were observed. The results are as follows: Figure 2 As shown.

[0064] Immediately after the experiment, a photograph is taken showing the phenotype, such as... Figure 2As shown, after salt stress treatment, the leaves of WT plants began to wither and turn yellow. In contrast, the leaves of transgenic plants OE-1# and OE-2#, which overexpress the tomato HB52 gene, remained green and their growth was significantly better than that of WT plants. The knockout plants, specifically the hb52 mutant, were significantly worse than the wild type.

[0065] To confirm the observed phenotype, we measured the Fv / Fm of WT, overexpressing plants, and knockout plants, as well as the potassium and sodium ion content in the xylem sap and the sodium-potassium ratio in the xylem sap. The results showed that, as Figure 3 As shown, there was no significant difference in Fv / Fm values ​​among WT, overexpressing plants, and knockout plants without salt stress treatment. After salt stress treatment, although the Fv / Fm values ​​of all plants decreased, the Fv / Fm values ​​of OE plants were significantly higher than those of WT plants, and those of knockout plants were significantly lower than those of WT plants. Figure 3 A).

[0066] In addition, under control conditions, there were no significant differences in sodium and potassium ion content and sodium-potassium ratio in the xylem sap of WT, overexpression, and knockout plants. After salt stress treatment, the sodium ion content in the xylem sap of knockout plants was significantly higher than that of WT, while that of overexpression plants was significantly lower than that of WT, and the potassium ion content was exactly the opposite. Furthermore, the sodium-potassium ratio in the xylem sap of knockout plants was significantly higher than that of wild type, while the sodium-potassium ratio in overexpression plants was significantly lower than that of wild type. Figure 3 B. Figure 3 C Figure 3 D).

[0067] In summary, it can be seen that the tomato HB52 gene can regulate the absorption of sodium and potassium ions in plants; overexpression of the HB52 gene in tomatoes enhances potassium ion absorption, reduces sodium ion absorption, and increases the potassium / sodium ratio in tomatoes. HB52-overexpressing plants exhibit enhanced salt stress tolerance, while HB52 loss-of-function mutants are sensitive to salt stress.

[0068] SEQ ID No. 1 Nucleotide sequence of the tomato HB52 gene

[0069] ATGGATTTCTTGAGTTGTCAAACTCAAAAAATTCATTTAAAATGTCACAAGAAAAGACTCAACCAAGATCAAATGAGGCTCTTAGAGATTAGCTTCAGTCTCGAATAACAAGCTTGATTCCGATAGAAAATTTCAA CTTGCCCAAGAACTAGGGTTGCCACCTAGGCAAATCGCAATATGGTATCAAAACAAGCGAGCACGATGGAAAAGTCAAAGCCTTGAGGTTGACTATAAGACCTTGCAACAAAGACTAGATAATGCCCTTGAGGAT AATGAGAAGTTGAAATTGGAAGTTGAGAGGCTAAGAAAAGAGCTAAACAAAAATCAAGAAGTGTTGTTGGGATTCAACACCACAACTACTAATAATTATTCATCAATTTCAAGTTCTTGTGATGAAGTTGGGAGT ACTTCATGTTTGCAACTTCATGATCAATCCAAGCATAATCATCTTGATAAGGATTTTTATGCTTGTTTAATTGGTGATGAAGGTCACTTTGGGACACATGATGGGCATAATTTCTTTGCTTCATCTTTGTCTTGA

[0070] SEQ ID No. 2 Amino acid sequence encoded by the tomato HB52 gene

[0071] MDFLSCQTQKIHLKCHKKRLNQDQMRLLEISFSSNNKLDSDRKFQLAQELGLPPRQIAIWYQNKRARWKSQSLEVDYKTLQQRLDNALEDNEKLKLEVERLRKELNKNQEVLLGFNTTTTNNYSSISSSCDEVGSTSCLQLHDQSKHNHLDKDFYACLIGDEGHFGTHDGHNFFASSLS

[0072] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of the tomato HB52 gene or its overexpression vector in regulating the absorption capacity of sodium and potassium ions in tomatoes, characterized in that... Overexpression of the HB52 gene in tomato enhances the absorption of potassium ions and reduces the absorption of sodium ions, thereby increasing the potassium / sodium ratio in tomatoes. The nucleotide sequence of the tomato HB52 gene is shown in SEQ ID No.

1. The overexpression vector is constructed by linking the tomato HB52 gene to the AscI and KpnI restriction enzyme sites of the pFGC1008-HA vector.

2. The application of the tomato HB52 gene or its overexpression vector in regulating tomato tolerance to salt stress, characterized in that, Overexpression of the HB52 gene in tomato enhances the tolerance of tomato plants to salt stress. The nucleotide sequence of the tomato HB52 gene is shown in SEQ ID No.

1. The overexpression vector is constructed by linking the tomato HB52 gene to the AscI and KpnI restriction enzyme sites of the pFGC1008-HA vector.

3. The application according to claim 2, characterized in that, By overexpressing the HB52 gene in tomatoes, the absorption of potassium ions is enhanced and the absorption of sodium ions is reduced, thereby increasing the potassium / sodium ratio in tomatoes and enhancing their tolerance to salt stress.

4. A method for improving the tolerance of tomatoes to salt stress, characterized in that, The method includes the following steps: S1. Total RNA was extracted from tomato leaves, and cDNA was obtained by reverse transcription. The tomato HB52 gene was amplified by PCR using cDNA as a template. S2. The PCR product obtained from S1 amplification was ligated into the basic vector by double enzyme digestion, positive clones were screened and sequenced to confirm, and the overexpression vector of the tomato HB52 gene was constructed. S3. The overexpression vector of the tomato HB52 gene constructed in S2 was introduced into tomato plants through an Agrobacterium-mediated tomato genetic transformation system; the nucleotide sequence of the tomato HB52 gene is shown in SEQ ID No.

1.

5. The method according to claim 4, characterized in that, S1 was performed using primers HB52-F and HB52-R for PCR amplification. The sequences of primers HB52-F and HB52-R are as follows: HB52-F: 5'-ATGGATTTCTTGAGTTGTCA-3'; HB52-R: 5'-TCAAGACAAAGATGAAGCAAA-3'.

6. The method according to claim 4, characterized in that, The basic carrier mentioned in S2 is pFGC1008-HA.

Citation Information

Patent Citations

  • PuHB52 gene for improving salt tolerance of populus nigra, protein coded by PuHB52 gene and application of PuHB52 gene

    CN116574741A

  • KR20220043605A