Sorghum aphid MsCYP1 gene, encoded protein, dsRNA and application thereof

Abstract

The application discloses a kind of high corn aphid MsCYP1 Gene, its encoding protein, dsRNA and application, to solve the technical problem of lack of key genes when using RNA interference technology to carry out high corn aphid biological control at present.The application has screened the high corn aphid protein MsCYP1 that can be secreted into high corn cell, and the protein and its encoding gene can inhibit the hydrogen peroxide content and immune response in high corn.Meanwhile, according to the cDNA sequence of high corn aphid MsCYP1 Gene, the dsRNA designed for the gene is introduced into high corn aphid body by artificial feeding mode, and it is found that it can significantly inhibit high corn aphid MsCYP1 Gene, and further affect the honeydew secretion amount and reproduction rate of high corn aphid, MsCYP1 MsCYP1 MsCYP1 MsCYP1 MsCYP1 MsC Gene can be used as RNAi target gene for aphid control, which is beneficial to reduce pesticide use and maintain ecological balance.

Description

Technical Field

[0001] This invention application relates to the field of biological control technology, specifically to a sorghum aphid. MsCYP1 Genes, their encoded proteins, dsRNAs, and their applications. Background Technology

[0002] Sorghum is the world's fifth largest food crop and one of the earliest cultivated cereal crops in China, holding an extremely important position in agricultural production. Sorghum possesses strong resistance to drought, flooding, salinity, poor soil, and high temperatures, making it suitable for food, feed, brewing, bioenergy, and chemical materials. It is one of the most promising dual-purpose crops for both food and feed, as well as an energy plant. However, sorghum seedlings are susceptible to sorghum aphids (… Melanaphis sacchari The sorghum aphid is a major pest in sorghum production in my country, with a single plant potentially infested with up to 30,000 aphids. Using their piercing-sucking mouthparts, the aphid penetrates the plant, feeding on the sap from the underside of leaves and the phloem of stems, and excreting honeydew, a high-sugar substance. This not only promotes fungal growth but also causes nutrient loss, leading to reduced yields and even the death of the entire plant. Furthermore, the sorghum aphid acts as a vector for plant viral diseases such as red leaf disease in cereals, yellow leaf disease in sugarcane, and sugarcane mosaic virus, indirectly harming crops. If insecticides are used, yield losses caused by sorghum aphids can reach 46% to 78%, and the aphids severely impact various economic traits of sorghum, such as reducing grain protein content, significantly decreasing stem sugar content, and causing damaged stems to be unsuitable for storage, resulting in devastating damage. Therefore, effective control of sorghum aphids is crucial for ensuring sorghum yield and quality.

[0003] Traditional methods for controlling sorghum aphids include the use of chemical pesticides. Chemical control is fast-acting, highly effective, and not limited by region or time. However, the large-scale use of chemical pesticides can cause environmental pollution, which is inconsistent with the theme of green development. Furthermore, pesticide residues in sorghum can harm humans and livestock. Long-term use of chemical pesticides can also cause aphids to develop resistance, thus losing their control effect.

[0004] RNA interference (RNAi) refers to the entry of double-stranded RNA (dsRNA) into cells to guide the efficient and specific degradation of homologous mRNA, thereby inhibiting and downregulating the expression of target genes. Currently, RNAi technology has been widely studied and applied in modern agriculture. Silenting target genes through artificial feeding, microinjection of dsRNA, and nanoparticle-mediated methods has been widely used in the identification and analysis of insect gene function. Therefore, identifying key genes in sorghum aphids that enable RNAi biocontrol is of great significance for ensuring my country's food security and environmental safety.

[0005] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0006] In view of at least one of the above technical problems, this disclosure provides a sorghum aphid MsCYP1 The study aims to address the technical challenge of lacking key genes in the current biocontrol of sorghum aphids using RNA interference technology, including the study of genes, their encoded proteins, dsRNA, and their applications.

[0007] According to one aspect of this disclosure, a sorghum aphid gene is provided. MsCYP1 Its nucleotide sequence is shown in SEQ ID NO.1.

[0008] According to a second aspect of this disclosure, a sorghum aphid gene is provided. MsCYP1 The encoded protein has the amino acid sequence shown in SEQ ID NO. 2.

[0009] According to a third aspect of this disclosure, a gene for inhibiting the sorghum aphid is provided. MsCYP1 The expressed dsRNA.

[0010] In some embodiments of this disclosure, the dsRNA is a double-stranded RNA composed of nucleotides of the sequence shown in SEQ ID NO. 3 and its reverse complementary sequence.

[0011] According to a fourth aspect of this disclosure, a biological material is provided containing the sorghum aphid gene. MsCYP1 Or the dsRNA.

[0012] In some embodiments of this disclosure, the biological materials include recombinant DNA, expression cassettes, plasmid vectors, viral vectors, or engineered bacteria.

[0013] According to the fifth aspect of this disclosure, the sorghum aphid gene MsCYP1 The encoded protein, the dsRNA, or the biological material is used in any one of the following (1) to (6):

[0014] (1) Controlling sorghum aphids or preparing products for controlling sorghum aphids;

[0015] (2) Reduce the survival rate of sorghum aphids or prepare products that reduce the survival rate of sorghum aphids;

[0016] (3) Suppressing the sorghum aphid gene MsCYP1 Expressing or preparing genes that inhibit sorghum aphids MsCYP1 The product being expressed;

[0017] (4) Regulating the immune response of sorghum and / or the hydrogen peroxide content of sorghum or preparing products that regulate the immune response of sorghum and / or the hydrogen peroxide content of sorghum;

[0018] (5) Inhibit sorghum aphids from feeding and / or from secreting honeydew, or prepare products that inhibit sorghum aphids from feeding and / or from secreting honeydew;

[0019] (6) Inhibit the reproduction and / or growth of sorghum aphids or prepare products that inhibit the reproduction and / or growth of sorghum aphids.

[0020] According to the sixth aspect of this disclosure, a product is provided in which the active ingredient is any one of the following A to D:

[0021] A. The above-mentioned sorghum aphid gene MsCYP1 ;

[0022] B. The encoded protein mentioned above;

[0023] C. The above-mentioned dsRNA;

[0024] D. The above-mentioned biological materials;

[0025] The product has at least one of the following functions (1) to (6):

[0026] (1) Control of sorghum aphids;

[0027] (2) Reduce the survival rate of sorghum aphids;

[0028] (3) Suppressing the sorghum aphid gene MsCYP1 Express;

[0029] (4) Regulate the immune response of sorghum and / or the hydrogen peroxide content of sorghum;

[0030] (5) Inhibit sorghum aphids from feeding and / or secreting honeydew;

[0031] (6) Inhibit the reproduction and / or growth of sorghum aphids.

[0032] One or more technical solutions provided in the embodiments of this application have at least one of the following technical effects or advantages:

[0033] 1. A sorghum aphid protein, MsCYP1, that can be secreted into sorghum cells was screened. This protein and its encoding gene can inhibit the hydrogen peroxide content and immune response in sorghum.

[0034] 2. Based on the sorghum aphid MsCYP1 The cDNA sequence of the gene was obtained, and a dsRNA targeting this gene was designed. This dsRNA was introduced into sorghum aphids via artificial feeding, and it was found to significantly inhibit sorghum aphid growth. MsCYP1Genes, in turn, affect the honeydew secretion (feeding amount) and reproductive rate of sorghum aphids. MsCYP1 The gene can be used as an RNAi target gene for aphid control, which helps reduce pesticide use and maintain ecological balance. Attached Figure Description

[0035] Figure 1 As shown in one embodiment of this application dsMsCYP1 Agarose gel electrophoresis image of dsGFP.

[0036] Figure 2 In one embodiment of this application, after artificially feeding dsRNA MsCYP1 Results of relative gene expression analysis; where dsGFP: sorghum aphids fed dsGFP; dsMsCYP1: sorghum aphids fed dsMsCYP1; ** indicates P<0.01, reaching extremely significant difference.

[0037] Figure 3 The results of the analysis of the reproduction rate and honeydew volume of sorghum aphids after artificial feeding in one embodiment of this application are shown below; where A: the amount of honeydew excreted by sorghum aphids two days after artificial feeding, and B: the number of newly generated sorghum aphids at 2, 4, and 6 days after artificial feeding; * indicates P<0.05, and ** indicates P<0.01.

[0038] Figure 4 This is the result of the expression of the MsCYP1 protein of the sorghum aphid in sorghum protoplasts in one embodiment of this application; wherein, GFP-Flag: GFP-Flag fusion protein expressed in sorghum protoplasts; MsCYP1-Flag: MsCYP1-Flag fusion protein expressed in sorghum protoplasts.

[0039] Figure 5 Overexpression in one embodiment of this application MsCYP1 Results of hydrogen peroxide accumulation in sorghum protoplast cells; among which, GFP+chitosan: hydrogen peroxide accumulation in chitin-treated sorghum protoplasts expressing the GFP gene (control group); MsCYP1+chitosan: hydrogen peroxide accumulation in chitin-treated sorghum protoplasts expressing the GFP gene. MsCYP1 The amount of hydrogen peroxide accumulated in the protoplasts of sorghum; ** indicates P<0.01. Detailed Implementation

[0040] The specific implementation of this application will be described below with reference to the embodiments. However, the following embodiments are only used to illustrate this application in detail and do not limit the scope of this application in any way.

[0041] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; unless otherwise specified, the reagents involved are all commercially available conventional reagents; unless otherwise specified, the detection methods involved are all conventional methods.

[0042] Example 1: Sorghum Aphid MsCYP1 gene segregation

[0043] This example analyzes the sorghum proteome after sorghum aphids have fed on sorghum, identifying a sorghum aphid protein, MsCYP1, that can be secreted into sorghum cells. Primers were then designed based on the coding sequence of this protein.

[0044] MsCYP1-F: 5'-ATGGCGTCCACCACGTTT-3';

[0045] MsCYP1-R: 5'-TTAACTCAATTGTCCACA-3'.

[0046] PCR amplification was performed using sorghum aphid cDNA as a template, employing a 50µl high-fidelity enzyme KOD-FX-Neo (TOYOBO, Japan) reaction system. The PCR conditions were: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s; 68℃ annealing extension for 30 s / kb; 32 cycles. The PCR reaction system is shown in Table 1.

[0047] Table 1 PCR reaction system

[0048] .

[0049] After PCR amplification, the amplification products were recovered by gel extraction and then ligated into pEASY. ® Positive clones were screened and sequenced using the Blunt Zero vector. The sequencing results are shown in SEQ ID NO:1.

[0050] Example 2: Preparation of dsMsCYP1 and its control dsGFP

[0051] Using cDNA from sorghum aphids as a template, PCR amplification was performed using dsMsCYP1-F and dsMsCYP1-R primers (the underlined region is the T7 RNA polymerase promoter sequence) to obtain the PCR amplification product.

[0052] F: 5'- TAATACGACTCACTATAGGG TCGAGCTTCGCAGTGATGTT-3';

[0053] R: 5'- TAATACGACTCACTATAGGG TGTCCACAATTAGCGACAGTGA-3'.

[0054] Using a GFP-containing plasmid as a template, PCR amplification was performed using dsGFP-F and dsGFP-R primers (the underlined region is the T7 RNA polymerase promoter sequence) to obtain the PCR amplification product.

[0055] F: 5'- TAATACGACTCACTATAGGG ATGGTGAGCAAGGGCGAGGA-3';

[0056] R: 5'- TAATACGACTCACTATAGGG TTGAAGTTCACCTTGATGCCGT-3'.

[0057] The above amplification product was ligated into pEASY. ® The Blunt Zero vector was sent for sequencing to obtain a correct positive clone. Using this clone plasmid as a template, the same primers were used for amplification. The amplification product was purified and recovered at a concentration of 1 μg / μL, and used as a template for dsRNA synthesis.

[0058] Add the following ingredients in the correct proportions: 1 μg template, 2 μL 10× T7 Reaction Buffer, 2 μL ATP Solution (75 mM), 2 μL CTP Solution (75 mM), 2 μL GTP Solution (75 mM), 2 μL UTP Solution (75 mM), 2 μL T7 Enzyme Mix, and Nuclease-free Water to a final volume of 20 μL. Gently tap to mix and centrifuge briefly. Place in a PCR machine and program at 37°C for 4 hours to complete transcription and produce dsRNA.

[0059] Subsequently, the template DNA and ssRNA were removed by nuclease digestion: 20 μL dsRNA, 21 μL Nuclease-free Water, 5 μL 10× Digestion Buffer, 2 μL DNase I, and 2 μL RNase were added, mixed thoroughly, centrifuged briefly, and placed in a PCR instrument at 37℃ for 1 h to obtain dsRNA with template DNA and ssRNA removed.

[0060] Finally, dsRNA was filtered and recovered: 50 μL dsRNA, 50 μL 10× Binding Buffer, 150 μL Nuclease-free Water, and 250 μL 100% Ethanol were mixed by inversion and added to the filter. The mixture was centrifuged for 2 min, washed with 500 μL Wash Solution, and then 50 μL Ethanol Solution was added and centrifuged for 2 min to obtain dsRNA. The concentration and purity were detected using a Nanodrop UV spectrophotometer and agarose gel electrophoresis. If the detection band is a single, bright band, such as... Figure 1 As shown, if its OD260 / 280 is between 1.8 and 2.0, it indicates that the dsRNA quality is good. Adjust the dsRNA to 250 ng / μL and store it at -20℃ for later use.

[0061] Example 3: Artificial feeding of dsMsCYP1 and dsGFP and effect detection

[0062] Preparation of sorghum aphids: Take sorghum aphids of uniform size that have been raised on BTx623 sorghum seedlings, place them in a petri dish, and starve them for 12 hours.

[0063] Artificial feeding: Prepare 15% sucrose water and mix it with dsRNA in a 1:1 ratio to make artificial feed. Use artificial feeding to introduce dsMsCYP1 into the sorghum aphid.

[0064] Sampling was started 24 hours after artificial feeding of sorghum aphids, with 5 aphids per replicate, repeated 3 times. Sorghum aphids fed with dsGFP were used as a control. Changes in gene expression were verified by qRT-PCR.

[0065] The specific procedures are as follows: After sampling, RNA was extracted and reversed using Invitrogen SuperScript II reverse transcriptase (catalog number 18064014) according to the manufacturer's instructions to obtain cDNA products. The cDNA products were diluted 10-fold with water, and then the reaction system was prepared according to the SYBR HPremix ExTaq™ II (TaKaRa) manufacturer's instructions. Real-time quantitative PCR was performed on a Roche LightCycler 480 instrument. The real-time quantitative PCR reaction conditions were: 95℃ pre-denaturation for 1 min, 95℃ denaturation for 10 s, 60℃ annealing extension for 30 s, repeating the last two steps for 40 cycles. Finally, melting curves were performed at 65℃-95℃, increasing by 0.5℃ for 5 s at each step, to determine the specificity of the amplified products.

[0066] internal reference gene actin primers:

[0067] Actin-F: 5'-TGTGACGATGATGTAGCAGCTT-3';

[0068] Actin-R: 5'-TACCGACCATGACTCCTTGATG-3'.

[0069] MsCYP1 quantitative primers:

[0070] QMsCYP1-F: 5'-ACTGCTCCACTCCGAATCAC-3';

[0071] QMsCYP1-R: 5'-TCGGGAGACTCATTTTTGGCA-3'.

[0072] The results are as follows Figure 2 As shown, compared with the control group artificially fed dsGFP, the sorghum aphids artificially fed dsMsCYP1 had significantly lower levels of dsGFP. MsCYP1 The relative expression level of the gene was significantly reduced, showing a highly significant difference compared to the control (P<0.01). This indicates that artificial feeding of dsMsCYP1 can induce a decrease in the expression level of the gene in sorghum aphids. MsCYP1 RNA interference with genes leads to a significant decrease in gene expression levels.

[0073] Example 4: Phenotypic detection of sorghum aphids after artificial feeding

[0074] Honeydew experiment of sorghum aphids: Sorghum aphids of dsMsCYP1 were artificially fed and placed in petri dishes (with a layer of water-moistened filter paper in the dish), and 2 cm of sorghum seedling stems were added. After two days, the filter paper was removed, and the mixture was stained with 0.1% ninhydrin. The stained area was calculated using ImageJ. Three aphids were used each time, and the experiment was repeated 5 times. The results are as follows. Figure 3 As shown, the amount of honeydew produced by sorghum aphids was significantly reduced after feeding with dsMsCYP1. This indicates that dsMsCYP1 inhibits... MsCYP1 The level of gene expression, in turn, affects the feeding behavior of sorghum aphids.

[0075] Sorghum aphid reproduction rate experiment: Sorghum aphids were divided into two groups, one artificially fed with dsGFP and the other artificially fed with dsMsCYP1. After 24 hours of feeding, they were returned to BTx623 sorghum seedlings. Ten aphids were used each time, and the experiment was repeated 5 times. Results are as follows: Figure 3 As shown, the number of sorghum aphids produced by artificially feeding dsMsCYP1 was significantly lower than that of artificially feeding dsGFP from the 4th day onwards, indicating that dsMsCYP1 can inhibit the reproduction of sorghum aphids.

[0076] Example 5: Sorghum Aphid MsCYP1 Construction of gene expression vectors

[0077] With MsCYP1Using the gene plasmid as a template, the gene was amplified using the high-fidelity enzyme KOD-FX-Neo (TOYOBO, Japan) and primers EMsCYP1-F and EMsCYP1-R (the underlined regions are the adapter sequences for constructing the vector). MsCYP1 The ORF sequence of the gene.

[0078] F: 5'- AGATCCAGTGGGATCC ATGGCGTCCACCACGTTTCG-3' ;

[0079] R: 5'- TTATAGTCAAGCTTGGTACC ACTCAATTGTCCACAATT-3' .

[0080] After PCR amplification, the gene was ligated into the vector pHZ-206 (with a Flag tag) using the In-Fusion cloning kit (TaKaRa, Japan) to construct the recombinant plasmid MsCYP1-Flag. This plasmid was then transformed into DH5α Escherichia coli strains. Single clones were selected, positive clones were identified by PCR and sent for sequencing. The recombinant plasmids with correct sequencing results were preserved.

[0081] Example 6: Sorghum Aphid MsCYP1 Verification of immune function of sorghum cells after gene overexpression

[0082] Combining the method for preparing maize protoplasts (Coy et al. Protoplast Isolation and Transfection in Maize. In: Wang, K., Zhang, F. (eds) Protoplast Technology. Methods in Molecular Biology. 2022. 2464.), the preparation of sorghum protoplasts was optimized as follows: Sorghum seedlings grown on 1 / 2 MS medium for 14 days were selected, and the young stems were cut into 0.5 cm segments and placed in an enzymatic hydrolysis solution (10 mM MES-KOH, 0.6 M D-mannitol, 1.5% w / v Cellulase R-10, 0.75% w / v Macerozyme R-10, 0.1% w / v BSA, 1 mM CaCl2). The solution was used for enzymatic hydrolysis at 28 ℃ and 80 rpm for 4 h, and the sorghum protoplasts were collected. The recombinant plasmid MsCYP1-Flag from Example 5 was introduced into sorghum protoplasts using a transient transformation system, inducing the expression of the recombinant protein MsCYP1-Flag in the protoplasts, with GFP-Flag serving as a control. After transformation, the protoplasts were cultured at 28°C for 16 h, and the proteins were extracted and analyzed by Western blot. The results are as follows: Figure 4As shown, the MsCYP1 protein of the sorghum aphid can be stably expressed in sorghum cells. Subsequently, the sorghum aphid was overexpressed using a protoplast transformation system. MsCYP1 Genes and controls GFP After gene transformation and culture for 16 h, the cells were treated with 0.04% chitin for 8 h. Protoplast cells were then collected, and the hydrogen peroxide content was determined using a hydrogen peroxide content kit (Keming Biotechnology). The results are as follows: Figure 5 As shown, after chitin treatment, the hydrogen peroxide content in protoplasts expressing MsCYP1 protein decreased significantly, indicating that the sorghum aphid... MsCYP1 The gene can suppress the immune response of sorghum cells.

[0083] Although some preferred embodiments of this invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0084] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from the spirit and scope of its inventive concept. Therefore, if these modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include these modifications and variations.

Claims

1. Inhibit the sorghum aphid gene with nucleotide sequences as shown in SEQ ID NO.1 MsCYP1 The expressed dsRNA is characterized by, It is a double-stranded RNA composed of nucleotides of the sequence shown in SEQ ID NO. 3 and its reverse complementary sequence.

2. A biological material comprising recombinant DNA, expression cassette, plasmid vector, viral vector, or engineered bacteria containing the dsRNA of claim 1.

3. The use of the dsRNA of claim 1 or the biological material of claim 2 in any one of the following (1) to (5): (1) Controlling sorghum aphids or preparing products for controlling sorghum aphids; (2) Reduce the survival rate of sorghum aphids or prepare products that reduce the survival rate of sorghum aphids; (3) Suppressing the sorghum aphid gene MsCYP1 Expressing or preparing genes that suppress sorghum aphids MsCYP1 The product being expressed; (4) Inhibit sorghum aphids from feeding and / or from secreting honeydew, or prepare products that inhibit sorghum aphids from feeding and / or from secreting honeydew; (5) Inhibit the reproduction and / or growth of sorghum aphids or prepare products that inhibit the reproduction and / or growth of sorghum aphids.

Images