A SNP molecular marker associated with chicken body weight and its application

Abstract

The invention discloses a SNP molecular marker related to chicken weight and its application, belonging to the field of molecular biology. By sequencing the genome of a deep hybrid population and performing GWAS analysis, a SNP site chrI:170405727 significantly related to 6 weeks of age and 8 weeks of age was found, and C at this site is a dominant allele in high-weight chickens. The SMR method was used to integrate GWAS and eQTL, and it was found that the SNP site far-end regulated the ESD gene. There are three genotypes at this site, among which the ESD gene of the CC genotype is more expressed in muscle tissue. For this site, SNP frequency analysis was performed on high-weight and low-weight chickens and found that there were significant differences. The CC genotype was the dominant genotype for high weight, and the TT genotype was the dominant genotype for low weight. Therefore, chickens with CC genotype at this site can be preferred, and it is expected to carry out early selection of high-weight chickens, thereby accelerating the genetic breeding of chickens.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a SNP molecular marker associated with chicken weight and an application thereof. Background Art

[0002] my country's chicken production has maintained rapid growth in recent years, and increasing production and improving quality have become key directions in the breeding field. In particular, the weight of chickens per week is a core trait. By selecting fast-growing and heavy-weight chickens, the production efficiency of the group can be significantly improved. With the advancement of genomic research and the development of genetic marker technology, breeding scientists can select genotypes with excellent traits for breeding, thereby promoting further improvement in chicken production and quality.

[0003] SNP (single nucleotide polymorphism) is an important form of genetic variation, which is characterized by abundant quantity, wide distribution and high stability. It is widely used in molecular breeding and genetic research. However, in the molecular breeding practice of broiler chickens, markers that can clearly define functions and significantly affect traits are still scarce. Therefore, in-depth exploration of molecular markers with strong effects and high applicability has become a current research hotspot. In particular, if the key SNPs associated with the target traits can be accurately located and the molecular mechanisms behind them can be elucidated, it will provide new ideas for the genetic improvement of chickens and promote major breakthroughs in the field of poultry breeding. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a SNP molecular marker related to chicken weight and its application.

[0005] The technical solution of the present invention is: a method for breeding chickens with high weight traits, extracting genomic DNA from chicken samples, detecting the genotype at position 170,405,727 of chromosome 1 of the chicken samples, and selecting individuals with a genotype of CC at the site as having a higher weight trait than individuals with a genotype of TT, and the reference genome version is GRCg6a.

[0006] The invention discloses an application of a material for detecting SNP site polymorphism or genotype in auxiliary breeding of chicken high body weight traits, wherein the SNP site is located at position 170,405,727 of chicken chromosome 1 and has T / C polymorphism.

[0007] Furthermore, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

[0008] The invention discloses an application of a substance for detecting polymorphism or genotype of a SNP site in preparing a chicken high body weight trait auxiliary breeding kit, wherein the SNP site is located at the 395th position of the nucleotide sequence shown in SEQ ID No.3.

[0009] Furthermore, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

[0010] A kit comprises a primer pair as shown in SEQ ID No.1 and SEQ ID No.2.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] The present invention discovered a SNP site chrI:170405727 that is significantly correlated with 6 weeks of age and 8 weeks of age, and C at this site is a dominant allele in high-weight chickens. The SMR method was used to integrate GWAS and eQTL, and it was found that the SNP site distally regulates the ESD gene. There are three genotypes at this site, among which the ESD gene of the CC genotype is more highly expressed in muscle tissue. For this site, SNP frequency analysis was performed in high-weight and low-weight chickens and found that there were significant differences. The CC genotype is the dominant genotype for high weight, and the TT genotype is the dominant genotype for low weight. Therefore, chickens with the CC genotype at this site can be preferred, and it is expected to carry out early selection of high-weight chickens, thereby accelerating the genetic breeding of chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Association between chromosome 1 SNP and chicken weight at 6 weeks of age;

[0014] Figure 2 Association between chromosome 1 SNP and chicken weight at 8 weeks of age;

[0015] Figure 3 The expression of ESD with different SNP genotypes in muscle tissue. DETAILED DESCRIPTION

[0016] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0017] Example 1 Discovery of SNP Molecular Markers

[0018] The resequencing technology was used to sequence 1,164 individuals in the hybrid chicken population, and the identified SNPs were quality-controlled and filtered. After filtering, the remaining 1,557,163 SNPs were subjected to GWAS, from which a SNP locus significantly associated with the 6-week-old and 8-week-old weight of chickens was obtained ( Figure 1 and Figure 2). The SNP is located at position 170,405,727 of chromosome 1 in the genomic version GRCg6a (SNP name is rs314360835), and its additive effect and significant P value are shown in Table 1. C is the dominant allele in high-weight chickens.

[0019] Table 1 Additive effects and significant P values

[0020]

[0021] Furthermore, based on the eQTL analysis of 28 tissues in ChickenGTEx, it was found that the expression of the ESD gene was regulated distally at the rs314360835 locus in muscle tissue. The expression level of the ESD gene in muscle tissue with the CC genotype of the rs314360835 locus was significantly higher than that with the TT genotype, with a P value of 6.26×10 -5 ( Figure 3 ).

[0022] The above results indicate that this SNP site can be used as a molecular marker for the breeding of high-weight chickens. Early breeding of CC individuals has great economic value for increasing the weight of chickens.

[0023] Example 2 Validation of SNP Molecular Markers

[0024] 1. Experimental Materials

[0025] Low-weight chicken breeds: Daweishan small chicken (n=7), Jiangxi silk-feather chicken (n=20), Tibetan chicken (n=1), Tibetan chicken (Aba, n=3), Tibetan chicken (Haiyan, n=6), Tibetan chicken (Lhasa, n=25), Tibetan chicken (Shigatse, n=32), Tibetan chicken (Shannan, n=14).

[0026] High-weight chicken breeds: Luxi fighting chicken (n=8), Nanjiang fighting chicken (n=8), Cornish chicken (n=1), Langshan chicken (n=10), White Plymouth chicken (n=1), Guangxi chicken (n=5), Miyi chicken (n=5), Yuanbao chicken (n=11).

[0027] 2. Test methods

[0028] The genotype file of 928 chickens was downloaded from Galbase (http: / / animal.omics.pro / code / index.php / ChickenVar): GRCg6a.928.SNP.vcf.gz, and the genotypes of rs314360835 in 49 high-weight chicken breeds and 108 low-weight chicken breeds were extracted using a self-written script. The genotype distribution and frequency of allele C in each chicken breed were statistically analyzed, and the specific information is shown in Table 2.

[0029] Table 2 Genotype distribution and frequency of allele C in various chicken breeds

[0030]

[0031] 3. Results Analysis

[0032] The frequency of allele C at rs314360835 locus (chr1:170405727) was significantly different between high-weight chickens and low-weight chickens. The frequency of allele C in high-weight chickens was 4.54 times that of low-weight chickens, with a P value of 0.00089. Therefore, the C genotype is the dominant allele for high weight. The proportion of CC genotype in the high-weight group was 59.18%, which was dominant; the TT genotype was dominant in the low-weight group, with a proportion of 69.44%.

[0033] Thus, by comparing the genotypes of high-weight and low-weight chicken groups, a SNP molecular marker related to chicken weight was obtained. By selecting individuals with the CC allele at this site, the weight of the breeding population can be increased.

[0034] Example 3 Detection of SNP Molecular Markers

[0035] (1) Based on the upstream and downstream sequence information of the SNP molecular marker, primers were designed to amplify the fragment containing the SNP site; forward primer F: TCCCTTCATTCTTTCTTAGCC (SEQ ID No. 1)

[0036] Reverse primer R: CCAGACAGCCTCCGAACA (SEQ ID No. 2)

[0037] (2) Extracting genomic DNA from the chicken sample to be tested as a template, performing PCR amplification using the primer pair designed in (1) to obtain an amplified product of 800 bp in size containing the SNP site, the sequence of which is shown in SEQ ID No. 3. The SNP site is located at position 395 of the sequence shown in SEQ ID No. 3.

[0038] (3) The amplified product is subjected to Sanger sequencing to obtain the genotype of the SNP site.

Claims

1. A method for breeding high-weight chickens, characterized in that: The genomic DNA of the chicken samples was extracted, and the genotype of position 170,405,727 of chromosome 1 of the chicken samples was tested. The individuals with the genotype CC at this position were selected to have a higher weight trait than the individuals with the genotype TT. The reference genome version was GRCg6a.

2. Application of materials for detecting SNP site polymorphism or genotype in assisting breeding of high weight traits in chickens. The SNP site is located at position 170,405,727 of chromosome 1 of chicken and has T / C polymorphism. Individuals with a genotype of CC at this position have a higher weight trait than individuals with a genotype of TT. The reference genome version is GRCg6a.

3. The use according to claim 2, characterized in that: The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.

2.

4. Use of a substance for detecting SNP site polymorphism or genotype in the preparation of a chicken high weight trait assisted breeding kit, wherein the SNP site is located at the 395th position of the nucleotide sequence shown in SEQ ID No. 3, has a T / C polymorphism, and individuals with a genotype of CC at this position have a higher weight trait than individuals with a genotype of TT.

5. The use according to claim 4, characterized in that The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

Images