A caps molecular marker closely linked to eggplant branch angle and application thereof

Abstract

The application belongs to the technical field of molecular markers, and discloses a CAPS molecular marker closely linked to eggplant branch angle and application thereof. The application firstly analyzes whole genome polymorphic sites of compact-branching eggplants and loose-branching eggplants through a second-generation sequencing technology, screens a target interval of the trait, obtains a snp molecular marker closely linked to the eggplant branch angle, and screens a CAPS molecular marker primer through the marker. The CAPS molecular marker closely linked to the eggplant branch angle in the application is convenient and fast to detect, the result is stable, and is not affected by the environment. Through PCR amplification, enzyme cutting and electrophoresis detection and analysis, early selection and breeding of compact-branching eggplants can be realized, and the plant type breeding process of eggplants is greatly promoted.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a CAPS molecular marker closely linked to the branch angle of eggplant and an application thereof. Background Art

[0002] Eggplant, a herbaceous crop of the Solanaceae family, originates in Africa and is now widely cultivated in Asia, Africa, Europe, and the Near East. The United Nations Food and Agriculture Organization (FAO) ranks eggplant as the fourth largest vegetable crop worldwide. my country is a major producer of eggplant, with over 12 million mu (approximately 1.5 million hectares) of sown area. Eggplant varieties and cultivation methods are diverse, making it a key vegetable for both southern and northern vegetable transport. The growing demand for eggplant cultivation, coupled with the decreasing arable land area and the structural shortage of labor, has become increasingly prominent, severely impacting the sustainable development of agriculture. An ideal plant shape with a moderate height and compact size, particularly in protected eggplant cultivation, offers advantages such as early maturity, enhanced lodging resistance, and labor-saving cultivation, making it crucial for improving the profitability of eggplant cultivation. Therefore, branch angle plays a key role in shaping this ideal plant shape. Compact eggplants facilitate double-vine pruning and hanging vine pruning, making them suitable for simplified cultivation. Currently, research on branch angle in Solanaceous vegetables is largely unreported.

[0003] With the development of modern molecular biology technology, a gene fragment detection method based on DNA molecular marker technology has emerged, which has the characteristics of being simple, rapid and accurate. Commonly used molecular marker technologies include marker technologies such as AFLP, SCAR, inDel, SSR and SNP. The present invention provides a pair of primers, CAPS primers, developed based on SNP sites. The experimental operation is simple, only the most basic molecular experimental supporting instruments and conditions are required, and no toxic polyacrylamide gel electrophoresis is required. The detection results are accurate and efficient, and can identify the early branch angle traits of eggplant, which is beneficial to the improvement of eggplant plant type. So far, there has been no report on the use of SNP markers to identify the branch angle traits of eggplant. Summary of the Invention

[0004] The present invention aims to provide an application of a reagent for detecting bases 81394594 of eggplant E08 chromosome in eggplant branch angle screening and breeding.

[0005] Another object of the present invention is to provide a primer for detecting base 81394594 of eggplant E08 chromosome in eggplant branch angle screening and breeding.

[0006] The last object of the present invention is to provide a method for screening and breeding eggplant branches.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] Acquisition of CAPS molecular markers tightly linked to branch angle in eggplant:

[0009] The applicant used the natural population screening method to obtain two pure line materials with extremely significant branching angle traits. Through genetic population, BSA (Bulked Segregant Analysis) and SNP site analysis, an SNP molecular marker closely linked to the branching angle of eggplant was obtained. This molecular marker is located at base 81394594 of the eggplant E08 chromosome and is an A / G mutation.

[0010] For the above SNP molecular markers, after enzyme site conversion and identification, a CAPS molecular marker closely linked to the branch angle was obtained. The primers for this molecular marker are:

[0011] F: GAAAATAAGGCGCATTTGGA and R: CCGCTTCTCTCTTCTCCT.

[0012] The protection scope of the present invention includes:

[0013] Application of a reagent for detecting bases 81,394,594 on chromosome E08 of eggplant in eggplant branch angle screening and breeding.

[0014] The reagents described above are preferably primers.

[0015] The primers mentioned above, preferably the CAPS detection primers provided by the present invention, are F: GAAAATAAGGCGCATTTGGA and R: CCGCTTCTCTCTTTCTCCCT.

[0016] A method for screening and breeding eggplant by branching angle comprises detecting bases 81,394,594 of eggplant E08 chromosome using conventional protocols in the art, wherein the conventional protocols include but are not limited to sequencing, TaqMan probe method, ARMS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, gene chip method, and mass spectrometry.

[0017] The version number of the eggplant genome used in the present invention is S. melongena HQ-1315 genome.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0019] This study provides the first CAPS molecular marker tightly linked to eggplant branching angle and develops primers for detecting this marker. This allows for early and rapid selection of eggplant varieties for the compact branching trait, significantly advancing eggplant plant type breeding. It will also help create new eggplant germplasm with compact branches suitable for simplified cultivation and ideal plant types.

[0020] The molecular marker closely linked to the branching angle of eggplant of the present invention has universal applicability and is applicable to various currently available eggplant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 They are the eggplant pure line compact-branched material "PnP05" and the loose-branched material "GnP05" in Example 1.

[0022] Figure 2 The results of molecular marker screening for 22 eggplant samples in Example 2 are shown. DETAILED DESCRIPTION

[0023] To better understand the technical content of the present invention, the following specific examples are provided to further illustrate the present invention. The experimental methods used in the examples of the present invention are conventional methods unless otherwise specified. The materials and reagents used in the examples of the present invention are commercially available unless otherwise specified. The eggplant genome of the present invention is based on the genome version number S. melongena HQ-1315 genome.

[0024] Example 1:

[0025] Determination of CAPS molecular markers tightly linked to branch angle in eggplant

[0026] 1) Construction of eggplant branch angle genetic population and BSA pooling

[0027] To study the branch angle phenotype of eggplant, the stable inheritance compact branching parent material PnP05 (purple calyx stick eggplant) and the stable inheritance loose branching material GnP05 (green calyx stick eggplant) were used as control parents (Chen X, Zhang M, Tan J, Huang S, Wang C, Zhang H, et al. (2017) Comparative transcriptome analysis provides insights into molecular mechanisms for parthenocarpic fruit development in eggplant (Solanum melongena L.). PLoS ONE 12 (6): e0179491.) to determine their genetic characteristics ( Figure 1). Phenotypic analysis showed that the angle between the first branch of PnP05 and the main stem was 30° to 40°, the branch angle of GnP05 was 80° to 90°, and the branch angle of its offspring F1 was between that of the parents, ranging from 50° to 70°. A total of 280 F2 plants were obtained after self-pollination of the F1 generation. The main branch angles of the F2 population were statistically analyzed. The maximum average size of the main branch angle of the F2 population was 85.56, the minimum was 28.32, and the average was 57.31 degrees. The absolute values ​​of the kurtosis and skewness were 2.34 and 1.28, respectively, both less than 3, which was consistent with the normal distribution, indicating that major effect genes are involved in controlling the fruit branch angle traits. This shows that the main fruit branch angle of the F2 population showed a unimodal continuous distribution without an obvious proportional relationship, showing the genetic characteristics of quantitative traits.

[0028] BSA pools: Two extreme phenotypic lines were selected from the F2 population. Pools of 30 plants, BraPnP05 (compact) and BraGnP05 (loose), were prepared. DNA was extracted from 10 individual samples of each parent, the compact branching parent, PnP05, and the loose branching parent, GnP05. DNA from each line was mixed in equal amounts based on phenotype to create four pools representing the four extreme phenotypes. The eggplant genome (S. melongena HQ-1315 genome) was used as the reference genome (https: / / solgenomics.net / organism / Solanum_melongena / genome), and 30× BSA analysis was performed on each of the four pools.

[0029] 2) High-throughput sequencing to identify regions associated with branch angle traits in eggplant

[0030] (1) High-throughput sequencing: The total clean data obtained from sequencing was 140.50G bp, with a Q30 of 95.45 and a GC content of 36.31%. The average alignment efficiency between the sample and the reference genome was 99.22%, the average coverage depth was 29.25X, and the genome coverage was 90.61%.

[0031] (2) Detection of variant sites: Clean reads were aligned to the reference genome, and GATK software was used to detect variant sites in four samples (PnP05, Gn P05, BraPnP05, and BraGnP05), mainly including SNPs and InDels. ANNOVAR software was then used to annotate the location information and types of the SNPs and inDel sites detected in the four samples.

[0032] (3) Target trait region initial positioning: First, filter the SNPs and InDels before association analysis, the filtering criteria are as follows: first, filter out SNPs and InDel sites with multiple genotypes, second, filter out SNPs and InDel sites with read support less than 4, third, filter out SNPs and InDel sites with consistent genotypes between pools and SNPs and InDel sites with recessive pool genes not from recessive parents, and finally obtain high-quality reliable SNPs and InDel sites. Then, through the QTL-seq method, the significant difference between SNP-index and ED (Euclidean Distance) of two pool samples, the target trait is associated with the related region of the genome.

[0033] (4) Determination of target trait associated region: The latest reference genome of eggplant is used for analysis, SNP molecular markers and Indel molecular markers are used to calculate the candidate interval, and then two molecular markers are used for joint analysis to determine the target trait associated region as a 2.64 Mb region on chromosome 8.

[0034] 3) Design and synthesis of polymorphic primers

[0035] According to the target trait associated region obtained by high-throughput sequencing, the intersection of the SNP and InDel associated regions is taken, and a total of 1 candidate region related to the trait is obtained. The associated region contains a total of 206 genes, of which 28 are non-synonymous mutation genes, containing 68 non-synonymous sites; 5 frameshift mutation genes. According to the sequence information of the 73 markers obtained by association analysis and the SNP site, based on the SNP with a restriction site, 85 CAPS markers containing a restriction site are designed. The parental DNA is amplified by PCR, and the amplified product is digested with 3% agarose gel to detect the band size. The polymorphic molecular markers are screened, and the primer sequences are synthesized by Beijing Aoke Ding Sheng Biological Technology Co., Ltd. (Wuhan).

[0036] 4) Screening and detection method of CAPS molecular marker primer

[0037] (1) Randomly select 10 strains of DNA from each parent for equal mixing as a template for screening primers. After dissolving the primers, the parental DNA is amplified by PCR. The reaction system is: DNA 1 μL, 2 × Taq enzyme mix 6 μL, 5 μM upstream primer 1 μL, 5 μM downstream primer 1 μL, add water to 12 μL.

[0038] (2) The PCR amplification program is: 94℃ pre-denaturation for 3 min; amplification cycle: 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ for 30 sec, 32 cycles; finally 72℃ extension for 5 min; finally 4℃ storage.

[0039] (3) The enzyme digestion reaction system and conditions were as follows: 2.5 μL 2×NEB Cutsmart buffer, 0.5 μL PstI restriction enzyme, and 15 μL ddH2O2 sterile water were directly added to the PCR reaction system and incubated in a 37°C incubator for 3 h.

[0040] (4) After enzyme digestion, the amplified product was detected on 3% agarose gel, the gel was imaged on a gel imager, and photographed and preserved.

[0041] (5) Primer polymorphism identification: First, using DNA from the parents PnP05 and GnP05 as templates, PCR amplification was performed. All 13 primer pairs synthesized were able to amplify bands. Electrophoresis was then performed, and it was found that the enzyme digestion products of the amplified fragments of two primer pairs showed polymorphism.

[0042] (5) Determination of tightly linked molecular markers for eggplant branching angle: Using the compactly branched eggplant PnP05 and the loosely branched eggplant GNP05 as materials, the two pairs of CAPS primers showing polymorphisms were further verified to determine whether the amplified products were related to the branching traits of eggplant.

[0043] Finally, it was found that the product of the amplified fragment of primer BraPstI_27 after digestion with PstI restriction enzyme was polymorphic, indicating that the primer had a good linkage with the branching angle of eggplant.

[0044] After amplification and restriction digestion of the branched and compact eggplant PnP05, a characteristic band of 267 bp was obtained, which is shown in SEQ ID NO.1;

[0045] After amplification and restriction digestion of the loosely branched eggplant GnP05, a 238 bp characteristic band was obtained, which is shown in SEQ ID NO. 2;

[0046] If two heterozygous bands of 267bp and 238bp appear, the branching angle of the material will generally be an intermediate type between the two parents.

[0047] The sequences of primer BraPstI_27 are F:GAAAATAAGGCGCATTTGGA and R:CCGCTTCTCTCTTTCTCCCT, and the amplified sequence in loosely branched eggplant GnP05 is:GAAAATAAGGCGCATTTGGATGAAAGTTCCGATGGCTGAGCTGGCCGTCCTGTTGATAGTAGAAGAGCGAAAATATGCCATGCTTTATGCACTTCAGAAATGGCGATGGAGGAGTCGGAGTCGGAGAATGAGGATAGTTGAATAAATTGGTGAATTTGAGTTCCATTGATTTTCAGATCTGAAAATACATATGGATTTTGCTTGTAGAGAAATGAGAGGAAGTGAAAAAGGAA CTGCAG AGATATGAAGGGAGAAAGAGAGAAGCGG.

[0048] The lower line indicates the PstI restriction site. The sequence amplified from the compactly branched eggplant is CTACAG, which is resistant to enzyme cleavage and produces a 267-bp band. In contrast, the sequence amplified from the loosely branched eggplant is CTGCAG, which is resistant to enzyme cleavage and produces a 238-bp band. Therefore, BraPstI_27 was ultimately identified as a molecular marker associated with the branch angle trait in eggplant.

[0049] Example 2:

[0050] Universality of CAPS molecular markers tightly linked to eggplant branch angle in identifying compact branching in eggplant:

[0051] A total of 22 eggplant materials of different eggplants and different branching types were selected. These materials were variety resources collected by the applicant from different regions of China. These materials have different local origins from the parent materials in the present invention. These materials can be used as test materials to test whether the primers have universal applicability.

[0052] The CAPS molecular marker of the present invention was verified by extracting genomic DNA from the eggplant leaves using the CTAB method. The primers corresponding to the BraPstI_27 molecular marker were used for PCR amplification and PstI digestion, and the fragment size was identified by 3% agarose gel electrophoresis. The results are shown in Figure 2 As shown in Table 1, the results showed that the accuracy of BraPstI_27 molecular marker in detecting branch angles reached 91%.

[0053] Table 1 Eggplant materials with different numbers of flowers and fruits

[0054]

[0055]

[0056] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of a reagent for detecting a polymorphism at base 236 of the sequence shown in SEQ ID NO. 1 in eggplant branch angle screening and breeding, wherein the polymorphism is an A / G mutation.

2. The use according to claim 1, wherein the reagent is a primer.

3. The use according to claim 2, wherein the primers are: F: GAAAATAAGGCGCATTTGGA and R: CCGCTTCTCTCTTTCTCCCT.

4. A method for screening and breeding eggplant by branch angle, comprising detecting a polymorphism at base 236 of SEQ ID NO. 1, wherein the polymorphism is an A / G mutation, and the detection method comprises: Sequencing method, TaqMan probe method, ARMS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, gene chip method, and mass spectrometry.

Images