Improved enzymatic modification of phospholipids in food products

Abstract

Presented are phospholipase A1 characterized by having a sn1 / sn2 specificity ratio of about 55 / 45 or higher wherein the phospholipase A1 has a lysophospholipase / phospholipase activity ratio of less than 0.01, as well as methods for use in lipid-containing food matrices, methods of baking and making dough using the phospholipase, and also including baking modifiers made using the disclosed phospholipase A1.

Description

Technical Field

[0001] The present invention relates to phospholipases and their use in the manufacture of food products. The present invention further relates to methods for making dough and baked products using phospholipases.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 63 / 368,530, filed on July 15, 2022, which is hereby incorporated by reference in its entirety.

[0004] References to sequence listings

[0005] The electronically submitted content of the text file sequence listing named "NB42091WOPCT_SequenceListing.xml" was created on July 15, 2022 and is 151KB in size, which sequence listing is hereby incorporated by reference in its entirety. Background Art

[0006] The use of lipase in bread dough is well known. For example, in EP 0585988, it was shown that the addition of lipase to dough provides an anti-staling effect. WO 94 / 04035 teaches that improved softness can be obtained by adding lipase to dough. It has also been shown that exogenous lipase can change bread volume.

[0007] Although the positive properties of lipases (including phospholipases) in the preparation of dough and baked products have been described, the lipases of the prior art sometimes have multiple activities that conflict with each other. Therefore, today, there is still a need for improved lipases with more specific activities in some food applications (especially in baking).

[0008] Microorganisms (such as filamentous fungi) are widely used as hosts for producing heterologous proteins (including lipases). However, microorganisms always express endogenous proteases. For heterologous proteins that are susceptible to enzymatic proteolysis, endogenous proteases may degrade the heterologous protein. Depending on the sensitivity of the heterologous protein to proteolysis, there are strain methods to minimize the degradation of the heterologous protein.

[0009] Heterologous proteins can be purified from endogenous proteases, for example, by chromatography. However, proteolysis may occur so rapidly that a significant amount of the heterologous protein is degraded before chromatography can be performed.

[0010] The host can also be genetically engineered to eliminate one or more proteases, thereby reducing or eliminating proteolysis of heterologous proteins. However, typical hosts such as Trichoderma have many endogenous proteases, and reducing proteolysis requires understanding which protease or proteases are responsible for degrading a particular heterologous protein. In addition, there are limitations on how many genes can be deleted and still maintain healthy host cells.

[0011] There is a continuing need for techniques that overcome problems with host cell proteolysis. Ideally, these improved techniques will produce higher yields of protein.

[0012] The subject matter disclosed herein addresses these needs and provides additional benefits. Summary of the invention

[0013] According to one aspect of the present invention, an isolated polypeptide having phospholipase A1 activity is presented, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0014] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0015] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0016] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0017] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0018] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0019] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0020] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0021] In another aspect of the present invention, a method for making dough is presented, the method comprising mixing dough ingredients selected from the group consisting of flour, salt, water, sugar, fat, lecithin, oil emulsifier and yeast with an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0022] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0023] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0024] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0025] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0026] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0027] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0028] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0029] Optionally, the method of making the dough has the further step of adding at least one additional enzyme useful for improving the dough and / or the baked product made from the dough.

[0030] Optionally, the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

[0031] Optionally, the amylase is an exoamylase.

[0032] Optionally, the exoamylase is a maltogenic amylase.

[0033] Optionally, the exoamylase is a non-maltogenic amylase.Optionally, the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides from the non-reducing ends of the amylopectin side chains, the one or more linear maltooligosaccharides comprising mainly four to eight D-glucopyranosyl units.

[0034] Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity.

[0035] Optionally, the phospholipase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:17 and / or SEQ ID NO:18.

[0036] Optionally, the amylase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO:123.

[0037] Optionally, the xylanase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:118.

[0038] Optionally, the glucose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:117.

[0039] Optionally, the hexose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:116.

[0040] In another aspect of the invention, a dough is presented, the dough containing an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0041] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0042] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0043] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0044] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0045] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0046] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0047] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0048] Optionally, the dough has improved dough extensibility and / or stability.

[0049] In another aspect of the invention, the dough has at least one additional enzyme useful for improving the dough and / or baked products made from the dough.

[0050] Optionally, the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

[0051] Optionally, the amylase is an exoamylase.

[0052] Optionally, the exoamylase is a maltogenic amylase.

[0053] Optionally, the exoamylase is a non-maltogenic amylase.Optionally, the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides from the non-reducing ends of the amylopectin side chains, the one or more linear maltooligosaccharides comprising mainly four to eight D-glucopyranosyl units.

[0054] Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity. Optionally, the phospholipase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.

[0055] Optionally, the amylase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO:123.

[0056] Optionally, the xylanase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:118.

[0057] Optionally, the glucose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:117.

[0058] Optionally, the hexose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:116.

[0059] In another aspect of the present invention, a method for preparing a baked product is presented, the method comprising baking the dough as described above.

[0060] In another aspect of the invention, a baked product obtainable by the method as described above is presented. Preferably, the baked product has at least one improved property selected from the group consisting of: improved crumb pore size, improved uniformity of gas bubbles, no separation between crust and crumb, increased volume, increased crust crispness and improved baked elasticity.

[0061] Optionally, the improved property is crust crispness.

[0062] In another aspect of the invention, a premix for baking is presented, the premix for baking having flour and an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

[0063] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0064] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0065] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0066] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0067] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0068] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0069] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0070] Optionally, the premix has at least one additional enzyme useful for improving the dough and / or the baked product made from the dough.

[0071] Optionally, the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

[0072] Optionally, the amylase is an exoamylase.

[0073] Optionally, the exoamylase is a maltogenic amylase.

[0074] Optionally, the exoamylase is a non-maltogenic amylase.Optionally, the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides from the non-reducing ends of the amylopectin side chains, the one or more linear maltooligosaccharides comprising mainly four to eight D-glucopyranosyl units.

[0075] Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity. Optionally, the phospholipase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.

[0076] Optionally, the amylase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO:123.

[0077] Optionally, the xylanase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:118.

[0078] Optionally, the glucose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:117.

[0079] Optionally, the hexose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:116.

[0080] In another aspect of the present invention, a baking improver is provided, which has granules or agglomerated powder and an isolated polypeptide having phospholipase A1 activity, wherein the isolated polypeptide has a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

[0081] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0082] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0083] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0084] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0085] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0086] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0087] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0088] Optionally, the baking improver has at least one additional enzyme useful for improving the dough and / or baked products made from the dough.

[0089] Optionally, the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

[0090] Optionally, the amylase is an exoamylase.

[0091] Optionally, the exoamylase is a maltogenic amylase.

[0092] Optionally, the exoamylase is a non-maltogenic amylase.Optionally, the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides from the non-reducing ends of the amylopectin side chains, the one or more linear maltooligosaccharides comprising mainly four to eight D-glucopyranosyl units.

[0093] Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity. Optionally, the phospholipase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.

[0094] Optionally, the amylase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO:123.

[0095] Optionally, the xylanase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:118.

[0096] Optionally, the glucose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:117.

[0097] Optionally, the hexose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:116.

[0098] In another aspect of the invention, an isolated polynucleotide is presented having a nucleic acid sequence encoding an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0099] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0100] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0101] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0102] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0103] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0104] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0105] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0106] In another aspect of the present invention, a recombinant expression vector having the polynucleotide as described above is presented.

[0107] In another aspect of the present invention, a host cell having the recombinant expression vector as described above is presented.

[0108] In another aspect of the invention, a method for modifying a phospholipid emulsifier is presented, the method having the step of treating the emulsifier with an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0109] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0110] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0111] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0112] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0113] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0114] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0115] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0116] Optionally, the phospholipid emulsifier is lecithin or lysolecithin.

[0117] In another aspect of the invention, a method for producing lysophospholipids in a lipid-containing food matrix is ​​presented, the method having the step of adding to the lipid-containing food matrix an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0118] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0119] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0120] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0121] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0122] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0123] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0124] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0125] Optionally, the lipid-containing food matrix is ​​selected from the group consisting of eggs and egg-containing food products, dough for baked desserts, processed meats, milk-based products, and vegetable oils.

[0126] In another aspect of the invention, a recombinant cell having a) a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide; and b) a heterologously expressed protein is presented.

[0127] Optionally, the heterologously expressed protein is an aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α-galactosidase, β-galactosidase, glucose oxidase (GOX), α-glucosidase, β-glucosidase, glucuronidase, glycosyl transferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase.

[0128] Optionally, the heterologously expressed protein is a phospholipase.

[0129] Optionally, the phospholipase is an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0130] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0131] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0132] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0133] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0134] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0135] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0136] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0137] Optionally, the recombinant cell is a bacterial, fungal, yeast, plant, or mammalian cell.

[0138] Optionally, the recombinant cell is of the genus Trichoderma, Aspergillus, Bacillus, or Myceliophthera.

[0139] Optionally, the recombinant cell is Trichoderma reesei.

[0140] In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

[0141] In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila, or Bacillus licheniformis.

[0142] Optionally, the BASI polypeptide is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:58.

[0143] In another aspect of the present invention, a fermentation broth having the recombinant cell as described above is presented.

[0144] In another aspect of the invention, a method for reducing proteolysis of a heterologously expressed protein is presented, the method having the step of culturing a recombinant cell comprising a) the BASI polypeptide; and b) the heterologously expressed protein under conditions suitable for producing the heterologously expressed protein and a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide.

[0145] Optionally, the method comprises the step of isolating the heterologous protein.

[0146] Optionally, the heterologously expressed protein is an aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α-galactosidase, β-galactosidase, glucose oxidase (GOX), α-glucosidase, β-glucosidase, glucuronidase, glycosyl transferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase.

[0147] Optionally, the heterologously expressed protein is a phospholipase.

[0148] Optionally, the phospholipase is an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0149] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0150] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0151] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0152] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0153] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0154] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0155] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0156] Optionally, the recombinant cell is a bacterial, fungal, yeast, plant, or mammalian cell.

[0157] Optionally, the recombinant cell is of the genus Trichoderma, Aspergillus, Bacillus, or Myceliophthera.

[0158] Optionally, the recombinant cell is Trichoderma reesei.

[0159] Optionally, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

[0160] Optionally, the recombinant cell is Bacillus subtilis, Myceliophthora thermophila, or Bacillus licheniformis.

[0161] Optionally, the BASI polypeptide is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:58.

[0162] In another aspect of the invention, a method for reducing proteolysis of a recombinantly expressed protein is presented, the method having the step of isolating the recombinantly expressed protein in the presence of an exogenously added barley alpha-amylase subtilisin inhibitor (BASI) polypeptide.

[0163] Optionally, the method comprises the step of isolating the heterologous protein.

[0164] Optionally, the heterologously expressed protein is an aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α-galactosidase, β-galactosidase, glucose oxidase (GOX), α-glucosidase, β-glucosidase, glucuronidase, glycosyl transferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase.

[0165] Optionally, the heterologously expressed protein is a phospholipase.

[0166] Optionally, the phospholipase is an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0167] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0168] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0169] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0170] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0171] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0172] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0173] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity to SEQ ID NO:27.

[0174] Optionally, the recombinant cell is a bacterial, fungal, yeast, plant, or mammalian cell.

[0175] Optionally, the recombinant cell is of the genus Trichoderma, Aspergillus, Bacillus, or Myceliophthera.

[0176] Optionally, the recombinant cell is Trichoderma reesei.

[0177] Optionally, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

[0178] Optionally, the recombinant cell is Bacillus subtilis, Myceliophthora thermophila, or Bacillus licheniformis.

[0179] Optionally, the BASI polypeptide is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:58.

[0180] Biological sequence description

[0181] SEQ ID NO: 1—shows the full length amino acid sequence of the CRC08310 phospholipase variant from Trichoderma harzianum.

[0182] SEQ ID NO:2—Lists the proprotein sequence of the CRC08310 phospholipase variant from Trichoderma harzianum.

[0183] SEQ ID NO: 3—shows the full length amino acid sequence of the CRC08316 phospholipase variant from Pestalotiopsis fici.

[0184] SEQ ID NO:4—shows the protein amino acid sequence of the CRC08316 phospholipase variant from Pseudomonas syringae.

[0185] SEQ ID NO: 5—shows the full length amino acid sequence of the CRC08319 phospholipase variant from Metarhizium guizhouense (also known as Metarhizium anisopliae).

[0186] SEQ ID NO:6—lists the protein native amino acid sequence of the CRC08319 phospholipase variant from Metarhizium anisopliae (also known as Metarhizium muscardineum).

[0187] SEQ ID NO: 7—shows the full length amino acid sequence of the CRC08405 phospholipase variant from Diaporthe ampelina.

[0188] SEQ ID NO: 8—shows the protein amino acid sequence of the CRC08405 phospholipase variant from Vitis vinifera.

[0189] SEQ ID NO:9—shows the full length amino acid sequence of the CRC08418 phospholipase variant from Magnaporthe oryzae.

[0190] SEQ ID NO: 10—shows the original protein amino acid sequence of the CRC08418 phospholipase variant from Magnaporthe oryzae.

[0191] SEQ ID NO: 11—shows the full length amino acid sequence of the CRC08826 phospholipase variant from Neonectria ditissima.

[0192] SEQ ID NO: 12 sets forth the protein original amino acid sequence of the CRC08826 phospholipase variant from Neophycoerythrocol rubrum.

[0193] SEQ ID NO: 13—shows the full length amino acid sequence of the CRC08833 phospholipase variant from Trichoderma gamsii.

[0194] SEQ ID NO: 14—shows the original protein amino acid sequence of the CRC08833 phospholipase variant from Trichoderma gemsii.

[0195] SEQ ID NO: 15:—shows the full length amino acid sequence of the CRC08845 phospholipase variant from Metarhizium anisopliae.

[0196] SEQ ID NO: 16 sets forth the original amino acid sequence of the protein of the CRC08845 phospholipase variant from Metarhizium anisopliae.

[0197] SEQ ID NO: 17—shows the amino acid sequence of phospholipase A1 used in the commercial product Powerbake 4080.

[0198] SEQ ID NO: 18—shows the amino acid sequence of phospholipase A1 used in the commercial product Lipopan F.

[0199] SEQ ID NO: 19—The codon-optimized synthetic nucleic acid sequence of full-length CRC08310 is shown.

[0200] SEQ ID NO:20—The codon-optimized synthetic nucleic acid sequence of full-length CRC08316 is shown.

[0201] SEQ ID NO:21—The codon-optimized synthetic nucleic acid sequence of full-length CRC08319 is shown.

[0202] SEQ ID NO:22—The codon-optimized synthetic nucleic acid sequence of full-length CRC08405 is shown.

[0203] SEQ ID NO:23—The codon-optimized synthetic nucleic acid sequence of full-length CRC08418 is shown.

[0204] SEQ ID NO:24—The codon-optimized synthetic nucleic acid sequence of full-length CRC08826 is shown.

[0205] SEQ ID NO:25—The codon-optimized synthetic nucleic acid sequence of full-length CRC08833 is shown.

[0206] SEQ ID NO:26—The codon-optimized synthetic nucleic acid sequence of full-length CRC08845 is shown.

[0207] SEQ ID NO:27—shows CRC08319 mature Q28-K147.

[0208] SEQ ID NO:28—CRC08319 mature Q28-T146 is shown.

[0209] SEQ ID NO:29—shows CRC08319 mature Q28-T140.

[0210] SEQ ID NO:30—shows CRC08310 mature Q28-K150.

[0211] SEQ ID NO:31—shows CRC08310 mature Q28-G149.

[0212] SEQ ID NO:32—CRC08316 mature Q26-R150 is shown.

[0213] SEQ ID NO:33—CRC08316 mature Q26-K149 is shown.

[0214] SEQ ID NO:34—CRC08405 mature Q28-K147 is shown.

[0215] SEQ ID NO:35—CRC08405 mature Q28-T146 is shown.

[0216] SEQ ID NO:36—shows CRC08418 mature Q34-G150.

[0217] SEQ ID NO:37—shows CRC08418 mature Q34-G157.

[0218] SEQ ID NO:38—shown is CRC08826 mature A30-K152.

[0219] SEQ ID NO:39—CRC08826 mature A30-D146 is shown.

[0220] SEQ ID NO:40—shows CRC08826 mature A30-K151.

[0221] SEQ ID NO:41—shows CRC08833 mature Q28-R150.

[0222] SEQ ID NO:42—shows CRC08833 mature Q28-Q124.

[0223] SEQ ID NO:43—shows CRC08833 mature Q28-F141.

[0224] SEQ ID NO:44—shows CRC08833 mature Q28-D145.

[0225] SEQ ID NO:45—CRC08833 mature Q28-G149 is shown.

[0226] SEQ ID NO:46—shows the cbhl promoter sequence.

[0227] SEQ ID NO:47—shows the pep1 signal with the gla1 intron.

[0228] SEQ ID NO:48—The CRC08319 zymogen DNA sequence is shown.

[0229] SEQ ID NO:49—shows the cbhl terminator DNA sequence.

[0230] SEQ ID NO:50—shows the pyr2 DNA sequence.

[0231] SEQ ID NO:51—shows the amds DNA sequence.

[0232] SEQ ID NO:52—shows the yhfN region DNA sequence.

[0233] SEQ ID NO:53—shows the engineered rrnI promoter DNA sequence.

[0234] SEQ ID NO:54—shows the aprE signal peptide DNA sequence.

[0235] SEQ ID NO:55—shows BASI codon-optimized for expression in Bacillus DNA sequence.

[0236] SEQ ID NO:56—shows the BPN' terminator DNA sequence.

[0237] SEQ ID NO:57—shows the alrA gene DNA sequence.

[0238] SEQ ID NO:58—shows mature BASI.

[0239] SEQ ID NO:59—CF 17-79 is shown.

[0240] SEQ ID NO:60—CF 19-20 is shown.

[0241] SEQ ID NO:61—CF 19-19 is shown.

[0242] SEQ ID NO:62—CF 19-22 is shown.

[0243] SEQ ID NO:63—CF 19-21 is shown.

[0244] SEQ ID NO:64—CF 17-80 is shown.

[0245] SEQ ID NO:65—sgRNA cpa5 is shown.

[0246] SEQ ID NO:66—sgRNA cpa5 is shown.

[0247] SEQ ID NO:67—shows the Locus A upstream homology region (UHR).

[0248] SEQ ID NO:68—shows the Locus A downstream homology region (DHR).

[0249] SEQ ID NO:69—shows the cbh2 promoter.

[0250] SEQ ID NO:70—depicts the cbhl catalytic core (E229Q) and linker.

[0251] SEQ ID NO:71—depicts the kexin site.

[0252] SEQ ID NO:72—shows the trpC terminator.

[0253] SEQ ID NO:73—sgRNA locus A is shown.

[0254] SEQ ID NO:74—cpa5 right wing is shown.

[0255] SEQ ID NO:75—shows the sdil marker.

[0256] SEQ ID NO:76—cpa5 left wing is shown.

[0257] SEQ ID NO:77—RPG2641 is shown.

[0258] SEQ ID NO:78—RPG2594 is shown.

[0259] SEQ ID NO:79—RPG2642 is shown.

[0260] SEQ ID NO:80—RPG2537 is shown.

[0261] SEQ ID NO:81—shows the als tag.

[0262] SEQ ID NO:82—TR0004946_slp6 is shown.

[0263] SEQ ID NO:83—TR0004988_slp6 is shown.

[0264] SEQ ID NO:84—TR0491140_amp1 is shown.

[0265] SEQ ID NO:85—TR0491227_amp1 is shown.

[0266] SEQ ID NO:86—TR0839906_Tr22210 is shown.

[0267] SEQ ID NO:87—TR0839982_Tr22210 is shown.

[0268] SEQ ID NO:88—TR2093782_slp3 is shown.

[0269] SEQ ID NO:89—TR2093819_slp3 is shown.

[0270] SEQ ID NO:90—RPG2732 is shown.

[0271] SEQ ID NO:91—RPG2733 is shown.

[0272] SEQ ID NO:92—RPG2736 is shown.

[0273] SEQ ID NO:93—RPG2737 is shown.

[0274] SEQ ID NO:94—RPG2738 is shown.

[0275] SEQ ID NO:95—RPG2739 is shown.

[0276] SEQ ID NO:96—RPG2740 is shown.

[0277] SEQ ID NO:97—RPG2741 is shown.

[0278] SEQ ID NO:98—shows the sucA marker.

[0279] SEQ ID NO:99—gSK96_pep2 is shown.

[0280] SEQ ID NO: 100—gSK97_pep2 is shown.

[0281] SEQ ID NO: 101—TR1266711_sed2 is shown.

[0282] SEQ ID NO: 102—TR1266752_sed2 is shown.

[0283] SEQ ID NO: 103—TR3505404_cpa5 is shown.

[0284] SEQ ID NO: 104—TR3505523_cpa5 is shown.

[0285] SEQ ID NO: 105 - shows the cbhl catalytic core and linker

[0286] SEQ ID NO: 106—shows the sdil marker.

[0287] SEQ ID NO: 107—TR3881664_gef1 is shown.

[0288] SEQ ID NO: 108—TR3882135_gef1 is shown.

[0289] SEQ ID NO: 109—RPG2752 is shown.

[0290] SEQ ID NO: 110—RPG2618 is shown.

[0291] SEQ ID NO: 111—RPG2734 is shown.

[0292] SEQ ID NO: 112—RPG2735 is shown.

[0293] SEQ ID NO: 113—RPG2742 is shown.

[0294] SEQ ID NO: 114—RPG2743 is shown.

[0295] SEQ ID NO: 115—Full length HOX is shown.

[0296] SEQ ID NO: 116—depicts mature HOX.

[0297] SEQ ID NO: 117—shows mature GOX.

[0298] SEQ ID NO: 118—shows mature BS3.

[0299] SEQ ID NO: 119—Mature WAAA249 is shown.

[0300] SEQ ID NO: 120—shows mature NBA.

[0301] SEQ ID NO: 121—shows mature SAS3.

[0302] SEQ ID NO: 122—shows the mature maltogenic amylase variant VERON MAXIMA.

[0303] SEQ ID NO: 123—Mature WAAA245 is shown.

[0304] SEQ ID NO: 124—shows BASI codon optimized DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0305] Figure 1 A depicts the specific volume of crusty rolls (ccm / g) as a function of the optimal dose of Lipopan F (relative dose based on mg protein / kg flour).

[0306] Figure 1 B depicts the specific volume (ccm / g) of crusty rolls as a function of the dose of CRC08319.

[0307] Figure 2 A depicts the dough lipid profile using Lipopan F.

[0308] Figure 2 B depicts dough lipid profile using CRC08319.

[0309] Figure 3 Depicted are the relative specific volumes of sponge starter and dough as an effect of 'CRC08319+Powerbake 4080' in the presence and absence of SOLEC F.

[0310] Figure 4A and Figure 4BSchematic diagrams of two phospholipase CRC08319 expression cassettes for Trichoderma expression are shown. These cassettes begin with a region corresponding to the promoter sequence of Trichoderma cbhl (SEQ ID NO:46). This is followed by the Trichoderma pep1 signal sequence (SEQ ID NO:47) interrupted by the Trichoderma gla1 intron, which is then fused in frame to the coding sequence of the phospholipase CRC08319 proenzyme (SEQ ID NO:48). This is followed by the Trichoderma cbhl terminator (SEQ ID NO:49). At the far right are the selection markers Trichoderma pyr2 gene (A, SEQ ID NO:50) or the Aspergillus amdS gene (B, SEQ ID NO:51). The numbers above the figure correspond to the base pair numbers.

[0311] Figure 5 Bar graph showing the residual activity of phospholipase expressed by Trichoderma strain AWG09 in ten independent 14 L fermentations (y-axis). Broth supernatants were incubated at 33° C. for about one day, and residual activity was calculated relative to incubation at 4° C. (x-axis). Dashed lines indicate the mean.

[0312] Figure 6 The schematic diagram of the BASI expression cassette for targeted integration at the yhfN locus and expression in Bacillus is shown. The cassette starts with a region homologous to the yhfN locus (SEQ ID NO:52) in Bacillus subtilis. This is followed by an engineered rrnI promoter (SEQ ID NO:53) to drive the expression of the aprE signal sequence (SEQ ID NO:54) fused in the codon-optimized coding sequence (SEQ ID:55) frame of BASI. This is followed by BPN' terminator sequence (SEQ ID NO:56) and alrA selection marker (SEQ ID NO:57). The numbering above the figure corresponds to the base pair numbering. The position of the primers (CF 17-79 and CF 17-80) for PCR and cassette cyclization is also mapped.

[0313] Figure 7 Box plots of residual activity of phospholipase expressed by Trichoderma strain AWG09 in a 14 L fermentor with and without addition of Bacillus expressing BASI are shown. The culture supernatant was incubated at 33°C for 18 hours and the residual activity was calculated relative to the incubation at 4°C. The statistics are presented in the table below the box plots. The comparison circles on the right show that at an alpha level of 0.1, the sample population with added BASI is statistically different from the sample population without added BASI.

[0314] Figure 8A schematic diagram of a BASI expression cassette for targeted integration and Trichoderma expression at locus A is shown. The cassette begins and ends with homology regions for targeting the cassette to locus A (upstream homology region SEQ ID NO:67 and downstream homology region SEQ ID NO:68). Between the homology regions is the BASI expression cassette and the amdS selection marker ("amdS gene", SEQ ID NO:51). The portion for BASI expression consists of the cbh2 promoter (SEQ ID NO:69), the coding sequence of the cbh1 catalytic core and linker ("cbh1_core", SEQ ID NO:70), the kexin cleavage promoting sequence ("Kex", SEQ ID NO:71), the codon-optimized coding sequence of mature BASI (SEQ ID:23), and the Aspergillus trpC terminator (SEQ ID:72). The numbers above the figure correspond to the base pair numbers.

[0315] Fig. 9 SDS-PAGE analysis of microtiter plate fermentation filtrates of Trichoderma strains expressing phospholipase, BASI and control strains is shown. More specifically, Fig. 9 14. Lane 1 is from strain AZP79pp, which shows background proteins still expressed in this Trichoderma host. Lane 2 is from strain BBS89, which additionally expresses phospholipase CRC08319. Lanes 3 and 4 are from transformants of BBS89 that additionally express BASI and its Cbh1_core fusion partner. The approximate migration of Cbh1_core, BASI, and CRC08319 proteins is marked on the far left of the figure.

[0316] Fig.10 Box plots of the residual activity of phospholipases expressed by parental BBS89 or two groups of transformants derived therefrom with the BASI expression cassette (BASI1 and BASI2) after 3 days of incubation at 33°C relative to incubation at 4°C are shown. Statistical data are given in the table below the box plots. The comparison circles on the right show that the population of transformants expressing BASI is statistically different from the parental BBS89 at an alpha level of 0.05.

[0317] Fig.11Box plots of the residual activity of phospholipases expressed by parent BBX71 or two groups of transformants derived therefrom after incubation for 3 days at 33°C are shown relative to incubation at 4°C. One group of transformants has a BASI expression cassette inserted at the gef1 locus (BASI), and the other group has only a selection marker integrated at the gef1 locus (marker only). Statistical data are given in the table below the box plots. The comparison circles on the right show that at an alpha level of 0.1, the populations are statistically different from each other.

[0318] Fig.12 Depicted are the specific volume of crusty rolls (ccm / g) presented as a function of the dose of the mature active fragment of phospholipase 8319, wherein the lowest dose tested is represented as 1 and the additional doses are represented by multiples (x) relative to the lowest dose.

[0319] Fig.13 The volume response of xylanase Bs3 in combination with CRC08319 mature active fragment and POWERBake 4080 in a crusty roll application measuring specific volume is shown.

[0320] Fig.14 Shown is the volumetric response of xylanase Bs3 in combination with CRC08319 mature active fragment and POWERBake 4080 in a Tweedy white toast application measuring unshocked and shaken specific volumes.

[0321] Fig.15 Glucose oxidase GOX (listed as SEQ ID NO: 117 and used as product S 860) in combination with CRC08319 mature active fragment and POWERBake4080 in measuring the volumetric response of Tweedy white toast application in both unshocked and shaken specific volumes.

[0322] Fig.16 Hexose oxidase HOX (listed as SEQ ID NO: 116 and used as product SUREBake 800) in combination with CRC08319 mature active fragment and POWERBake 4080 in a Tweedy white toast application measuring the volumetric response of unshocked and shaken specific volumes.

[0323] Fig.17 The gelatinization temperatures of RVA samples containing CRC08319 in combination with different amylases are shown. CRC08319 alone provided higher gelatinization temperatures compared to the control dough. Surprisingly, even higher gelatinization temperatures were observed when CRC08319 was present in combination with an amylase. DETAILED DESCRIPTION

[0324] abbreviation

[0325] NAPE-N-Acylphosphatidylethanolamine

[0326] NALPE - N-Acyl lysophosphatidylethanolamine

[0327] NAGPE-N-acylglycerophosphoethanolamine

[0328] DGDG- digalactosyl diglyceride

[0329] DGMG-Digalactosylmonoglyceride

[0330] MGDG-monogalactosyl diglyceride

[0331] MGMG-monogalactosylglycerol

[0332] PC – Phosphatidylcholine

[0333] LPC – Lysophosphatidylcholine

[0334] PLA – Phospholipase A

[0335] DATEM - diacetyl tartaric acid esters of mono- and diglycerides

[0336] definition

[0337] The term "amino acid sequence" is synonymous with the terms "polypeptide", "protein" and "peptide", and is used interchangeably. When such amino acid sequences show activity, they may be referred to as "enzymes". Amino acid sequences are represented using the standard amino-to-carboxyl orientation (i.e., N→C) using conventional single-letter or three-letter codes for amino acid residues.

[0338] The term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules that can encode polypeptides. Nucleic acids can be single-stranded or double-stranded. The terms "nucleic acid" and "polynucleotide" are used interchangeably. Since the genetic code is degenerate, more than one codon can be used to encode a specific amino acid, and the compositions and methods of the present invention encompass nucleotide sequences that encode a specific amino acid sequence. Unless otherwise indicated, nucleic acid sequences are presented in a 5'- to -3' orientation.

[0339] "Vector" refers to a polynucleotide sequence designed to introduce a nucleic acid into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes, etc.

[0340] "Expression vector" refers to a DNA construct comprising a DNA sequence encoding a polypeptide of interest, which is operably linked to a suitable control sequence capable of achieving DNA expression in a suitable host. Such control sequences may include a promoter for achieving transcription, an optional operator sequence for controlling transcription, a sequence encoding a suitable ribosome binding site on mRNA, an enhancer, and a sequence for controlling transcription and translation termination.

[0341] The term "barley alpha-amylase / subtilisin inhibitor" or "BASI" is an inhibitor of the alpha-amylase and subtilisin family of serine proteases from barley. In some embodiments, the BASI comprises the amino acid sequence of SEQ ID NO:58. In other embodiments, the BASI may have at least about 50% sequence identity to SEQ ID NO:58, or it may comprise a sequence having at least about 50% sequence identity to residues 67-96 of SEQ ID NO:58. The identity may specifically be at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 98% identical to residues 67-96 of SEQ ID NO:58.

[0342] In addition to the specific amino acid sequences and polynucleotides mentioned herein, the present invention also encompasses variants, homologues, derivatives and fragments thereof.The term "variant" is used to refer to a nucleotide sequence or an amino acid sequence that differs from the wild-type sequence.

[0343] For example, variants may include substitutions, insertions, deletions, truncations, transversions and / or inversions relative to one or more positions of the wild-type sequence. Variants may be prepared using methods known in the art (e.g., site scanning mutagenesis, insertion mutagenesis, random mutagenesis, site-directed mutagenesis, and directed evolution) and using recombination methods well known in the art. Polynucleotide sequences encoding variant amino acid sequences may be easily synthesized using methods known in the art.

[0344] In some aspects, a variant is a naturally occurring nucleotide sequence or amino acid sequence that is different from the wild-type sequence. For example, a variant can be a natural genetic variant.

[0345] In some aspects, the variant is an engineered variant. For example, the variant can be engineered by recombinant methods.

[0346] The target protein sequence of the present invention may also have deletions, insertions or substitutions of amino acid residues that produce silent changes and result in functionally equivalent substances. Deliberate amino acid substitutions may be made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic properties of the residues, as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values ​​include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine and tyrosine.

[0347] For example, conservative substitutions can be made according to the following table: Amino acids in the same box in the second column, and preferably in the same row in the third column, can be substituted for each other, as shown in Table 3.

[0348] Table 3.

[0349]

[0350] The present invention also encompasses homologous substitutions that may occur (substitution and replacement are both used herein to mean the exchange of an existing amino acid residue with an alternative residue), i.e., equivalent substitutions, such as basic for basic, acidic for acidic, polar for polar, etc. Non-homologous substitutions may also occur, i.e., from one type of residue to another or alternatively involving the inclusion of unnatural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine, and phenylglycine.

[0351] Substitutions can also be made with synthetic amino acids (e.g., unnatural amino acids), including: α* and α-disubstituted* amino acids, N-alkyl amino acids*, lactic acid*, halide derivatives of natural amino acids (such as trifluorotyrosine*, p-Cl-phenylalanine*, p-Br-phenylalanine*, p-I-phenylalanine*), L-allyl-glycine*, β-alanine*, La-aminobutyric acid*, Lg-aminobutyric acid*, La-aminoisobutyric acid*, Le-aminocaproic acid # , 7-aminoheptanoic acid*, L-methionine sulfone #* , L-norleucine*, L-norvaline*, p-nitro-L-phenylalanine*, L-hydroxyproline # , L-thioproline*, methyl derivatives of phenylalanine (Phe) (such as 4-methyl-Phe*, pentamethyl-Phe*), L-Phe (4-amino) #、L-Tyr(methyl)*、L-Phe(4-isopropyl)*、L-Tic(1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid)*、L-diaminopropionic acid # and L-Phe(4-benzyl)*.

[0352] For the purposes of the above discussion (relating to homologous or nonhomologous substitution), the symbol * is used to indicate the hydrophobic nature of the derivative, while # is used to indicate the hydrophilic nature of the derivative, with #* indicating amphiphilic character.

[0353] Variant amino acid sequences may include suitable spacers that may be inserted between any two amino acid residues of the sequence, including, in addition to amino acid spacers such as glycine or b-alanine residues, alkyl groups such as methyl, ethyl or propyl groups. Other variant forms (involving the presence of one or more amino acid residues in the form of peptoids) will be well understood by those skilled in the art. To avoid doubt, "peptoid form" is used to refer to variant amino acid residues, wherein the a-carbon substituent group is on the nitrogen atom of the residue, rather than on the a-carbon. Methods for preparing peptides in the form of peptoids are known in the art, such as Simon RJ et al., PNAS [Proceedings of the National Academy of Sciences of the United States of America] (1992) 89 (20), 9367-9371 and Horwell DC, Trends Biotechnol. [Biological Technology Trends] (1995) 13 (4), 132-134.

[0354] Nucleotide sequences used in the present invention may include synthetic or modified nucleotides therein. Modifications of various types for oligonucleotides are known in the art. They include methylphosphonate and thiophosphate backbones and / or add acridine or polylysine chains at the 3' and / or 5' ends of the molecule. For purposes of the present invention, it will be appreciated that nucleotide sequences as herein described may be modified by any method available in the art. Such modifications may be performed to enhance the in vivo activity or lifespan of nucleotide sequences of the present invention.

[0355] The present invention also encompasses the use of nucleotide sequences that are complementary to the sequences presented herein.

[0356] Other variants of the sequences described herein can be obtained, for example, by probing DNA libraries prepared from a series of individuals (e.g., individuals from different populations). In addition, other homologues can be obtained and such homologues and fragments thereof will generally be able to selectively hybridize with the sequences shown in the sequence table herein. Such sequences can be obtained by probing cDNA libraries or genomic DNA libraries prepared from other animal species and probing such libraries with probes containing all or part of any sequence in the accompanying sequence table under medium to high stringency conditions. Similar considerations apply to obtaining species homologues and allelic variants of polypeptides or nucleotide sequences of the present invention.

[0357] Variants and strain / species homologues can also be obtained using degenerate PCR, which will use primers designed to target sequences within variants and homologues that encode conserved amino acid sequences within the sequences of the present invention. Conserved sequences can be predicted, for example, by comparing the amino acid sequences from several variants / homologues. Sequence alignments can be performed using computer software known in the art. For example, the GCG Wisconsin PileUp program is widely used.

[0358] Primers used in degenerate PCR will contain one or more degenerate positions and will be used under less stringent conditions than those used to clone a sequence from a known sequence with single sequence primers.

[0359] Alternatively, such polynucleotides can be obtained by carrying out site-directed mutagenesis to the sequence that has been characterized. This may be useful in situations where, for example, silent codon sequence changes are required to optimize the codon preference of a particular host cell in which the polynucleotide sequence is expressed. Other sequence changes may be desirable in order to introduce restriction enzyme recognition sites, or in order to change the properties or functions of the polypeptides encoded by the polynucleotides.

[0360] Unless otherwise indicated, the present invention employs conventional biochemistry, molecular biology, microbiology and recombinant DNA techniques, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, e.g., J. Sambrook, EF Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, 2nd ed., Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, FM et al. (1995 and periodically supplemented; Current Protocols in Molecular Biology, Chapters 9, 13, and 16, John Wiley & Sons, New York, NY); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; MJ Gait (ed.), 1984, Oligonucleotide Synthesis: A Practical Method. Approach [Oligonucleotide synthesis: A practical method], IrI Press [IrI Press]; and DMJ Lilley and JE Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology [Enzyme Methods: DNA Structure Part A: Synthesis and Physical Analysis Methods of DNA in Enzymology], Academic Press [Academic Press]. Each of these general texts is incorporated herein by reference.

[0361] As used herein, "sequence identity percentage (%)" means that when the CLUSTAL W algorithm with default parameters is used to align a particular sequence, it has at least a certain percentage of amino acid residues that are identical to the amino acid residues in a specified reference sequence. See Thompson et al. (1994) Nucleic Acids Res. [Nucleic Acids Research] 22: 4673-4680. The default parameters of the CLUSTAL W algorithm are:

[0362]

[0363] Deletions are considered non-identical residues compared to the reference sequence. Deletions occurring at either terminus are included. For example, a variant having a deletion of five amino acids from the C-terminus of a mature 617 residue polypeptide would have a 99% sequence identity percentage (612 / 617 identical residues x 100, rounded to the nearest integer) relative to the mature polypeptide. Such a variant would be encompassed by a variant having "at least 99% sequence identity" to the mature polypeptide.

[0364] As used herein, the term "lipase" refers to a triacylglycerol lipase as defined in enzyme entry EC 3.1.1.3. Lipase catalyzes the hydrolysis of triacylglycerols to produce free fatty acids (saturated or unsaturated), diacylglycerols, monoacylglycerols and glycerol.

[0365] As used herein, the term "phospholipase" refers to an enzyme that hydrolyzes phospholipids into fatty acids (saturated or unsaturated), lysophospholipids, diacylglycerol, phosphorylcholine and phosphatidic acid according to the hydrolysis site. Phospholipase is further classified into A, B, C and D types.

[0366] According to the present invention, the protein of the present invention (including enzyme) exists in various forms. The protein of the present invention can be sheared or trimmed (i.e., removing amino acids) from the N-terminus and / or C-terminus, thereby producing a shorter protein. The protein of the present invention can also have internal deletions. Shorter proteins as described herein can have higher activity or lower activity than longer counterparts. Without being bound by theory, as used herein, the term "pre-proprotein" is a protein (including enzyme) with an N-terminal signal peptide that targets the protein for secretion. Pre-proprotein is sometimes referred to as "full length" or "full-length protein" in this article. The N-terminal signal peptide is cut in the endoplasmic reticulum to produce a "proprotein". As used herein, the length of the proprotein is shorter than the full-length protein (it lacks a signal peptide), but longer than the mature protein. Generally, the proprotein is inactive or less active than the mature protein. The proprotein can be activated or converted into a more active mature form by post-translational modification (such as N- or C-terminal shearing). The proprotein as an enzyme can be referred to as a "proenzyme" or "proenzyme (zymogen)". The sheared active protein (derived from the original protein) is also referred to herein as the mature protein. It should be noted that the above terms are used for convenience and are not meant to overrule or determine the activity of the protein of the present invention. It should also be noted that any particular protein of the present invention may have more than one variant described by the same term.

[0367] As used herein, the term "phospholipase A" refers to an enzyme that catalyzes the hydrolysis of the ester bonds of the fatty acid components of phospholipids. There are two different types of phospholipase A activities that can be distinguished. Phospholipase A1 as defined in enzyme entry EC 3.1.1.32 and phospholipase A2 as defined in enzyme entry EC 3.1.1.4, catalyze the deacylation of one fatty acyl group at the sn1 and sn2 positions from diacylglycerol phospholipids, respectively, to produce lysophospholipids.

[0368] Phospholipase A1 and A2 catalyze the deacylation of one fatty acid group at the sn1 and sn2 positions, respectively. Thus, phospholipase A1 (sometimes also referred to herein as PLA1) hydrolyzes the 1-acyl group of phospholipids, thereby hydrolyzing the bond between the fatty acid and the glycerol residue at one position. Phospholipase A2 (sometimes also referred to herein as PLA2) catalyzes the hydrolysis of 2-acyl groups.

[0369] Hydrolysis of phospholipids by phospholipases produces compounds called lysophospholipids. Thus, selective hydrolysis of phospholipids with phospholipase A1 produces 2-acyl lysophospholipids. Hydrolysis of phospholipids with phospholipase A2 produces 1-acyl lysophospholipids. Another phospholipase is "lysophospholipase," which catalyzes the hydrolysis of the remaining fatty acyl groups in lysophospholipids.

[0370] As used herein, the phrase "sn1 / sn2 specificity ratio" is defined herein as the relative PLA1 activity divided by the relative PLA2 activity, as more fully described below.

[0371] As used herein, the phrase "lysophospholipase / phospholipase activity ratio" means (LPC-U / mg protein) / (PC-U / mg protein), as more fully shown below.

[0372] As used herein, the phrase "NALPE / NAPE activity ratio" means (NALPE-U / mg protein) / (NAPE-U / mg protein), as more fully set forth below.

[0373] All references cited in this specification are hereby incorporated by reference in their entirety. In particular, the teachings of all references specifically referenced herein are incorporated by reference.

[0374] Unless otherwise defined, all terms (including technical and scientific terms) used to disclose the present invention have the meaning commonly understood by those skilled in the art to which the present invention belongs. By way of further guidance, term definitions are included to better understand the teachings of the present invention.

[0375] Additional definitions are given below.

[0376] Enzyme production

[0377] Enzyme of the present invention can be produced in host cells, for example, by secretion or intracellular expression. After the enzyme is secreted into the cell culture medium, a cultured cell material (for example, a whole cell culture fluid) with the enzyme can be obtained. Optionally, the enzyme can be separated from the host cell, or even separated from the cell culture fluid, depending on the desired purity of the final enzyme. Suitable host cells include bacteria, fungi (including yeast and filamentous fungi) and plant cells (including algae). Particularly useful host cells include Aspergillus niger, Aspergillus oryzae or Trichoderma reesei. Other host cells include bacterial cells, such as Bacillus subtilis or Bacillus licheniformis, and Streptomyces, Escherichia coli.

[0378] Carrier

[0379] The DNA construct comprising the nucleic acid encoding the enzyme can be constructed to express in a host cell. Due to the well-known degeneracy in the genetic code, variant polynucleotides encoding the same amino acid sequence can be designed and prepared with conventional techniques. The codons optimized for a specific host cell are also well known in the art. The nucleic acid encoding the phospholipase can be incorporated into a vector. The vector can be transferred to a host cell using well-known transformation techniques (such as those disclosed below).

[0380] The vector can be any vector that can be transformed into a host cell and replicated in the host cell. For example, a vector containing a nucleic acid encoding an enzyme can be transformed and replicated in a bacterial host cell as a means of propagation and amplification of the vector. The vector can also be transformed into an expression host so that the encoding nucleic acid can be expressed as a functional phospholipase. The host cell used as an expression host can include, for example, filamentous fungi. The strain catalog of the American Fungal Genetics Stock Center (FGSC) lists vectors suitable for expression in fungal host cells. See FGSC, strain catalog, University of Missouri, website www.fgsc.net (latest modification time is January 17, 2007). A representative vector is pJG153, which is a promoterless Cre expression vector that can be replicated in a bacterial host. See Harrison et al., (June 2011) Applied Environ. Microbiol [Application and Environmental Microbiology] 77: 3916-22. pJG153 can be modified with conventional techniques to contain and express nucleic acids encoding phospholipase.

[0381] The nucleic acid encoding the enzyme can be operably connected to a suitable promoter that allows transcription in the host cell. The promoter can be any DNA sequence that shows transcriptional activity in the host cell of selection, and can be derived from a gene encoding a protein that is homologous or heterologous to the host cell. Exemplary promoters for directing the transcription (particularly in a bacterial host) of the DNA sequence encoding the phospholipase are promoters of the lactose operon of Escherichia coli, Streptomyces coelicolor agarase gene dagA or celA promoters, Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), promoters of Bacillus subtilis xylA and xylB genes, etc. For transcription in fungal hosts, examples of useful promoters are promoters derived from genes encoding Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral α-amylase, Aspergillus niger acid stable α-amylase, Aspergillus niger glucoamylase, Rhizomucor miehei lipase, Aspergillus oryzae alkaline proteinase, Aspergillus oryzae trisaccharide phosphate isomerase, or Aspergillus nidulans acetamidase. When the gene encoding the enzyme is expressed in a bacterial species such as Escherichia coli, a suitable promoter may be selected from, for example, phage promoters including T7 promoters and phage lambda promoters. Examples of suitable promoters for expression in yeast species include, but are not limited to, Gal 1 and Gal 10 promoters of Saccharomyces cerevisiae and Pichia pastoris AOX1 or AOX2 promoters. cbhl is an endogenous inducible promoter from Trichoderma reesei. See Liu et al. (2008) "Improved heterologous gene expression in Trichoderma reesei by cellobiohydrolase I gene (cbhl) promoter optimization," Acta Biochim. Biophys. Sin (Shanghai) 40(2): 158-65.

[0382] The coding sequence can be operably linked to a signal sequence. The DNA encoding the signal sequence can be a DNA sequence naturally associated with the phospholipase gene to be expressed or from a different genus or species. The signal sequence and promoter sequence that make up the DNA construct or vector can be introduced into a fungal host cell and can be derived from the same source. For example, the signal sequence is a cbhl signal sequence operably linked to a cbhl promoter.

[0383] The expression vector may also comprise a suitable transcription terminator and, in eukaryotes, a polyadenylation sequence operably linked to the DNA sequence encoding the variant phospholipase. The terminator and polyadenylation sequences may be suitably derived from the same source as the promoter.

[0384] The vector may further comprise a DNA sequence enabling the vector to replicate in a host cell. Examples of such sequences are the replication origins of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1, and pIJ702.

[0385] The vector may also comprise a selective marker, e.g., a gene whose product compensates for a defect in the isolated host cell, such as the dal gene from Bacillus subtilis or Bacillus licheniformis, or a gene that confers antibiotic resistance (e.g., such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance). In addition, the vector may comprise an Aspergillus selection marker, such as amdS, argB, niaD and xxsC, a marker that causes hygromycin resistance, or selection may be achieved by co-transformation (e.g., known in the art). See, e.g., International PCT Application WO 91 / 17243.

[0386] Intracellular expression may be advantageous in some aspects, for example, when using certain bacteria or fungi as host cells to produce large amounts of phospholipases for subsequent enrichment or purification. Extracellular secretion of the phospholipases into the culture medium can also be used to prepare cultured cell materials containing isolated phospholipases.

[0387] The expression vector typically comprises the composition of cloning vector, for example, as the element that allows the vector to replicate autonomously in the selected host organism and one or more phenotype detectable markers for selecting the purpose. The expression vector usually comprises a control nucleotide sequence, such as a promoter, an operator, a ribosome bind site, a translation initiation signal and optionally a repressor gene or one or more activator genes. In addition, the expression vector can comprise the sequence of the encoding amino acid sequence, which can target the phospholipase to the host cell organelle (such as peroxisome) or to a specific host cell compartment. This targeting sequence includes but is not limited to the sequence SKL. For expressing under the guidance of the control sequence, the nucleotide sequence of the phospholipase is operably connected to the control sequence in a suitable manner about expression.

[0388] The procedures for ligating a DNA construct encoding a phospholipase, a promoter, a terminator and other elements, respectively, and inserting them into an appropriate vector containing the information required for replication are well known to those skilled in the art (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, 1989, and 3rd ed., 2001).

[0389] Host cell transformation and culture

[0390] The cell that comprises the separation of DNA construct or expression vector is advantageously used as the host cell of recombinant production according to enzyme of the present invention.By DNA construct (with one or more copies) being integrated in the host chromosome, it is possible to easily transform cells with the DNA construct of encoding enzyme.It is generally believed that this integration is favourable because the DNA sequence dna is more likely to be stably maintained in the cell.Can be according to conventional methods, for example, by homologous or heterologous recombination, DNA construct is integrated in the host chromosome.Alternately, it is possible to transform cells with the expression vector relevant to different types of host cells as mentioned above.

[0391] Examples of suitable bacterial host organisms are gram-positive bacterial species such as the Bacillaceae family, including Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Geobacillus (formerly Bacillus stearothermophilus), Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus lautus, Bacillus megaterium, and Bacillus thuringiensis; Streptomyces species, such as Streptomyces murinus; lactic acid bacterial species, including Lactococcus species, such as Lactococcus lactis. lactis; Lactobacillus species, including Lactobacillus reuteri; Leuconostoc species; Pediococcus species; and Streptococcus sp. Alternatively, strains of gram-negative bacterial species belonging to the family Enterobacteriaceae (including E. coli) or to the family Pseudomonadaceae may be selected as host organisms.

[0392] Suitable yeast host organisms can be selected from biotechnology-related yeast species, such as but not limited to yeast species, such as Pichia species (Pichia sp.), Hansenula species (Hansenula sp.) or Kluyveromyces (Kluyveromyces), Yarrowinia (Yarrowinia), Schizosaccharomyces species or Saccharomyces species, including Saccharomyces cerevisiae, or belong to the species of Schizosaccharomyces, such as S. pombe (S.pombe) species. Methylotrophic yeast species strain Pichia pastoris can be used as host organisms. Alternatively, the host organism can be a Hansenula species. In filamentous fungi, suitable host organisms include species of Aspergillus, for example, Aspergillus niger, Aspergillus oryzae, Aspergillus tubigensis, Aspergillus awamori or Aspergillus nidulans. Alternatively, strains of Fusarium species (e.g., Fusarium oxysporum) or strains of Rhizomucor species (such as Rhizomucor miehei) can be used as host organisms. Other suitable strains include Thermomyces and Mucor species. In addition, Trichoderma species can be used as hosts. Suitable procedures for transforming Aspergillus host cells include, for example, the procedures described in EP 238023. The enzyme expressed by the fungal host cell can be glycosylated, i.e., will contain a glycosyl moiety. The glycosylation pattern can be the same or different as that present in the wild-type phospholipase. The type and / or degree of glycosylation may impart changes in enzymatic and / or biochemical properties.

[0393] It may be advantageous to delete genes from an expression host, where the gene defect may be cured by a transformed expression vector. Known methods may be used to obtain fungal host cells with one or more inactivated genes. Gene inactivation may be accomplished by complete or partial deletion, by insertional inactivation, or by any other means that renders the gene ineffective for its intended purpose such that the gene is prevented from expressing a functional protein. Any gene from a cloned Trichoderma species or other filamentous fungal host may be deleted, for example, the cbhl, cbh2, egl1, and egl2 genes. Gene deletion may be accomplished by inserting a form of the desired gene to be inactivated into a plasmid by methods known in the art.

[0394] The introduction of DNA constructs or vectors into host cells includes the following techniques, such as transformation; electroporation; nuclear microinjection; transduction; transfection, such as lipofection-mediated and DEAE-dextrin-mediated transfection; incubation with calcium phosphate DNA precipitation; high-speed bombardment with DNA-coated microparticles; and protoplast fusion. General transformation techniques are known in the art. See, for example, Sambrook et al. (2001), supra. The expression of heterologous proteins in Trichoderma is described in, for example, U.S. Patent No. 6,022,725. For the transformation of Aspergillus strains, reference is also made to Cao et al. (2000) Science [Science] 9:991-1001. Genetically stable transformants can be constructed with a vector system, whereby the nucleic acid encoding the enzyme is stably integrated into the host cell chromosome. The transformants are then selected and purified by known techniques.

[0395] The preparation of Trichoderma species for transformation can, for example, involve the preparation of protoplasts from fungal mycelium. See Campbell et al. (1989) Curr. Genet. [Contemporary Genetics] 16: 53-56. Mycelium can be obtained from germinated vegetative spores. Mycelium is treated with enzymes that digest the cell wall to produce protoplasts. Protoplasts are protected by the presence of osmotic stabilizers in the suspension medium. These stabilizers include sorbitol, mannitol, potassium chloride, magnesium sulfate, etc. Typically, the concentration of these stabilizers varies between 0.8M and 1.2M, for example, a 1.2M solution of sorbitol can be used in the suspension medium.

[0396] DNA is taken up into the host Trichoderma species strain, depending on the calcium ion concentration. Typically, CaCl2 between about 10-50mM is used in the uptake solution. Additional suitable compounds include buffer systems such as TE buffer (10mMTris, pH 7.4; 1mM EDTA) or 10mM MOPS (pH 6.0) and polyethylene glycol. It is believed that polyethylene glycol allows cell membrane fusion, thereby allowing the contents of the culture medium to be delivered to the cytoplasm of the Trichoderma species strain. This fusion often leaves multiple copies of the plasmid DNA that are integrated into the host chromosome.

[0397] Typically, Trichoderma species are transformed using protoplasts or cells that have been permeabilized, typically at 10 5 Up to 10 7 / mL, especially 2x 10 6The protoplasts can be grown in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM CaCl2) at a density of 100 μL. These protoplasts or cells can be mixed with the desired DNA in a suitable solution (e.g., 1.2 M sorbitol and 50 mM CaCl2). Typically, a high concentration of PEG is added to the uptake solution. From 0.1 to 1 volume of 25% PEG 4000 can be added to the protoplast suspension; however, adding about 0.25 volume to the protoplast suspension is useful. Additives such as dimethyl sulfoxide, heparin, spermidine, potassium chloride, etc. can also be added to the uptake solution to promote transformation. Similar procedures can be used for other fungal host cells. See, for example, U.S. Patent No. 6,022,725.

[0398] As used herein, protein identification ("JGI-PID") numbers for native Trichoderma genes refer to version 2 of the Trichoderma reesei QM6a genome sequence assembly generated by the Department of Energy Joint Genome Institute (JGI). (The Genome Portal of the Department of Energy Joint Genome Institute, Grigoriev et al., Nucleic Acids Res 2012 Jan;40(Database Special):D26-32.doi:10.1093 / nar / gkr947). The JGI assembled scaffold sequences and annotated genes have also been deposited in GeneBank (The National Center for Biotechnology) under nucleotide accession numbers GL985056.1 to GL985132.1.

[0399] Express

[0400] A method of producing an enzyme of the invention may comprise culturing a host cell as described above under conditions conducive for production of the enzyme, and recovering the enzyme from the cells and / or culture medium.

[0401] The culture medium for culturing cells can be any conventional medium suitable for the growth of the host cell under consideration and for obtaining expression of the phospholipase. Suitable culture medium and culture medium components are available from commercial suppliers or can be prepared according to published recipes (e.g., as described in the catalog of the American Type Culture Collection).

[0402] The enzyme secreted from the host cell can be used in the whole culture fluid preparation.In the method of the present invention, any culture method known in the art can be used to realize the preparation of the spent whole fermentation liquid of recombinant microorganism, thereby causing the expression of phospholipase.Therefore, fermentation can be understood as including in the laboratory or industrial fermentor tank in the shake flask culture, small-scale or large-scale fermentation (comprising continuous fermentation, batch fermentation, fed-batch fermentation or solid-state fermentation) carried out under the condition that suitable substratum and phospholipase can be expressed or separated.Term " spent whole fermentation liquid " is defined as the unfractionated contents of the fermentation material comprising substratum, extracellular protein (for example, enzyme) and cell biomass in this article.It should be understood that term " spent whole fermentation liquid " also encompasses the cell biomass that has been cracked or permeabilized using method well known in the art.

[0403] The enzyme secreted from the host cell can be easily recovered from the culture medium by well-known procedures, which include separating cells from the culture medium by centrifugation or filtration, and precipitating the protein components of the culture medium with the aid of salts (such as ammonium sulfate), and then using chromatographic procedures, such as ion exchange chromatography, affinity chromatography, etc. The polynucleotide encoding the enzyme in the vector can be operably connected to a control sequence that can provide expression of the coding sequence by the host cell, i.e., the vector is an expression vector. The control sequence can be modified, for example, by adding other transcriptional regulatory elements, so that the transcription level directed by the control sequence is more responsive to the transcriptional regulatory factor. The control sequence can particularly include a promoter.

[0404] Host cells can be cultured under suitable conditions that allow expression of phospholipids. The expression of these enzymes can be constitutive, so that they can be produced continuously, or inducible, requiring stimulation to start expression. In the case of inducible expression, protein production can be started when necessary by, for example, adding an inducing substance, such as dexamethasone or IPTG or sophorose to the culture medium. Polypeptides can also be expressed in an in vitro cell-free system (such as TNT TM Produced recombinantly in the rabbit reticulocyte system (Promega).

[0405] The expression host can also be cultured under aerobic conditions in a medium suitable for the host. A combination of shaking or stirring and aeration can be provided, wherein production occurs at a temperature suitable for this host (e.g., from about 25°C to about 75°C (e.g., 30°C to 45°C), depending on the needs of the host and the production of the desired phospholipase). Cultivation can occur from about 12 to about 100 hours or longer (and any hour value therebetween, e.g., from 24 to 72 hours). Typically, the pH of the culture fluid is about 4.0 to about 8.0, depending also on the host's desired culture conditions relative to the production of the phospholipase.

[0406] Methods for enriching and purifying enzymes

[0407] Fermentation, separation and concentration techniques are well known in the art, and conventional methods can be used to prepare solutions containing enzyme polypeptides.

[0408] After fermentation, the fermentation broth is obtained, and the microbial cells and various suspended solids (including the remaining crude fermentation material) are removed by conventional separation techniques to obtain an enzyme solution. Usually, filtration, centrifugation, microfiltration, rotary vacuum drum filtration, ultrafiltration, ultrafiltration after centrifugation, extraction or chromatography are used.

[0409] It is desirable to concentrate the solution containing the enzyme polypeptide to optimize recovery. Using an unconcentrated solution requires increasing the incubation time in order to collect the enriched or purified enzyme precipitate.

[0410] Use conventional concentration techniques to concentrate the enzyme solution until the desired enzyme level is obtained. The concentration of the enzyme solution can be achieved by any of the techniques discussed in this article. Exemplary methods of enrichment and purification include but are not limited to rotary vacuum filtration and / or ultrafiltration.

[0411] The enzyme solution is concentrated into a concentrated enzyme solution until the enzyme activity of the concentrated phospholipase polypeptide-containing solution reaches a desired level.

[0412] Concentration can be performed using, for example, a precipitant such as a metal halide precipitant. Metal halide precipitants include, but are not limited to, alkali metal chlorides, alkali metal bromides, and blends of two or more of these metal halides. Exemplary metal halides include sodium chloride, potassium chloride, sodium bromide, potassium bromide, and blends of two or more of these metal halides. The metal halide precipitant sodium chloride can also be used as a preservative.

[0413] The metal halide precipitation agent is used in an amount effective to precipitate the phospholipase. After routine testing, it will be apparent to one of ordinary skill in the art to select at least an effective amount and an optimal amount of a metal halide to effectively cause precipitation of the enzyme, as well as precipitation conditions, including incubation time, pH, temperature, and enzyme concentration, for maximizing recovery.

[0414] Typically, at least about 5% w / v (weight / volume) to about 25% w / v of the metal halide is added to the concentrated enzyme solution, and typically at least 8% w / v. Typically, no more than about 25% w / v of the metal halide is added to the concentrated enzyme solution, and typically no more than about 20% w / v. The optimal concentration of the metal halide precipitation agent will depend, among other things, on the properties of the particular phospholipase polypeptide and its concentration in the concentrated enzyme solution.

[0415] Another alternative to precipitating the enzyme is to use an organic compound. Exemplary organic compound precipitation agents include: 4-hydroxybenzoic acid, alkali metal salts of 4-hydroxybenzoic acid, alkyl esters of 4-hydroxybenzoic acid, and blends of two or more of these organic compounds. The addition of the organic compound precipitation agent can be performed before, simultaneously with, or after the addition of the metal halide precipitation agent, and the addition of the two precipitation agents, the organic compound, and the metal halide can be performed sequentially or simultaneously.

[0416] Typically, the organic precipitation agent is selected from the group consisting of: an alkali metal salt of 4-hydroxybenzoic acid (such as a sodium salt or potassium salt), and a straight or branched alkyl ester of 4-hydroxybenzoic acid, wherein the alkyl group contains 1 to 12 carbon atoms, and a blend of two or more of these organic compounds. The organic compound precipitation agent can be, for example, a straight or branched alkyl ester of 4-hydroxybenzoic acid, wherein the alkyl group contains 1 to 10 carbon atoms, and a blend of two or more of these organic compounds. An exemplary organic compound is a straight chain alkyl ester of 4-hydroxybenzoic acid, wherein the alkyl group contains 1 to 6 carbon atoms, and a blend of two or more of these organic compounds. Methyl esters of 4-hydroxybenzoic acid, propyl esters of 4-hydroxybenzoic acid, butyl esters of 4-hydroxybenzoic acid, ethyl esters of 4-hydroxybenzoic acid, and a blend of two or more of these organic compounds can also be used. Additional organic compounds also include, but are not limited to, methyl 4-hydroxybenzoate (known as methylparaben), propyl 4-hydroxybenzoate (known as propylparaben), which are also preservatives. For further description, see, for example, U.S. Pat. No. 5,281,526.

[0417] The addition of an organic compound precipitation agent offers the advantage of high flexibility in precipitation conditions with respect to pH, temperature, phospholipase concentration, precipitation agent concentration and incubation time.

[0418] The organic compound precipitation agent is used in an amount effective to improve the precipitation of the enzyme by the metal halide precipitation agent. After routine testing, the selection of at least an effective amount and an optimal amount of the organic compound precipitation agent, together with the conditions of the precipitation to maximize the recovery, including incubation time, pH, temperature and enzyme concentration, will be apparent to one of ordinary skill in the art in light of this disclosure.

[0419] Typically, at least about 0.01% w / v of the organic compound precipitation agent is added to the concentrated enzyme solution, and typically at least about 0.02% w / v. Typically, no more than about 0.3% w / v of the organic compound precipitation agent is added to the concentrated enzyme solution, and typically no more than about 0.2% w / v.

[0420] The concentrated polypeptide solution containing the metal halide precipitation agent and the organic compound precipitation agent can be adjusted to a certain pH, which will necessarily depend on the enzyme to be enriched or purified. Typically, the pH is adjusted to a level close to the isoelectric point of the phospholipase. The pH can be adjusted in a pH range from about 2.5 pH units below the isoelectric point (pi) to about 2.5 pH units above the isoelectric point.

[0421] The incubation time required to obtain an enriched or purified enzyme precipitate depends on the nature of the specific enzyme, the concentration of the enzyme, and one or more specific precipitation agents and their concentrations. Typically, the time for effective precipitation of the enzyme is between about 1 and about 30 hours; usually no more than about 25 hours. In the presence of an organic compound precipitation agent, the incubation time can still be reduced to less than about 10 hours, and in most cases even to about 6 hours.

[0422] Typically, the temperature during incubation is between about 4° C. and about 50° C. Typically, the method is performed at a temperature between about 10° C. and about 45° C. (e.g., between about 20° C. and about 40° C.). The optimal temperature for inducing precipitation varies depending on the solution conditions and the enzyme or one or more precipitation agents used.

[0423] The overall recovery of the enzyme precipitate of enrichment or purification and the efficiency of the process with it are improved by stirring the solution comprising enzyme, added metal halide and added organic compound. Stirring steps are performed during the addition of metal halide and organic compound and during subsequent incubations. Suitable stirring methods include mechanical stirring or shaking, vigorous ventilation or any similar techniques.

[0424] After the incubation period, the enzyme of enrichment or purification is separated from the pigment and other impurities of dissociation, and collected by conventional separation techniques such as filtration, centrifugation, microfiltration, rotary vacuum filtration, ultrafiltration, filter press, cross-membrane microfiltration, cross-flow membrane microfiltration, etc. The further enrichment or purification of the enzyme precipitate can be obtained by washing the precipitate with water. For example, the enzyme precipitate of enrichment or purification can be obtained by washing with water containing a metal halide precipitation agent or by water containing a metal halide and an organic compound precipitation agent.

[0425] During fermentation, the enzyme polypeptide accumulates in the culture fluid. In order to separate, enrich or purify the desired phospholipase, the culture fluid is centrifuged or filtered to eliminate cells, and the resulting cell-free liquid is used for enzyme enrichment or purification. In one embodiment, the cell-free culture fluid is salted out using ammonium sulfate at about 70% saturation; the precipitated fraction at 70% saturation is then dissolved in a buffer and applied to a column (such as a Sephadex G-100 column), and eluted to recover the enzyme activity fraction. For further enrichment or purification, conventional procedures such as ion exchange chromatography can be used.

[0426] The enriched or purified enzyme can be prepared as a liquid (solution, slurry) or solid (granules, powder) final product.

[0427] Description of the Preferred Embodiments

[0428] According to one aspect of the present invention, an isolated polypeptide having phospholipase A1 activity is presented, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0429] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0430] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0431] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0432] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0433] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0434] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0435] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0436] In another aspect of the present invention, a method for making dough is presented, the method comprising mixing dough ingredients selected from the group consisting of flour, salt, water, sugar, fat, lecithin, oil emulsifier and yeast with an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0437] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0438] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0439] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0440] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0441] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0442] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0443] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0444] Preferably, the method of making the dough has the further step of adding at least one additional enzyme useful for improving the dough and / or the baked product made from the dough.

[0445] Preferably, the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

[0446] Preferably, the amylase is an exoamylase.

[0447] Preferably, the exoamylase is a maltogenic amylase.

[0448] In other preferred embodiments of the present invention, the exoamylase is a non-maltogenic amylase. Preferably, the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides from the non-reducing ends of the amylopectin side chains, the one or more linear maltooligosaccharides mainly comprising four to eight D-pyranoglucopyranosyl units.

[0449] In other preferred embodiments, the additional enzyme is a phospholipase.Preferably, the phospholipase has galactolipase activity.

[0450] Preferably, the phospholipase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:17 and / or SEQ ID NO:18.

[0451] In other preferred embodiments, the amylase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO:123.

[0452] Preferably, the xylanase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:118.

[0453] Preferably, the glucose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:117.

[0454] Preferably, the hexose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:116.

[0455] In another aspect of the invention, a dough is presented, the dough containing an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0456] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0457] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0458] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0459] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0460] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0461] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0462] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0463] Preferably, the dough has improved dough extensibility and / or stability.

[0464] In another aspect of the invention, the dough has at least one additional enzyme useful for improving the dough and / or baked products made from the dough.

[0465] Preferably, the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

[0466] Preferably, the amylase is an exoamylase.

[0467] Preferably, the exoamylase is a maltogenic amylase.

[0468] In other preferred embodiments of the present invention, the exoamylase is a non-maltogenic amylase. Preferably, the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides from the non-reducing ends of the amylopectin side chains, the one or more linear maltooligosaccharides mainly comprising four to eight D-pyranoglucopyranosyl units.

[0469] In other preferred embodiments, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity. Preferably, the phospholipase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 17 and / or SEQ ID NO: 18.

[0470] In other preferred embodiments, the amylase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO:123.

[0471] Preferably, the xylanase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:118.

[0472] Preferably, the glucose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:117.

[0473] Preferably, the hexose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:116.

[0474] In another aspect of the present invention, a method for preparing a baked product is presented, the method comprising baking the dough as described above.

[0475] In another aspect of the invention, a baked product obtainable by the method as described above is presented. Preferably, the baked product has at least one improved property selected from the group consisting of: improved crumb pore size, improved uniformity of gas bubbles, no separation between crust and crumb, increased volume, increased crust crispness and improved baked elasticity.

[0476] Preferably, the improved property is crust crispness.

[0477] In another aspect of the invention, a premix for baking is presented, the premix for baking having flour and an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

[0478] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0479] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0480] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0481] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0482] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0483] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0484] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0485] Preferably, the premix has at least one additional enzyme useful for improving the dough and / or the baked product made from the dough.

[0486] Preferably, the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

[0487] Preferably, the amylase is an exoamylase.

[0488] Preferably, the exoamylase is a maltogenic amylase.

[0489] In other preferred embodiments of the present invention, the exoamylase is a non-maltogenic amylase. Preferably, the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides from the non-reducing ends of the amylopectin side chains, the one or more linear maltooligosaccharides mainly comprising four to eight D-pyranoglucopyranosyl units.

[0490] In other preferred embodiments, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity. Preferably, the phospholipase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 17 and / or SEQ ID NO: 18.

[0491] In other preferred embodiments, the amylase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO:123.

[0492] Preferably, the xylanase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:118.

[0493] Preferably, the glucose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:117.

[0494] Preferably, the hexose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:116.

[0495] In another aspect of the present invention, a baking improver is provided, which has granules or agglomerated powder and an isolated polypeptide having phospholipase A1 activity, wherein the isolated polypeptide has a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

[0496] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0497] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0498] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0499] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0500] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0501] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0502] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0503] Preferably, the baking improver has at least one additional enzyme useful for improving the dough and / or the baked product made from the dough.

[0504] Preferably, the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

[0505] Preferably, the amylase is an exoamylase.

[0506] Preferably, the exoamylase is a maltogenic amylase.

[0507] In other preferred embodiments of the present invention, the exoamylase is a non-maltogenic amylase. Preferably, the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides from the non-reducing ends of the amylopectin side chains, the one or more linear maltooligosaccharides mainly comprising four to eight D-pyranoglucopyranosyl units.

[0508] In other preferred embodiments, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity. Preferably, the phospholipase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 17 and / or SEQ ID NO: 18.

[0509] In other preferred embodiments, the amylase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122 or SEQ ID NO:123.

[0510] Preferably, the xylanase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:118.

[0511] Preferably, the glucose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:117.

[0512] Preferably, the hexose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:116.

[0513] In another aspect of the invention, an isolated polynucleotide is presented having a nucleic acid sequence encoding an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0514] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0515] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0516] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0517] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0518] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0519] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0520] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0521] In another aspect of the present invention, a recombinant expression vector having the polynucleotide as described above is presented.

[0522] In another aspect of the present invention, a host cell having the recombinant expression vector as described above is presented.

[0523] In another aspect of the invention, a method for modifying a phospholipid emulsifier is presented, the method having the step of treating the emulsifier with an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0524] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0525] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0526] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0527] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0528] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0529] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0530] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0531] Preferably, the phospholipid emulsifier is lecithin or lysolecithin.

[0532] In another aspect of the invention, a method for producing lysophospholipids in a lipid-containing food matrix is ​​presented, the method having the step of adding to the lipid-containing food matrix an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0533] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0534] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0535] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0536] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0537] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0538] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0539] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0540] Preferably, the lipid-containing food matrix is ​​selected from the group consisting of eggs and egg-containing food products, dough for baked desserts, processed meats, milk-based products, and vegetable oils.

[0541] In another aspect of the invention, a recombinant cell having a) a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide; and b) a heterologously expressed protein is presented.

[0542] Preferably, the heterologously expressed protein is an aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α-galactosidase, β-galactosidase, glucose oxidase (GOX), α-glucosidase, β-glucosidase, glucuronidase, glycosyl The heterologously expressed protein is a phospholipase, a phospholipase, a lipase, a lipoxygenase, a mannanase, a mannosidase, a peroxidase, a phospholipase, a galactolipase, an oxidase, a phytase, a phenoloxidase, a polyphenoloxidase, a protein disulfide isomerase, a proteolytic enzyme, a ribonuclease, an α-1,6-transglucosidase, a transglutaminase, a urokinase, a xylanase, or a β-xylosidase. More preferably, the heterologously expressed protein is a phospholipase.

[0543] Still more preferably, the phospholipase is an isolated polypeptide having phospholipase A1 activity, which has a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0544] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0545] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0546] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0547] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0548] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0549] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0550] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0551] Preferably, the recombinant cell is a bacterial, fungal, yeast, plant, or mammalian cell.

[0552] Preferably, the recombinant cell is of the genus Trichoderma, Aspergillus, Bacillus or Myceliophthora.

[0553] More preferably, the recombinant cell is Trichoderma reesei.

[0554] In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

[0555] In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila, or Bacillus licheniformis.

[0556] Preferably, the BASI polypeptide is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:58.

[0557] In another aspect of the present invention, a fermentation broth having the recombinant cell as described above is presented.

[0558] In another aspect of the invention, a method for reducing proteolysis of a heterologously expressed protein is presented, the method having the step of culturing a recombinant cell comprising a) the BASI polypeptide; and b) the heterologously expressed protein under conditions suitable for producing the heterologously expressed protein and a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide.

[0559] Preferably, the method comprises the step of isolating the heterologous protein.

[0560] Preferably, the heterologously expressed protein is an aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α-galactosidase, β-galactosidase, glucose oxidase (GOX), α-glucosidase, β-glucosidase, glucuronidase, glycosyl transferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase.

[0561] More preferably, the heterologously expressed protein is a phospholipase.

[0562] Still more preferably, the phospholipase is an isolated polypeptide having phospholipase A1 activity, which has a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0563] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0564] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0565] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0566] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0567] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0568] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0569] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0570] Preferably, the recombinant cell is a bacterial, fungal, yeast, plant, or mammalian cell.

[0571] Preferably, the recombinant cell is of the genus Trichoderma, Aspergillus, Bacillus or Myceliophthora.

[0572] More preferably, the recombinant cell is Trichoderma reesei.

[0573] In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

[0574] In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila, or Bacillus licheniformis.

[0575] Preferably, the BASI polypeptide is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:58.

[0576] In another aspect of the invention, a method for reducing proteolysis of a recombinantly expressed protein is presented, the method having the step of isolating the recombinantly expressed protein in the presence of an exogenously added barley alpha-amylase subtilisin inhibitor (BASI) polypeptide.

[0577] Preferably, the method comprises the step of isolating the heterologous protein.

[0578] Preferably, the heterologously expressed protein is an aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α-galactosidase, β-galactosidase, glucose oxidase (GOX), α-glucosidase, β-glucosidase, glucuronidase, glycosyl transferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase.

[0579] More preferably, the heterologously expressed protein is a phospholipase. Still more preferably, the phospholipase is an isolated polypeptide having phospholipase A1 activity, the isolated polypeptide having a protein sequence having at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.

[0580] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO:27.

[0581] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0582] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO:27.

[0583] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0584] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO:27.

[0585] Preferably, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:45.

[0586] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO:27.

[0587] Preferably, the recombinant cell is a bacterial, fungal, yeast, plant, or mammalian cell.

[0588] Preferably, the recombinant cell is of the genus Trichoderma, Aspergillus, Bacillus or Myceliophthora.

[0589] More preferably, the recombinant cell is Trichoderma reesei.

[0590] In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.

[0591] In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthera thermophila, or Bacillus licheniformis.

[0592] Preferably, the BASI polypeptide is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO:58.

[0593] Determination and methods

[0594] Enzyme characterization assays - activity assays and assays for determining positional specificity of phospholipases

[0595] PC-P determination:

[0596] Phospholipase activity (PC-U) can be determined using the following assay:

[0597] Substrate: 1.71% L-α-phosphatidylcholine soybean (95%) (Avanti 441601G, Avanti Polar Lipids, USA), 6.25% TRITON TM -X 100 (Sigma X-100) and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer (pH 7).

[0598] Determination procedure:

[0599] The samples, calibration samples and control samples were mixed in a solution containing 0.1% TRITON TM X-100 10mM HEPES (pH 7.0) dilution.Use 96-well microtiter plates and ThermoMixcer C (Eppendorf, Germany) to analyze.The determination is carried out at 30 ℃.200 μL substrates are constant temperature at 30 ℃ for 180 seconds, then 50 μL enzyme samples are added.Enzymization continues for 600sec.Use NEFA test kit (obtained from WakoChemicals Co., Ltd. (WakoChemicals GmbH, Germany) to measure the amount of free fatty acids released during enzymization.

[0600] This assay kit consists of two reagents

[0601] NEFA-HR(1):

[0602] 50 mM phosphate buffer (pH 7.0) containing

[0603] 0.53U / mL acyl-CoA synthase (ACS)

[0604] 0.31mM Coenzyme A (CoA)

[0605] 4.3mM Adenosine 5-triphosphate disodium salt (ATP)

[0606] 1.5mM 4-amino-antipyrine (4-AA)

[0607] 2.6U / mL ascorbate oxidase (AOD)

[0608] 0.062% Sodium Azide

[0609] NEFA-HR(2):

[0610] 2.4 mM 3-methyl-N-ethyl-N-(E-hydroxyethyl)-aniline (MEHA)

[0611] 12U / mL Acyl-CoA Oxidase (ACOD)

[0612] 14U / mL peroxidase (POD)

[0613] After incubation, 10 μl of the enzymatic mixture was transferred to a new microtiter plate containing 150 μl NEFA-HR (1) and incubated at 30° C. for 240 sec. Thereafter, 75 μl NEFA-HR (2) was added, and the mixture was incubated at 30° C. for 240 sec. OD 540 nm was then measured.

[0614] Enzyme activity (μmol FFA / (min·mL)) was calculated based on a calibration curve made with oleic acid. Enzyme activity PC-U was calculated as μmol fatty acid produced / mL volume of enzyme sample / minute under the assay conditions.

[0615]

[0616] OD = sample OD from which the blind sample OD was taken

[0617] 250 μl = total volume of substrate and enzyme

[0618] 50 μl = volume of enzyme solution

[0619] D = dilution of the sample

[0620] S = slope of the calibration curve (OD / (μmol / mL))

[0621] 10 = Enzymatic reaction time (min)

[0622] LC-MC:

[0623] Samples were analyzed as intact protein by CapLC-MS.The only sample preparation was a 10x dilution in 6 M guanidine HCl, 50 mM ammonium bicarbonate, pH 7.0.

[0624] The masses corresponding to the major components were extracted from the deconvoluted (protein molecular masses calculated using the intact envelope of the protein, detected in several charge states. The Xtract function in Thermo Xcalibur Qual Browser was used for deconvolution) MS spectra and used to calculate the relative ratios between the major components.

[0625] CapLC-ESI-MS Instrument:

[0626] Agilent CapLC system:

[0627] Solvent A: H2O 99.9% / formic acid 1‰

[0628] Solvent B: ACN 99.9% / formic acid 1‰

[0629] Column: 10 cm, ID 75 μm–3 μm C18-A2

[0630] MS-Instrument: LTQ Orbitrap high-resolution mass spectrometer (Thermo Finnigan)

[0631] Chromatographic conditions, CapLC

[0632]

[0633]

[0634] MS conditions

[0635]

[0636] LPC-P determination:

[0637] Lysophospholipase activity (LPC-U) can be determined using the following assay:

[0638] Substrate: 1.18% 1-oleoyl-2-hydroxy-sn-glycero-3-phosphocholine (Avanti845875P, Avanti Polar Lipids Co., Ltd., USA), 6.25% TRITON TM -X 100 (Sigma X-100) and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer (pH 7).

[0639] Determination procedure:

[0640] The samples, calibration samples and control samples were mixed in a solution containing 0.1% TRITON TM X-100 10mM HEPES (pH 7.0) dilution.Use 96-well microtiter plate and ThermoMixcer C (Eppendorf, Germany) to analyze.This determination is carried out at 30 ℃.By 200 μ L substrate at 30 ℃ constant temperature 180 seconds, then add 50 μ L enzyme sample.Enzymization continues 600sec.Use NEFA test kit (obtained from WakoChemicals Co., Ltd. (WakoChemicals GmbH, Germany) to measure the amount of free fatty acids released during enzymization.

[0641] This assay kit consists of two reagents

[0642] NEFA-HR(1):

[0643] 50 mM phosphate buffer (pH 7.0) containing

[0644] 0.53U / mL acyl-CoA synthase (ACS)

[0645] 0.31mM Coenzyme A (CoA)

[0646] 4.3mM Adenosine 5-triphosphate disodium salt (ATP)

[0647] 1.5mM 4-amino-antipyrine (4-AA)

[0648] 2.6U / mL ascorbate oxidase (AOD)

[0649] 0.062% Sodium Azide

[0650] NEFA-HR(2):

[0651] 2.4 mM 3-methyl-N-ethyl-N-(E-hydroxyethyl)-aniline (MEHA)

[0652] 12U / mL Acyl-CoA Oxidase (ACOD)

[0653] 14U / mL peroxidase (POD)

[0654] After incubation, 10 μl of the enzymatic mixture was transferred to a new microtiter plate containing 150 μl NEFA-HR (1) and incubated at 30° C. for 240 sec. Thereafter, 75 μl NEFA-HR (2) was added, and the mixture was incubated at 30° C. for 240 sec. OD 540 nm was then measured.

[0655] The enzyme activity (μmol FFA / (min·mL)) was calculated based on a calibration curve made with oleic acid. The enzyme activity LPC-U was calculated as μmol fatty acid produced / mL volume of enzyme sample / minute under the assay conditions.

[0656]

[0657] OD = sample OD from which the blind sample OD was taken

[0658] 250 μl = total volume of substrate and enzyme

[0659] 50 μl = volume of enzyme solution

[0660] D = dilution of the sample

[0661] S = slope of the calibration curve (OD / (μmol / mL))

[0662] 10 = Enzymatic reaction time (min)

[0663] NAPE-P assay:

[0664] NAPE phospholipase activity (NAPE-U) can be determined using the following assay:

[0665] Substrate: 2.25% palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine-N-linoleoyl (16:0-18:2PE-N18:2) (Avanti 792003, Avanti Polar Lipids, Inc., USA), 6.25% TRITON TM -X100 (Sigma X-100) and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer (pH 7).

[0666] Determination procedure:

[0667] The samples, calibration samples and control samples were mixed in a solution containing 0.1% TRITON TM X-100 10mM HEPES (pH 7.0) dilution.Use 96-well microtiter plate and ThermoMixcer C (Eppendorf, Germany) to analyze.This determination is carried out at 30 ℃.By 200 μ L substrate at 30 ℃ constant temperature 180 seconds, then add 50 μ L enzyme sample.Enzymization continues 600sec.Use NEFA test kit (obtained from WakoChemicals Co., Ltd. (WakoChemicals GmbH, Germany) to measure the amount of free fatty acids released during enzymization.

[0668] This assay kit consists of two reagents

[0669] NEFA-HR(1):

[0670] 50 mM phosphate buffer (pH 7.0) containing

[0671] 0.53U / mL acyl-CoA synthase (ACS)

[0672] 0.31mM Coenzyme A (CoA)

[0673] 4.3mM Adenosine 5-triphosphate disodium salt (ATP)

[0674] 1.5mM 4-amino-antipyrine (4-AA)

[0675] 2.6U / mL ascorbate oxidase (AOD)

[0676] 0.062% Sodium Azide

[0677] NEFA-HR(2):

[0678] 2.4 mM 3-methyl-N-ethyl-N-(E-hydroxyethyl)-aniline (MEHA)

[0679] 12U / mL Acyl-CoA Oxidase (ACOD)

[0680] 14U / mL peroxidase (POD)

[0681] After incubation, 10 μl of the enzymatic mixture was transferred to a new microtiter plate containing 150 μl NEFA-HR (1) and incubated at 30° C. for 240 sec. Thereafter, 75 μl NEFA-HR (2) was added, and the mixture was incubated at 30° C. for 240 sec. OD 540 nm was then measured.

[0682] The enzyme activity (μmol FFA / min·mL) was calculated based on a calibration curve prepared with oleic acid. The enzyme activity NAPE-UpH 7 was calculated as μmol fatty acid produced / min under the assay conditions.

[0683] The enzyme activity (μmol FFA / (min·mL)) was calculated based on a calibration curve made with oleic acid. The enzyme activity NAPE-U was calculated as μmol fatty acid produced / mL volume of enzyme sample / minute under the assay conditions.

[0684]

[0685] OD = sample OD from which the blind sample OD was taken

[0686] 250 μl = total volume of substrate and enzyme

[0687] 50 μl = volume of enzyme solution

[0688] D = dilution of the sample

[0689] S = slope of the calibration curve (OD / (μmol / mL))

[0690] 10 = Enzymatic reaction time (min)

[0691] NALPE-P assay:

[0692] NALPE phospholipase activity (NALPE-U) can be determined using the following assay:

[0693] Substrate: 1.68% 1-palmitoyl-sn-glycero-3-phosphoethanolamine-N-linoleoyl (16:0-NALPE-N18:2) (Avanti 791759, Avanti Polar Lipids, Inc., USA), 6.25% TRITON TM-X 100 (Sigma X-100) and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer (pH 7).

[0694] Determination procedure:

[0695] The samples, calibration samples and control samples were mixed in a solution containing 0.1% TRITON TM X-100 10mM HEPES (pH 7.0) dilution.Use 96-well microtiter plate and ThermoMixcer C (Eppendorf, Germany) to analyze.This determination is carried out at 30 ℃.By 200 μ L substrate at 30 ℃ constant temperature 180 seconds, then add 50 μ L enzyme sample.Enzymization continues 600sec.Use NEFA test kit (obtained from WakoChemicals Co., Ltd. (WakoChemicals GmbH, Germany) to measure the amount of free fatty acids released during enzymization.

[0696] This assay kit consists of two reagents

[0697] NEFA-HR(1):

[0698] 50 mM phosphate buffer (pH 7.0) containing

[0699] 0.53U / mL acyl-CoA synthase (ACS)

[0700] 0.31mM Coenzyme A (CoA)

[0701] 4.3mM Adenosine 5-triphosphate disodium salt (ATP)

[0702] 1.5mM 4-amino-antipyrine (4-AA)

[0703] 2.6U / mL ascorbate oxidase (AOD)

[0704] 0.062% Sodium Azide

[0705] NEFA-HR(2):

[0706] 2.4 mM 3-methyl-N-ethyl-N-(E-hydroxyethyl)-aniline (MEHA)

[0707] 12U / mL Acyl-CoA Oxidase (ACOD)

[0708] 14U / mL peroxidase (POD)

[0709] After incubation, 10 μl of the enzymatic mixture was transferred to a new microtiter plate containing 150 μl NEFA-HR (1) and incubated at 30° C. for 240 sec. Thereafter, 75 μl NEFA-HR (2) was added, and the mixture was incubated at 30° C. for 240 sec. OD 540 nm was then measured.

[0710] The enzyme activity (μmol FFA / (min·mL)) was calculated based on a calibration curve made with oleic acid. The enzyme activity NALPE-U was calculated as μmol fatty acid produced / mL volume of enzyme sample / minute under the assay conditions.

[0711]

[0712] OD = sample OD from which the blind sample OD was taken

[0713] 250 μl = total volume of substrate and enzyme

[0714] 50 μl = volume of enzyme solution

[0715] D = dilution of the sample

[0716] S = slope of the calibration curve (OD / (μmol / mL))

[0717] 10 = Enzymatic reaction time (min)

[0718] Assay for determining phospholipase activity towards PC (phosphatidylcholine) and sn1 and sn2 position specificity

[0719] Substrate: 0.6% 16:0-18:1 PC 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (Avanti850457, Avanti Polar Lipids Co., Ltd., USA), 0.4% TRITON TM -X100 (Sigma, X-100) and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer (pH 7).

[0720] Determination procedure:

[0721] 2 mL of substrate were incubated at 30° C. and 0.1 ml of enzyme dilution corresponding to an enzyme dilution consuming 2%-10% of substrate after 10 minutes of reaction was added in 0.05 M HEPES buffer (magnetic stirring).

[0722] The free fatty acid is protonated by adding 40 μ L 4M HCl to terminate the reaction. Add 1 mL 99% ethanol and mix on a vortex mixer. Add 5 mL MTBE (methyl tertiary butyl ether) containing 0.5 mg C17:0 lipid acid (heptadecanoic acid). Sample is mixed for 5 sec on a vortex mixer again, and extracted 30 minutes with 25 rpm on a rotamixer (Stuart Rotartor SB2). Sample was centrifuged for 10 minutes at 1520 g.

[0723] A 500 mg amine (NH2)-Bond Elut SPE column (Agilent) was placed on the Bond Elut vacuum system. The column was conditioned with 8 mL petroleum ether. The MTBE phase from the extraction was applied to the column and eluted with:

[0724] 1. Fraction 8 mL solvent A: MTBE: 2-propanol (2:1)

[0725] 2. Fraction 8 mL of solvent B: acetone: formic acid (100:2)

[0726] The solvent was eluted at approximately 0.25 mL / min.

[0727] The collected fatty acid fractions (fraction 2) were evaporated to dryness and the fatty acids were analyzed by GLC. The amounts of C16:0 and C18:1 fatty acids were determined based on the internal standard fatty acid C17:0.

[0728] Enzyme activity was calculated as μmol fatty acid / min produced under the assay conditions.

[0729]

[0730] in

[0731] A=%C16:0 fatty acid+%C18:1 fatty acid

[0732] 2 = mL substrate

[0733] 1000000 = mol to μmol

[0734] D = enzyme dilution factor

[0735] MW = average molecular weight of the C16:0 and C18:1 fatty acids produced

[0736] 10 = minutes reaction time

[0737] 0.1 = mL enzyme added to the assay

[0738] The relative PLA1 enzyme activity was calculated as:

[0739]

[0740] The relative PLA2 enzyme activity was calculated as:

[0741]

[0742] The SN1 / SN2 specificity ratio is presented as:

[0743] Sn1 / sn2 specificity ratio = relative PLA1 activity / relative PLA2 activity

[0744] Assay for determining phospholipase activity and sn1 and sn2 position specificity towards NAPE (N-acylphosphatidylethanolamine)

[0745] Substrate: 0.79% 16:0-18:2 (PE-N18:2) NAPE palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine-N-linoleoyl (Avanti 792003, Avanti Polar Lipids Co., Ltd., USA), 0.4% TRITON TM -X 100 (Sigma, X-100) and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer (pH 7).

[0746] Determination procedure:

[0747] 2 mL of substrate were incubated at 30° C. and 0.1 ml of enzyme dilution corresponding to an enzyme dilution consuming 2%-10% of substrate after 10 minutes of reaction was added in 0.05 M HEPES buffer (magnetic stirring).

[0748] The free fatty acid is protonated by adding 40 μ L 4M HCl to terminate the reaction. Add 1 mL 99% ethanol and mix on a vortex mixer. Add 5 mL MTBE (methyl tertiary butyl ether) containing 0.5 mg C17:0 lipid acid (heptadecanoic acid). Sample is mixed for 5 sec on a vortex mixer again, and extracted 30 minutes with 25 rpm on a rotamixer (Stuart Rotartor SB2). Sample was centrifuged for 10 minutes at 1520 g.

[0749] A 500 mg amine (NH2)-Bond Elut SPE column (Agilent) was placed on the Bond Elut vacuum system. The column was conditioned with 8 mL petroleum ether. The MTBE phase from the extraction was applied to the column and eluted with:

[0750] 1. Fraction 8 mL solvent A: MTBE: 2-propanol (2:1)

[0751] 2. Fraction 8 mL of solvent B: acetone: formic acid (100:2)

[0752] The solvent was eluted at approximately 0.25 mL / min.

[0753] The collected fatty acid fractions (fraction 2) were evaporated to dryness and the fatty acids were analyzed by GLC. The amounts of C16:0 and C18:2 fatty acids were determined based on the internal standard fatty acid C17:0.

[0754] Enzyme activity was calculated as μmol fatty acid / min produced under the assay conditions.

[0755]

[0756] in

[0757] A=%C16:0 fatty acid+%C18:2 fatty acid

[0758] 2 = mL substrate

[0759] 1000000 = mol to μmol

[0760] D = enzyme dilution factor

[0761] MW = average molecular weight of the C16:0 and C18:1 fatty acids produced

[0762] 10 = minutes reaction time

[0763] 0.1 = mL enzyme added to the assay

[0764] The relative PLA1 enzyme activity was calculated as:

[0765]

[0766] The relative PLA2 enzyme activity was calculated as:

[0767]

[0768] The SN1 / SN2 specificity ratio is presented as:

[0769] Sn1 / sn2 specificity ratio = relative PLA1 activity / relative PLA2 activity

[0770] Gas chromatography (GLC):

[0771] Free fatty acids were analyzed by GLC as trimethylsilyl derivatives (TMS).

[0772] instrument

[0773] - Perkin Elmer Clarus 600 capillary gas chromatograph equipped with a WCOT fused silica column 12.5m x 0.25mm ID x 0.1μ film thickness 5% phenyl-methyl-silicone (CP Sil 8CB from Chrompack).

[0774] Carrier gas: Helium.

[0775] Syringe: PSSI cold split injection (initial temperature 90°C, heated to 395°C), volume 1.0 μl

[0776] Detector FID: 395℃

[0777]

[0778] Sample preparation:

[0779] The evaporated sample was dissolved in 1.5 ml of heptane:pyridine (2:1). 500 μl of the sample solution was transferred to a curved vial, 100 μl of MSTFA (N-methyl-N-trimethylsilyl-trifluoroformamide) was added and reacted at 60° C. for 15 minutes.

[0780] Baking Applications

[0781] Crusty roll baking settings

[0782]

[0783]

[0784] Knead on a Diosna spiral mixer. According to analysis, the water absorption of flour is: 400BU-2% program

[0785] Mix all ingredients in a bowl, add water slowly for 1 minute and knead slowly for 2 minutes and quickly for 6.5 minutes. The dough temperature must be about 26°C. Weigh 1350g of dough and mold into a round shape by hand. Place the dough in a heating cabinet at 30°C for 10 minutes.

[0786] Mix the dough with "GLIMIK TM Use a rounding machine (set according to the table on the machine) to mold into 30 dough balls.

[0787] The dough was proofed at 34°C, 85% RH for 45 minutes and baked at 200°C / 2l steam + 5 minutes damper open (MIWE oven program 1) for 13 minutes. After baking, the rolls were cooled at ambient temperature for 25 minutes and then weighed and the volume measured.

[0788] Evaluation of dough and bread characteristics by skilled artisans

[0789] Baking settings for sponge starter and dough

[0790]

[0791]

[0792] Knead on a Hobart mixer.

[0793] program

[0794] Sponge starter: Mix all ingredients in a bowl at speed 1 for 1 min – speed 2 for 3 min. The sponge starter temperature must be approx. 25.5°C. Ferment the sponge starter at 30°C, 85% RH for 3 hours in an uncovered bowl.

[0795] Dough: Mix the sponge starter and all remaining ingredients (except salt) on low speed for 2 minutes, then on medium speed for 3 minutes (using ice water). Add salt and mix on medium speed for 3 minutes.

[0796] Weigh 450g dough pieces and mould (underweigh – weigh 550g dough normally). Leave dough at ambient temperature for 10 minutes. Mould on a Benier MS500 with the following settings:

[0797] Preform-16

[0798] Vertical drum pulping machine 3

[0799] Front end of pressure plate 4.0 (3.5 for vibration)

[0800] Platen rear end 3.5 (3.1 for vibration)

[0801] The front width is 330 and the back width is 290

[0802] The dough was placed in a greased jar and proofed at 43°C, 95% RH for 70 minutes (extended proofing - normal proofing 60 min). The jar containing the dough was dropped twice from a height of 6.5 cm onto a table to vibrate half of the bread. Bake at 200°C for 26 minutes (MIWE oven program 4). The bread was removed from the jar and cooled for 70 minutes, then weighed and the volume was measured. The characteristics of the dough and bread were evaluated by a person skilled in the art.

[0803]

[0804]

[0805] Extraction of dough lipids.

[0806] The fully proofed dough samples were frozen and freeze-dried. The dry dough was ground and sieved. 1.5 g of the ground, sieved sample was mixed with 1.5 g of a carrier (diatomaceous earth, Thermo Scientific, P / N: 60-033854) and transferred to an ASE 10 ml sample tube. Extraction was performed using a Dionex ASE350 (Thermo Scientific) at 40°C with water-saturated butanol as solvent and a static run time of 10 minutes. After extraction, the solvent was evaporated using a Scan Speed ​​40 (Scanvac, Labogene APS) at 60°C and 1000 rpm. The dried lipids were dissolved in 3.75 ml of heptane: isopropanol (3:2).

[0807] HPLC analysis of phospholipids extracted from dough:

[0808] Dough lipid samples were analyzed by liquid chromatography using a charged aerosol detector. The column was a normal phase column (DIOL) and the mobile phase was the following gradient: A: acetone / methanol 96 / 4 with the addition of 1 mM ammonium formate, and B: acetone / methanol / H2O 60 / 34 / 6 with the addition of 1 mM ammonium formate.

[0809] NALPE was used as a quantitative standard.

[0810] instrument:

[0811] Dionex Ultimate 3000UHPLC, Thermo Scientific

[0812] VANQOISH Detector, Thermo Scientific

[0813] Column: Fortis HILIC Diol, 1.7μm, 50x 2.1mm

[0814] Color spectrum:

[0815] Time (min) Mobile phase A Mobile phase B 0 100％ 0％ 20 0％ 100％ 30 0％ 100％

[0816] The column temperature was 30°C and the injection volume was 4 μL.

[0817] Sample preparation:

[0818] Lipids were extracted from dough as described in 'Extraction of dough lipids' and filtered through a 0.45 μM filter before injection.

[0819] calculate:

[0820] The chromatograms were integrated using Cromeleon software, and the molar concentrations of NAPE, NALPE, and NAGPE were calculated based on the NALPE standard curve.

[0821] Results:

[0822] The corresponding lipid levels of NAPE, NALPE and NAGPE were obtained by first normalizing the respective molar levels of each component to the 'average total molar lipid (NAPE + NALPE + NAGPE)' in all doughs. Subsequently, the corresponding lipid levels are presented relative to the NAPE level in the negative control (no enzyme added). Therefore, NAPE starts (negative control) at 1. NALPE and NAGPE are presented as the levels generated relative to the NAPE starting level.

[0823] RVA Analysis

[0824] For RVA analysis, samples were prepared using Brabender Farinograph AACC method No. 54-2 and modified wheat flour. The water content in the control sample was adjusted to 400BU. The same water content as in the control sample was used for all samples containing enzymes. The dough samples were extended and frozen in liquid nitrogen. For RVA analysis, the dough was thawed and homogenized in distilled water using Ultra-Turex T25 Basic, IKA Labortechnik. RVA analysis was performed using a Rapid Visco vertical analyzer RVA-2 from Newport Scientific, Calibre control International Itd., Appleton, Warrington, UK, from Appleton, UK. The RVA analysis curve was run from 40°C to 95°C in 28min. The data was analyzed using the Thermocline software program.

[0825] White Toast Baking Settings

[0826]

[0827] Mixed on Tweedy K5 mixer. According to analysis, the water absorption of flour is: 400BU-4%

[0828] program

[0829] All dry ingredients are added to the mixer, then water is added, and mixing is started (mixing energy 11.5 watt-hours / kg at 400rpm, -0.6 bar). The dough temperature must be about 29°C. The dough is placed under a cloth at ambient temperature for 5 minutes. 700g of dough pieces are weighed and molded into a round shape by hand. The dough is placed under a cloth at ambient temperature for 5 minutes. Then, the dough is molded on a Benier MS500 under the following settings: Preform: -18, vertical cylinder extruder: 3, press plate: front end 4.5cm, rear end 4.0cm, width: front end 370mm, rear end 340mm. The molded dough is added to a 10x 10x30cm jar and proofed for 70 minutes at 40°C, 70% RH. The jar containing the dough is dropped onto the table twice from a height of 6.5cm to vibrate half of the bread. Bake at 205°C for 30 minutes. The bread was cooled at ambient temperature for 70 minutes before the weight and volume were measured. The dough and bread characteristics were evaluated by a skilled person.

[0830] Chemical structure

[0831] In the following structure, R1, R2 and R3 are C12-C24 hydrocarbons. These C12-24 hydrocarbons are saturated or unsaturated. R1, R2 and R3 can be the same or different hydrocarbons.

[0832] PC

[0833]

[0834] LPC

[0835]

[0836] or

[0837]

[0838] NAPE

[0839]

[0840] NALPE

[0841]

[0842] or

[0843]

[0844] It should be remembered that the one or more embodiments described below are presented by way of example only, and should not be construed as limiting the concepts of the present invention to any specific enzyme.

[0845] Examples

[0846] Example 1 - CRC08310-ThaPla1

[0847] Cloning of Trichoderma harzianum phospholipase ThaPla1 (CRC08310)

[0848] A putative phospholipase gene (designated CRC08310) was identified in Trichoderma harzianum that encodes a protein that has 100% identity to a sequence available from the NCBI database (NCBI accession number: KKO98756.1), as determined from a BLAST search (Altschul et al., J Mol Biol, 215:403–410, 1990). The codon-optimized synthetic nucleic acid sequence of the full-length CRC08310 is provided in SEQ ID NO: 19. The corresponding protein encoded by the full-length CRC08310 gene is shown in SEQ ID NO: 1. At the N-terminus, the protein has a signal peptide of 16 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of the signal sequence indicates that CRC08310 is a secreted enzyme. The proprotein sequence of CRC08310 is shown in SEQ ID NO:2.

[0849] Example 2 - Expression of CRC08310

[0850] A codon-optimized synthetic DNA sequence encoding the full-length CRC08310 protein (SEQ ID NO: 19) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (same as the pTTTpyr2 vector described in published PCT application WO 2015 / 017256, which is incorporated herein by reference) to obtain plasmid pGXT-CRC08310. In the pGXT vector, the Aspergillus nidulans pyrG gene was replaced by the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of the transformant on acetamide as the sole nitrogen source, and the Trichoderma reesei telomeric region allows maintenance of the non-chromosomal plasmid in the fungal cell. pGXT-CRC08310 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing strong inducible expression of the gene of interest.

[0851] The pGXT-CRC08310 plasmid was then transformed into an appropriate strain of Trichoderma reesei using protoplast transformation (Te'o et al. (2002) J. Microbiol. Methods 51:393-99) (methods described in published PCT application WO05 / 001036). Transformants were selected on solid medium containing acetamide as the sole nitrogen source (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron (II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt (II) chloride 1 mg / L; manganese (II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared within about 1 week. After growth on acetamide plates, transformants were picked and transferred to acetamide agar plates separately. After 5 days of growth on acetamide plates, transformants showing stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28°C for 5 days in an oxygen growth chamber. Supernatants from these cultures were used to confirm protein expression by SDS-PAGE analysis. Stable strains with the highest protein expression were selected and fermented in 250-mL shake flasks with glucose / sophorose defined medium.

[0852] Example 3 - CRC08316 - PfiPla1

[0853] Cloning of phospholipase PfiPla1 (CRC08316) from Pseudohylosporium Ficus carica W106-1

[0854] A putative phospholipase gene (designated CRC08316) was identified in Pseudomonas figi W106-1, encoding a protein having 100% identity to a sequence available from the NCBI database (NCBI accession number: ETS81250.1), as determined from a BLAST search (Altschul et al., J Mol Biol, 215:403–410, 1990). The codon-optimized synthetic nucleic acid sequence of the full-length CRC08316 is provided in SEQ ID NO:20. The corresponding protein encoded by the full-length CRC08316 gene is shown in SEQ ID NO:3. At the N-terminus, the protein has a signal peptide of 18 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of the signal sequence indicates that CRC08316 is a secreted enzyme. The proprotein sequence of CRC08316 is shown in SEQ ID NO:4.

[0855] Example 4 - Expression of CRC08316

[0856] A codon-optimized synthetic DNA sequence encoding the full-length CRC08316 protein (SEQ ID NO: 20) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (same as the pTTTpyr2 vector described in published PCT application WO 2015 / 017256, which is incorporated herein by reference) to obtain plasmid pGXT-CRC08316. In the pGXT vector, the Aspergillus nidulans pyrG gene was replaced by the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of the transformant on acetamide as the sole nitrogen source, and the Trichoderma reesei telomeric region allows maintenance of the non-chromosomal plasmid in the fungal cell. pGXT-CRC08316 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing strong inducible expression of the gene of interest.

[0857] The pGXT-CRC08316 plasmid was then transformed into a suitable strain of Trichoderma reesei using protoplast transformation (Te'o et al. (2002) J. Microbiol. Methods 51:393-99) (methods described in published PCT application WO05 / 001036). Transformants were selected on solid medium containing acetamide as the sole nitrogen source (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron (II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt (II) chloride 1 mg / L; manganese (II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared within about 1 week. After growth on acetamide plates, transformants were picked and transferred to acetamide agar plates separately. After 5 days of growth on acetamide plates, transformants showing stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28°C for 5 days in an oxygen growth chamber. Supernatants from these cultures were used to confirm protein expression by SDS-PAGE analysis. Stable strains with the highest protein expression were selected and fermented in 250-mL shake flasks with glucose / sophorose defined medium.

[0858] The crude culture fluid was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Then ammonium sulfate was added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a 60 mL Phenyl-FF agarose column pre-equilibrated with a loading buffer containing 20 mM sodium acetate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted from the column with a gradient of 20 mM sodium acetate (pH 5.0) and 0.5–0.3 M ammonium sulfate. The fractions containing the active target protein were merged, concentrated, and subsequently loaded onto a HiLoad Q-HP agarose column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted from the column with a 20 mM Tris buffer (pH 8.0) and a 0-0.4 M NaCl gradient. The fractions containing active target protein were then pooled and concentrated via a 1OK Amicon Ultra instrument and stored in 20 mM Tris buffer (pH 8.0) and 40% glycerol at -20°C until use.

[0859] Example 5 - CRC08319-MguPla1

[0860] Cloning of Phospholipase MguPla1 (CRC08319) from ARSEF 977 of Metarhizium anisopliae in Guizhou

[0861] A putative phospholipase gene (named CRC08319) was identified in Guizhou Metarhizium ARSEF 977, which encodes a protein that has 100% identity with a sequence available from the NCBI database (NCBI accession number: KID92477.1), as determined from a BLAST search (Altschul et al., J Mol Biol [Journal of Molecular Biology], 215: 403–410, 1990). The codon-optimized synthetic nucleic acid sequence of the full-length CRC08319 is provided in SEQ ID NO: 21. The corresponding protein encoded by the full-length CRC08319 gene is shown in SEQ ID NO: 5. At the N-terminus, the protein has a signal peptide of 16 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods [Natural Methods], 8: 785-786). The presence of the signal sequence indicates that CRC08319 is a secreted enzyme. The proprotein sequence of CRC08319 is shown in SEQ ID NO:6.

[0862] Example 6 - Expression of CRC08319

[0863] A codon-optimized synthetic DNA sequence encoding the full-length CRC08319 protein (SEQ ID NO: 21) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (same as the pTTTpyr2 vector described in published PCT application WO 2015 / 017256, which is incorporated herein by reference) to obtain plasmid pGXT-CRC08319. In the pGXT vector, the Aspergillus nidulans pyrG gene was replaced by the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of the transformant on acetamide as the sole nitrogen source, and the Trichoderma reesei telomeric region allows maintenance of the non-chromosomal plasmid in the fungal cell. pGXT-CRC08319 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing strong inducible expression of the gene of interest.

[0864] The pGXT-CRC08319 plasmid was then transformed into a suitable strain of Trichoderma reesei using protoplast transformation (Te'o et al. (2002) J. Microbiol. Methods 51:393-99) (methods described in published PCT application WO05 / 001036). Transformants were selected on solid medium containing acetamide as the sole nitrogen source (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron (II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt (II) chloride 1 mg / L; manganese (II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared within about 1 week. After growth on acetamide plates, transformants were picked and transferred to acetamide agar plates separately. After 5 days of growth on acetamide plates, transformants showing stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28°C for 5 days in an oxygen growth chamber. Supernatants from these cultures were used to confirm protein expression by SDS-PAGE analysis. Stable strains with the highest protein expression were selected and fermented in 250-mL shake flasks with glucose / sophorose defined medium.

[0865] Use VivaFlow 200 ultrafiltration equipment (Sartorius Stedi Biotech Co., Ltd.) that crude culture fluid is concentrated to about 80mL.Then ammonium sulfate is added in the concentrated solution to a final concentration of 1M.After filtration, the gained soluble fraction is applied to the 60mL Phenyl-FF agarose column pre-balanced with the loading buffer containing 20mM sodium phosphate (pH 7.0) and 1M ammonium sulfate. 20mM sodium phosphate (pH 7.0) and 0.25M ammonium sulfate are used to elute the target protein from the post. Merge the fraction containing the active target protein, concentrate, and be loaded on the Superdex 75 gel filtration column pre-balanced with 20mM sodium phosphate buffer (pH 7.0) (supplemented with extra 0.15M NaCl and 10% glycerol) subsequently. The fractions containing active target protein were then pooled and concentrated via a 10K Amicon Ultra apparatus and stored at -20°C in 20 mM sodium phosphate buffer (pH 7.0) supplemented with 0.15 M NaCl and 40% glycerol until use.

[0866] Example 7 - CRC08405-DamPla1

[0867] Cloning of Phospholipase DamPla1 (CRC08405) from Grapevine

[0868] A putative phospholipase gene (designated CRC08405) was identified in Vitis vinifera that encodes a protein that has 100% identity to a sequence available from the NCBI database (NCBI accession number: KKY36548.1), as determined from a BLAST search (Altschul et al., J Mol Biol, 215:403–410, 1990). The codon-optimized synthetic nucleic acid sequence of the full-length CRC08405 is provided in SEQ ID NO:22. The corresponding protein encoded by the full-length CRC08405 gene is shown in SEQ ID NO:7. At the N-terminus, the protein has a signal peptide of 18 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of the signal sequence indicates that CRC08405 is a secreted enzyme. The proprotein sequence of CRC08405 is shown in SEQ ID NO:8.

[0869] Example 8 - Expression of CRC08405

[0870] A codon-optimized synthetic DNA sequence encoding the full-length CRC08405 protein (SEQ ID NO: 22) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (same as the pTTTpyr2 vector described in published PCT application WO 2015 / 017256, which is incorporated herein by reference), resulting in plasmid pGXT-CRC08405. In the pGXT vector, the Aspergillus nidulans pyrG gene was replaced by the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of the transformant on acetamide as the sole nitrogen source, and the Trichoderma reesei telomeric region allows maintenance of the non-chromosomal plasmid in the fungal cell. pGXT-CRC08405 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing strong inducible expression of the gene of interest.

[0871] The pGXT-CRC08405 plasmid was then transformed into an appropriate strain of Trichoderma reesei using protoplast transformation (Te'o et al. (2002) J. Microbiol. Methods 51:393-99) (methods described in published PCT application WO05 / 001036). Transformants were selected on solid medium containing acetamide as the sole nitrogen source (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron (II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt (II) chloride 1 mg / L; manganese (II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared within approximately 1 week. After growth on acetamide plates, transformants were picked and transferred to acetamide agar plates separately. After 5 days of growth on acetamide plates, transformants showing stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28°C for 5 days in an oxygen growth chamber. Supernatants from these cultures were used to confirm protein expression by SDS-PAGE analysis. Stable strains with the highest protein expression were selected and fermented in 250-mL shake flasks with glucose / sophorose defined medium.

[0872] The crude culture solution was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedi Biotech). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a 60 mL Phenyl-FF agarose column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium phosphate (pH 7.0). The fractions containing the active target protein were combined, concentrated, and subsequently loaded onto a HiPrep Q-XL agarose column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted with a 20 mM Tris buffer (pH 8.0) and a 0–0.5 M NaCl gradient. The fractions containing active target protein were then pooled and passed through a 1OK Amicon Ultra apparatus and stored at -20°C in 20 mM Tris buffer (pH 8.0) supplemented with 0.15 M NaCl and 40% glycerol until use.

[0873] Example 9 - CRC08418 - MorPla3

[0874] Cloning of Phospholipase MorPla3 (CRC08418) from Magnaporthe grisea Y34

[0875] A putative phospholipase gene (named CRC08418) was identified in Magnaporthe oryzae Y34, which encodes a protein that is 100% identical to a sequence available from the NCBI database (NCBI accession number: ELQ41978.1), as determined from a BLAST search (Altschul et al., J Mol Biol [Journal of Molecular Biology], 215: 403–410, 1990). The codon-optimized synthetic nucleic acid sequence of the full-length CRC08418 is provided in SEQ ID NO: 23. The corresponding protein encoded by the full-length CRC08418 gene is shown in SEQ ID NO: 9. At the N-terminus, the protein has a signal peptide of 25 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods [Natural Methods], 8: 785-786). The presence of the signal sequence indicates that CRC08418 is a secreted enzyme. The proprotein sequence of CRC08418 is shown in SEQ ID NO:10.

[0876] Example 10 - Expression of CRC08418

[0877] A codon-optimized synthetic DNA sequence encoding the full-length CRC08418 protein (SEQ ID NO: 23) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (same as the pTTTpyr2 vector described in published PCT application WO 2015 / 017256, which is incorporated herein by reference) to obtain plasmid pGXT-CRC0418. In the pGXT vector, the Aspergillus nidulans pyrG gene was replaced by the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of the transformant on acetamide as the sole nitrogen source, and the Trichoderma reesei telomeric region allows maintenance of the non-chromosomal plasmid in the fungal cell. pGXT-CRC08418 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing strong inducible expression of the gene of interest.

[0878] The pGXT-CRC08418 plasmid was then transformed into a suitable strain of Trichoderma reesei using protoplast transformation (Te'o et al. (2002) J. Microbiol. Methods 51:393-99) (methods described in published PCT application WO05 / 001036). Transformants were selected on solid medium containing acetamide as the sole nitrogen source (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron (II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt (II) chloride 1 mg / L; manganese (II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared within about 1 week. After growth on acetamide plates, transformants were picked and transferred to acetamide agar plates separately. After 5 days of growth on acetamide plates, transformants showing stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28°C for 5 days in an oxygen growth chamber. Supernatants from these cultures were used to confirm protein expression by SDS-PAGE analysis. Stable strains with the highest protein expression were selected and fermented in 250-mL shake flasks with glucose / sophorose defined medium.

[0879] Use VivaFlow 200 ultrafiltration equipment (Sartorius Steady Biotech Co., Ltd.) that crude culture fluid is concentrated to about 80mL.Then ammonium sulfate is added in the concentrated solution to ultimate concentration of 0.8M.After filtration, gained soluble fraction is applied on the 60mL Phenyl-FF agarose column with the pre-equilibration of the loading buffer containing 20mM sodium phosphate (pH 7.0) and 1M ammonium sulfate.Use 20mM sodium phosphate (pH 7.0) from post wash-out target protein.Merge the fraction containing active target protein, concentrate, and be loaded on the Superdex 75 gel filtration column with 20mM sodium phosphate buffer (pH 7.0) (containing 0.15M NaCl (pH 7.0)) pre-equilibration subsequently. The fractions containing active target protein were then pooled and concentrated via a 1OK Amicon Ultra instrument and stored at -20°C in 20 mM sodium phosphate buffer (pH 7.0) containing 0.15 M NaCl (pH 7.0) and 40% glycerol until use.

[0880] Example 11 - CRC08826-NdiPla1

[0881] Cloning of Phospholipase NdiPla1 (CRC08826) from Neoglobulus rubrum

[0882] A putative phospholipase gene (designated CRC08826) was identified in Echinococcus rubrum that encodes a protein that is 100% identical to a sequence available from the NCBI database (NCBI accession number: KPM45012.1) as determined from a BLAST search (Altschul et al., J Mol Biol, 215:403–410, 1990). The codon-optimized synthetic nucleic acid sequence of the full-length CRC08826 is provided in SEQ ID NO:24. The corresponding protein encoded by the full-length CRC08826 gene is shown in SEQ ID NO:11. At the N-terminus, the protein has a signal peptide of 16 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of the signal sequence indicates that CRC08826 is a secreted enzyme. The proprotein sequence of CRC08826 is shown in SEQ ID NO:12.

[0883] Example 12 - Expression of CRC08826

[0884] A codon-optimized synthetic DNA sequence encoding the full-length CRC08826 protein (SEQ ID NO: 24) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (same as the pTTTpyr2 vector described in published PCT application WO 2015 / 017256, which is incorporated herein by reference) to obtain plasmid pGXT-CRC08826. In the pGXT vector, the Aspergillus nidulans pyrG gene was replaced by the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of the transformant on acetamide as the sole nitrogen source, and the Trichoderma reesei telomeric region allows maintenance of the non-chromosomal plasmid in the fungal cell. pGXT-CRC08826 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing strong inducible expression of the gene of interest.

[0885] The pGXT-CRC08826 plasmid was then transformed into an appropriate strain of Trichoderma reesei using protoplast transformation (Te'o et al. (2002) J. Microbiol. Methods 51:393-99) (methods described in published PCT application WO05 / 001036). Transformants were selected on solid medium containing acetamide as the sole nitrogen source (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron (II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt (II) chloride 1 mg / L; manganese (II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared within about 1 week. After growth on acetamide plates, transformants were picked and transferred to acetamide agar plates separately. After 5 days of growth on acetamide plates, transformants showing stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28°C for 5 days in an oxygen growth chamber. Supernatants from these cultures were used to confirm protein expression by SDS-PAGE analysis. Stable strains with the highest protein expression were selected and fermented in 250-mL shake flasks with glucose / sophorose defined medium.

[0886] The crude culture solution was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedi Biotech). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a HiPrep Phenyl FF16 / 10 column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted from the column with a gradient of 20 mM sodium phosphate (pH 5.0) and 0.5–0 M ammonium sulfate. The fractions containing the active target protein were combined, concentrated, and subsequently loaded onto a HiPrep Q FF16 / 10 column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0). The target protein was eluted with a 20 mM sodium phosphate buffer (pH 7.0) and a 0–0.5 M NaCl gradient. The fractions containing the active target protein were then pooled, concentrated, and subsequently loaded onto a HiLoad 26 / 60 Superdex 75 Prep column pre-equilibrated with 20 mM sodium acetate (pH 5.0) and 150 mM NaCl. The fractions containing the active target protein were pooled, concentrated, and loaded onto a HiPrep Phenyl HP 16 / 10 column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted with a gradient of 20 mM sodium phosphate (pH 5.0) and 0.75–0 M ammonium sulfate. The fractions containing the active target protein were pooled, concentrated via a 10K Amicon Ultra device, and stored at -20°C in 20 mM sodium phosphate (pH 5.0) and 40% glycerol until use.

[0887] Example 13 - CRC08833 - TgaPla1

[0888] Cloning of Trichoderma gemsii phospholipase TgaPla1 (CRC08833)

[0889] A putative phospholipase gene (designated CRC08833) was identified in Trichoderma gemsii that encodes a protein that has 100% identity to a sequence available from the NCBI database (NCBI accession number: KUF04745.1), as determined from a BLAST search (Altschul et al., J Mol Biol, 215:403–410, 1990). The codon-optimized synthetic nucleic acid sequence of the full-length CRC08833 is provided in SEQ ID NO:25. The corresponding protein encoded by the full-length CRC08833 gene is shown in SEQ ID NO:13. At the N-terminus, the protein has a signal peptide of 16 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of the signal sequence indicates that CRC08833 is a secreted enzyme. The proprotein sequence of CRC08826 is shown in SEQ ID NO:14.

[0890] Example 14 - Expression of CRC08833

[0891] A codon-optimized synthetic DNA sequence encoding the full-length CRC08833 protein (SEQ ID NO: 25) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (same as the pTTTpyr2 vector described in published PCT application WO 2015 / 017256, which is incorporated herein by reference) to obtain plasmid pGXT-CRC08833. In the pGXT vector, the Aspergillus nidulans pyrG gene was replaced by the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of the transformant on acetamide as the sole nitrogen source, and the Trichoderma reesei telomeric region allows maintenance of the non-chromosomal plasmid in the fungal cell. pGXT-CRC08833 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing strong inducible expression of the gene of interest.

[0892] The pGXT-CRC08833 plasmid was then transformed into a suitable strain of Trichoderma reesei using protoplast transformation (Te'o et al. (2002) J. Microbiol. Methods 51:393-99) (methods described in published PCT application WO05 / 001036). Transformants were selected on solid medium containing acetamide as the sole nitrogen source (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron (II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt (II) chloride 1 mg / L; manganese (II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared within about 1 week. After growth on acetamide plates, transformants were picked and transferred to acetamide agar plates separately. After 5 days of growth on acetamide plates, transformants showing stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28°C for 5 days in an oxygen growth chamber. Supernatants from these cultures were used to confirm protein expression by SDS-PAGE analysis. Stable strains with the highest protein expression were selected and fermented in 250-mL shake flasks with glucose / sophorose defined medium.

[0893] The crude culture fluid is concentrated to about 80 mL using VivaFlow 200 ultrafiltration equipment (Sartorius Stedi Biotech). Then ammonium sulfate is added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction is applied to a 60 mL Phenyl-FF agarose column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein is eluted from the column with 20 mM sodium phosphate (pH 7.0) and 0.5 M ammonium sulfate. The fractions containing the active target protein are merged, concentrated, and subsequently loaded onto a HiLoad Q_XL agarose column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein is eluted with a 20 mM Tris buffer (pH 8.0) and a 0–0.5 M NaCl gradient. The fractions containing active target protein were then pooled and concentrated via a 1OK Amicon Ultra instrument and stored in 20 mM Tris buffer (pH 8.0) and 40% glycerol at -20°C until use.

[0894] Example 15 - CRC08845-ManPla1

[0895] Cloning of phospholipase ManPla1 (CRC08845) from Metarhizium anisopliae BRIP 53293

[0896] A putative phospholipase gene (designated CRC08845) was identified in M. anisopliae BRIP 53293, encoding a protein having 100% identity to a sequence available from the NCBI database (NCBI accession number: KJK84204.1), as determined from a BLAST search (Altschul et al., J Mol Biol, 215:403–410, 1990). The codon-optimized synthetic nucleic acid sequence of the full-length CRC08845 is provided in SEQ ID NO:26. The corresponding protein encoded by the full-length CRC08845 gene is shown in SEQ ID NO:15. At the N-terminus, the protein has a signal peptide of 17 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods, 8:785-786). The presence of the signal sequence indicates that CRC08845 is a secreted enzyme. The proprotein sequence of CRC08845 is shown in SEQ ID NO:16.

[0897] Example 16 - Expression of CRC08845

[0898] A codon-optimized synthetic DNA sequence encoding the full-length CRC08845 protein (SEQ ID NO: 26) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (same as the pTTTpyr2 vector described in published PCT application WO 2015 / 017256, which is incorporated herein by reference) to obtain plasmid pGXT-CRC08845. In the pGXT vector, the Aspergillus nidulans pyrG gene was replaced by the Trichoderma reesei pyr2 gene. The Aspergillus nidulans amdS and pyr2 selective markers confer growth of the transformant on acetamide as the sole nitrogen source, and the Trichoderma reesei telomeric region allows maintenance of the non-chromosomal plasmid in the fungal cell. pGXT-CRC08845 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing strong inducible expression of the gene of interest.

[0899] The pGXT-CRC08845 plasmid was then transformed into a suitable strain of Trichoderma reesei using protoplast transformation (Te'o et al. (2002) J. Microbiol. Methods 51:393-99) (methods described in published PCT application WO05 / 001036). Transformants were selected on solid medium containing acetamide as the sole nitrogen source (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron (II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt (II) chloride 1 mg / L; manganese (II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared within about 1 week. After growth on acetamide plates, transformants were picked and transferred to acetamide agar plates separately. After 5 days of growth on acetamide plates, transformants showing stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28°C for 5 days in an oxygen growth chamber. Supernatants from these cultures were used to confirm protein expression by SDS-PAGE analysis. Stable strains with the highest protein expression were selected and fermented in 250-mL shake flasks with glucose / sophorose defined medium.

[0900] The crude culture solution was concentrated to about 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedi Biotech). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a Butyl FF column pre-equilibrated with a loading buffer containing 20 mM sodium acetate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted from the column with a gradient of 20 mM sodium acetate (pH 5.0) and 0.3–0 M ammonium sulfate. The fractions containing the active target protein were combined, concentrated, and subsequently loaded onto a Q HP column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0). The target protein was eluted with a 20 mM sodium phosphate buffer (pH 7.0) and a 0–0.5 M NaCl gradient. The fractions containing the active target protein were then combined, concentrated, and subsequently loaded onto a Q HP column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted with 20 mM Tris buffer (pH 8.0) and a NaCl gradient of 0-0.5 M. The fractions containing active target protein were then pooled and concentrated via a 10K AmiconUltra device and stored at -20°C in 20 mM Tris buffer (pH 8.0), 0.15 M NaCl and 40% glycerol until use.

[0901] Example 17. Characterization of the phospholipases of the invention relative to Powerbake 4080 and Lipopan F

[0902] According to the activity method presented in "Assays and Methods", enzyme characterization is performed by determining specific activity using different lipid substrates. Powerbake 4080 is a commercial product of International Flavors & Fragrances (IFF) in the United States. Powerbake 4080 acts on polar lipids at the sn1 position. The active enzyme component of Powerbake 4080 is shown by SEQ ID NO:6 of U.S. Patent No. 8,012,732 (which is hereby incorporated by reference) (also shown herein as SEQ ID NO:17). This enzyme is known to have galactolipase and phospholipase activities. Lipopan F is a commercial product of Novozymes. The active enzyme in Lipopan F acts on polar lipids at the sn1 position and is in SEQ ID NO:2 of EP 0869167B (which is hereby incorporated by reference) (also shown herein as SEQ ID NO:18). This enzyme is also known to have galactolipase activity.

[0903] Specific activity was determined using a phosphatidylcholine substrate (PC-P assay), a lysophosphatidylcholine substrate (LPC-P assay), an N-acylphosphatidylethanolamine substrate (NAPE-P assay) and a lyso-N-acylphosphatidylethanolcholine substrate (NALPE-P assay). Activity is presented relative to protein concentration, which represents the specific activity of each enzyme using the different substrates - see Table 1.

[0904]

[0905] Table 1. Specific activity of enzymes (activity units / mg enzyme protein)

[0906] As can be seen in Table 1, the specific activities of all enzymes (except Powerbake 4080 and Lipopan F) on LPC and NALPE substrates are very low. The ratio of LPC to PC and the ratio of NALPE to NAPE activities are presented in Table 2.

[0907]

[0908]

[0909] Table 2. The specific activity ratios of LPC to PC (LPC-U / PC-U) and NALPE to NAPE (NALPE-U / NAPE-U). More specifically, LPC-U / PC-U = (LPC-U / mg protein) / (PC-U / mg protein), and NALPE-U / NAPE-U = (NALPE-U / mg protein) / (NAPE-U / mg protein).

[0910] As is clear from Table 2, relative to phospholipid substrates, the activity of the tested candidates on lysophospholipid substrates is significantly lower than that of existing commercial enzyme products such as Powerbake 4080 and Lipopan F.

[0911] Surprisingly, the evaluated candidates represent a new group of phospholipases - 'non-lysophospholipases' - characterized by having no or very low lysophospholipase activity.

[0912] The current marketed products show LPC-U / PC-U or NALPE-U / NAPE-U ratios higher than 0.014 and 0.13, respectively, whereas, in contrast, the 'non-lysophospholipase' shows ratios lower than 0.002 and 0.0016, respectively. Thus, the ratios of the 'non-lysophospholipase' are 7 and 90 times lower than those of the current marketed products, respectively.

[0913] This feature of 'non-lysophospholipase' activity provides an opportunity for a more powerful system for generating emulsifying components in lipid-containing food matrices. 'Non-lysophospholipase' provides a more powerful system by eliminating the risk of overdosing, as with currently commercially available enzymes. 'Non-lysophospholipase' is able to generate emulsifying components without the risk of degradation of the generated emulsifying components (lysophospholipid-like, i.e., LPC or NALPE). Thus, the "rollover effect" observed with currently commercially available enzymes (wherein lysophospholipid components are not only generated, but further hydrolyzed / degraded) is eliminated, thereby providing the potential for overall higher levels of emulsifying components.

[0914] Example 18. Characterization of phospholipase positional specificity.

[0915] The positional specificity of the enzymes was characterized by determining the free fatty acids (FFA) released from specifically designed PC and NAPE substrates. FFA determination was performed by GLC analysis as presented in 'Gas Chromatography (GLC)' following 'Assays for Determination of Phospholipase Activity and Sn1 and Sn2 Positional Specificity on PC (Phosphatidylcholine)' and 'Assays for Determination of Phospholipase Activity and Sn1 and Sn2 Positional Specificity on NAPE (N-Acylphosphatidylethanolamine)' under 'Assays and Methods'.

[0916] The release of free fatty acids (FFA) was determined by GLC analysis to determine specificity. Based on the internal standard (fatty acid C17:0), the amount of C16:0 and C18:1 fatty acids was determined by PC, and the amount of C16:0 and C18:2 fatty acids was determined by NAPE. Position specificity is expressed as % of relative PLA1 activity and % of relative PLA2 activity. Please refer to Table 3 (A and B), PC and NAPE position specificity were used to determine specificity of different candidates.

[0917]

[0918] Table 3A. Positional specificity of phospholipases as determined by 'Assay for determining phospholipase activity towards PC (phosphatidylcholine) and sn1 and sn2 positional specificity' and presentation of sn1 / sn2 ratios.

[0919]

[0920]

[0921] Table 3B. Positional specificity of phospholipases as determined by 'Assay for determining phospholipase activity towards NAPE (N-acylphosphatidylethanolamine) and sn1 and sn2 positional specificity' and presentation of sn1 / sn2 ratios.

[0922] Example 19. Baking test of the effect of 'non-lysophospholipase' on dough lipid characteristics compared with the commercial phospholipase Lipopan F

[0923] In this experiment, the currently available phospholipase product Lipopan F was tested in a crusty bread roll experimental setting to show the application performance and associated lipid profile of the dough matrix with increasing dosage. In addition, the application performance and dough lipid profile of a 'non-lysophospholipase' CRC08319 was tested in comparison.

[0924] Crusty roll baking was performed as described above for 'Crusty rolls' in the 'Assays and methods' section.

[0925] In Table 4 (A and B), Figure 1 (A and B) and Figure 2 The experimental setup of the applied trials and the results of the baking evaluation and dough lipid profiles are presented in (A and B).

[0926] Table 4A and Table 4B. Experimental setup for enzyme dose-response testing in crusty roll baking.

[0927] All doses are presented as doses relative to the optimal dose of Lipopan F (relative based on mg protein / kg flour). The optimal dose of Lipopan F is defined as the dose that gives the highest specific volume in the baking settings presented. The optimal Lipopan F dose is represented by '1' and the negative control by '0'.

[0928] For example, Lipoopan F dose-response trial 2 (Table 4A): For example, a Lipopan F dose of 0.10 reflects that the dose of Lipopan F in this trial was '0.10 x the optimal dose of Lipopan F' - or in other words, the dose of Lipopan F in this trial was 10% of the dose used in the trial showing the optimal dose of Lipopan F (the trial showing the highest specific volume (Trial 4)).

[0929] Table 4A: Crusty Bread Roll Baking - Lipopan F Dose-Response

[0930]

[0931] Table 4B: Crusty Bread Roll Baking - CRC08319 Dose-Response

[0932]

[0933] Figure 1 A depicts the specific volume of crusty rolls as a function of the optimal dose of Lipopan F (ccm / g).

[0934] The optimal dose of Lipopan F is defined as the dose of Lipopan F that gives the highest specific volume in the baking settings presented - and the optimal Lipopan F dose is represented by '1'. All other doses presented are relative to the optimal Lipopan dose (based on mg protein / kg flour). 0 represents the negative control. Dose response of Lipopan F: 0 represents the negative control (no enzyme added) and '1' represents the optimal Lipopan F dose (=highest specific volume).

[0935] Figure 1 B depicts the dose response of 'CRC08319 - non-lysophospholipase'. 0 represents the negative control (no enzyme added) and CRC08319 doses are presented relative to the optimal Lipopan F dose (relative dose based on mg protein / kg flour).

[0936] Lipopan F showed an optimal dose indicated by '1x optimal dose'. With increasing doses, Lipopan F showed superdose indicated by a decrease in hematocrit. In contrast, increasing doses of CRC08319 showed a continuous increase or plateau in hematocrit.

[0937] The fully fermented dough was frozen, freeze-dried, and the lipids in the dried dough were extracted with water-saturated butanol and analyzed by HPLC according to the procedures described in Assays and Methods. Figure 2 Shown in.

[0938] The lipid profile supports the effect of the application of specific volume. The current marketed product - Lipopan F - shows hydrolysis of NAPE to NALPE when compared to a decrease in specific volume, and at higher doses, further hydrolysis of NALPE to NAGPE. With 80% NAPE hydrolysis (NAPE reduction to 20% of the starting level (starting level = 0x optimal dose (negative control))), Lipopan F shows about 60% NALPE generation. This 80% NAPE hydrolysis and 60% NALPE generation are associated with the optimal dose of Lipopan F (highest specific volume = 1x optimal dose). Lipopan F shows a comparison between specific volume and peak NALPE levels. For Lipopan F, it is apparent that when compared to the formation of NAGPE, the peak NALPE level is about 60% at the higher tested doses (doses above the optimal dose (1)), followed by a decrease in NALPE. The highest level of NAGPE was observed at the highest dose of Lipopan F.

[0939] In contrast, the 'non-lysophospholipase' - CRC08319 - showed complete conversion of NAPE to NALPE. At 80% NAPE hydrolysis (NAPE reduced to 20% of the starting level), the level of NALPE was 80%. With further hydrolysis of NAPE, the 'non-lysophospholipase' showed a continuous increase or plateau in the level of NALPE (which was also compared to specific volume).

[0940] With complete hydrolysis of NAPE (>90%-95% hydrolysis), the reaction equilibrium begins to show a continuous increase or plateau in NAPE levels.

[0941] Even when the dose of 'non-lysophospholipase' was 20x the optimal dose of Lipopan F, which corresponds to 4-6 times the dose of 'non-lysophospholipase', resulting in complete NAPE hydrolysis (about 10% residual NAPE), the NAGPE level was still below 5%.

[0942] Example 20. Application of non-lysophospholipase in lipid-containing food matrices

[0943] Non-lysophospholipases can be used, for example, in egg yolks and whole eggs, processed meats, degumming of vegetable oils, dairy products such as cheese, and baked products such as bread and baked products such as baked desserts (including cakes and biscuits).

[0944] Products containing egg yolk

[0945] As is well known, egg yolk is used in the food industry due to its emulsifying properties. About 30% of the lipids in egg yolk are phospholipids, which contribute to the emulsifying properties of egg yolk. The emulsifying properties of egg yolk are utilized in many foods (including mayonnaise, sauces, condiments and cakes). However, for some food applications, the emulsifying properties of egg yolk are not enough to obtain a homogenous product without separation. For example, in mayonnaise, pasteurization of the product at high temperature can lead to product separation. Non-lysophospholipases can be used to modify the phospholipids in egg yolk (and food products containing egg yolk) into lysophospholipids. The use of enzyme-modified egg yolks can avoid product separation in high temperature pasteurization.

[0946] Processed meat

[0947] Non-lysophospholipases can be used in processed meat products. Non-lysophospholipases will help improve the emulsification of processed meat products and help improve consistency and reduce cooking losses. Non-lysophospholipases added to processed meats convert meat phospholipids into lysophospholipids. Due to the emulsifying properties of lysophospholipids, this component helps improve consistency and reduce cooking-induced losses by improving the emulsification of fat in meat.

[0948] Vegetable oil

[0949] Crude vegetable oils (such as soybean oil) contain 1%-2% phospholipids. Lecithin is removed from the oil during the refining process to improve the quality of the oil and prevent precipitation in the oil. During the oil refining process, phospholipids are removed by a so-called degumming process. Degumming can be done by chemical or enzymatic methods. During the degumming process, 'non-lysophospholipases' can be used to convert phospholipids into lysophospholipids, which are more water soluble and can be removed from the oil by washing with water. Enzymatic hydrolysis of phospholipids is a milder process compared to chemical degumming, which requires harsh alkaline or acidic conditions. Using non-lysophospholipases for degumming will reduce effluent.

[0950] dairy

[0951] Non-lysophospholipases can be used in dairy products. Non-lysophospholipases will help increase yields during cheese production. Non-lysophospholipases added to milk convert milk phospholipids into lysophospholipids. Due to the emulsifying properties of lysophospholipids, this will help increase cheese yields by trapping more lipids in the cheese curd.

[0952] Baked Desserts

[0953] Eggs are an important part of most cake products. Non-lysophospholipases can be used to modify the phospholipids in eggs by producing lysophospholipids, which helps improve emulsification during cake preparation and provides a softer and more delicate crumb. Non-lysophospholipases can also be used directly in cake dough to modify the phospholipids of flour.

[0954] Example 21. Baking effect of 'non-lysophospholipase' in the presence of supplementary substrate - lecithin (SOLEC F)

[0955] In this example, a combination of 'non-lysophospholipase' CRC08319 and Powerbake 4080 was tested in the presence and absence of a supplementary substrate in the form of SOLEC F. SOLEC F is a commercial product of IFF. SOLEC F is a de-oiled soy lecithin that is easy to handle. 'Non-lysophospholipase' CRC08319 and Powerbake 4080 showed a significant improvement in both the volume shaken and the volume not shaken in the presence of the supplementary substrate. In the absence of CRC08319 and Powerbake 4080, the effect of the supplementary substrate was very limited and could even be negative in terms of shake stability. Sponge starter and dough baking trials were performed according to the description of 'Sponge starter and dough' presented in the 'Assay and Methods' section above.

[0956] Table 6 and Figure 3 The experimental setup of the applied trials and the results from the baking evaluation are presented respectively.

[0957] Doses of CRC08319 are presented as doses relative to the optimal dose of Lipopan F (relative on a mg protein / kg flour basis), as presented in Example 19. The optimal dose of Lipopan F is defined as the dose that gives the highest specific volume in the crusty roll baking setting presented in Example 19. The optimal Lipopan F dose is represented by '1' and the negative control is shown as '0'.

[0958] For example, in this trial, a CRC08319 dose of 5x was the 'optimal dose of 5x Lipopan F' (based on mg protein / kg flour), as presented in the crusty roll application test in Example 19.

[0959]

[0960] Table 6. Experimental setup for sponge starter and dough testing of 'CRC08319+Powerbake4080' in the presence and absence of supplementary substrate (SOLEC F).

[0961] Figure 3 The relative specific volumes of sponge starter and dough as a function of 'CRC08319+Powerbake 4080' are shown in the presence and absence of SOLEC F.

[0962] Figure 3 The relative specific volumes of the shaken and non-shaken breads (relative to the non-shaken negative control) are presented. The sponge starter and dough trials showed a significant increase in specific volume (non-shaken and shaken) of 'CRC08319+Powerbake 4080' relative to the negative control (Neg Ctrl) in the absence of SOLEC F. The effect of 'CRC08319+Powerbake 4080' in the presence of SOLEC F provided a further increase in specific volume relative to 'CRC08319+Powerbake 4080' in the absence of the supplement SOLEC F.

[0963] Example 22. Proteolysis of phospholipase CRC08319 when recombinantly expressed in Trichoderma reesei

[0964] 1. Overview

[0965] A Trichoderma strain expressing the phospholipase CRC08319 was developed. The secreted CRC08319 phospholipase was found to lose activity in the fermentation broth. By proteolytic analysis, it was found that the loss of activity was associated with the loss of amino acids at the C-terminus of the CRC08319 lipase.

[0966] 2. Trichoderma strains for recombinant expression of phospholipase CRC08319

[0967] Using methods known to those skilled in the art, two expression cassettes for phospholipase CRC08319 were developed to place the phospholipase proenzyme coding sequence under the control of the cbh1 promoter and terminator sequences and with a signal sequence from Trichoderma pep1 containing an intron from Trichoderma gla1. The two cassettes differed in the selection markers located at one end of the cassette to facilitate isolation of Trichoderma transformants carrying the expression cassette, one with the Trichoderma pyr2 gene and the other with the Aspergillus amdS gene. A schematic diagram of the expression cassette is shown in Figure 4A and Figure 4B, showing the relative position and orientation of the DNA parts in the box. The relevant biological parts of the box are listed in Table 7 in the order in which they are found in the box together with the corresponding SEQ ID. These boxes can be constructed by those skilled in the art based on the disclosed information and / or commercially synthesized (e.g., GeneArt, IDT).

[0968] Table 7: Portions of the CRC08319 phospholipase expression cassette

[0969]

[0970] First, the pyr2-linked expression cassette was used to co-transform a Trichoderma strain along with the restriction endonuclease SwaI. Approximately fifteen (15) μg of the purified expression cassette was used to transform protoplasts of strain AZP79 (a pyr2 mutant Trichoderma reesei strain) in which the four native cellulase genes cbh1, cbh2, egl1, and egl2 had been deleted. Transformation was performed using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol. Transformants were grown on Vogel minimal medium agar plates to select for uridine prototrophy resulting from the pyr2 marker. Transformants were then isolated and grown on Vogel minimal agar plates and then screened for phospholipase expression as generally described in Section 3 of this Example. Strain ASQ29, which expresses a phospholipase, was selected for transformation with the amdS-linked expression cassette.

[0971] Second, the amdS-linked expression cassette was used to co-transform the Trichoderma strain along with the restriction endonuclease NotI. Approximately fifteen (15) μg of the purified expression cassette DNA was used to transform protoplasts of strain ASQ29 using PEG-mediated transformation as described above, except that transformants were selected on minimal medium containing acetamide as the sole nitrogen source. Transformants were then isolated and grown on minimal agar plates with acetamide as the sole nitrogen source and then screened for phospholipase expression as generally described in Section 3 of this Example. Strain AWG09 was selected for fermentation and characterization of the CRC08319 phospholipase.

[0972] 3. Fermentation and Transformant Evaluation in Microtiter Plates

[0973] The methods used for microtiter plate fermentation of transformants and analysis of fermentation broth by SDS-PAGE and PC-P assay are described below.

[0974] Culture medium composition:

[0975] 400x Trichoderma reesei trace elements: citric acid (anhydrous), 175g / L; FeSO4.7H2O, 200g / L, ZnSO4.7H2O, 16g / L, CuSO4.5H2O, 3.2g / L; MnSO4.H2O, 1.4g / L; H3BO3, 0.8g / L.

[0976] Citrate minimal medium 5g / L (NH4)2S04, 4.5g / L KH2PO4, 1g / LMgS04.7H20, and 14.4g / L citric acid, adjusted to pH 5.5 with 5% NaOH. After autoclaving for 30 minutes, 50% sterile glucose was added to a final concentration of 0.5%, and 2.5mL / L of 400x trace element solution was added.

[0977] Liquid defined (LD) medium contained the following components. Caseinoic acid, 12 g / L; (NH4)2SO4, 5 g / L; MgSO4.7H2O, 1 g / L; KH2PO4, 4.5 g / L; CaCl2.2H2O, 1 g / L; PIPPS, 33 g / L; 400× Trace Elements from Trichoderma reesei, 2.5 ml / L; pH was adjusted to 6.9 with NaOH. After sterilization, lactose or glucose / sophorose mixture was added to a final concentration of 1.5% w / v.

[0978] Fermentation:

[0979] Transformants were grown in citrate minimal medium at 32°C in 96-well plates with shaking for 36-48 hours. After incubation, 0.11 mL of seed culture was added to 0.99 ml of LD medium per well of a 24-well 20% lactose slow-release microtiter plate (srMTP). srMTP has been described in U.S. Pat. No. 10030221B2. These production cultures were then fermented at 25°C and 250RPM for 4 to 5 days. After fermentation, the secreted proteins were separated from the cell mass by filtering through a 96-well plate filtered through the bottom into a 96-well non-binding assay plate.

[0980] Phosphatidylcholine assay:

[0981] To assess phospholipase activity (PC-U), the filtrate was assayed for activity towards phosphatidylcholine using the PC-P assay as described in the Assays and Methods above.

[0982] SDS-PAGE analysis:

[0983] To visualize proteins secreted by Trichoderma into the fermentation broth, one (1) to five (5) microliters of the filtrate were diluted in 4xLDS loading buffer (Invitrogen), denatured and run on NuPAGE 4-12% Bis-Tris SDS-PAGE gels (Invitrogen) in 1X NuPAGE MES buffer (Invitrogen) with See Blue Plus 2 molecular weight standards (Invitrogen). The gel was then stained with Simply Blue Safe Stain (Invitrogen) and destained in water using standard molecular biology procedures.

[0984] 4. Fermentation of AWG09 in a 14L fermenter

[0985] To generate a fermentation broth more representative of commercial scale fermentations, a Trichoderma strain engineered to express the CRC08319 phospholipase was fermented in a 14 L fermentor.

[0986] In brief, the spores of the strain were added to 500 mL of culture medium in a 3L flask with both side and bottom baffles. The culture was grown in a shaking incubator at 34 ° C in a minimal medium for 48 hours. After 48 hours, the contents of each flask were added to a 14L fermentor containing 9.5L culture medium, which contained 4.7 g / L KHPO, 1.0 g / LMgSO7HO, 4.3 g / L (NH)SO and 2.5 mL / L of 400X Trichoderma reesei trace element solution (citric acid (anhydrous), 175 g / L; FeSO4·7H2O, 200 g / L, ZnSO4·7H2O, 16 g / L, CuSO4·5H2O, 3.2 g / L; MnSO4H2O, 1.4 g / L; H3BO3, 0.8 g / L; soy flour, 15 g / L). These components were heat sterilized together at 121°C for 30 minutes. Solutions of 60% glucose and 0.48% CaCl2·2H2O were autoclaved separately, cooled and added to the fermentor to a final concentration of 75 g / L glucose and 0.6 g / L CaCl2·2H2O. The medium was adjusted to pH 3.5 with 28% NH, and the temperature was maintained at 34°C during growth. Once the glucose was exhausted, the temperature was reduced to 28°C, and glucose-sophorose was supplied to the culture. The pH of the culture solution was controlled at about 7 with an ammonia feed. Dry cell weight (DCW), total protein concentration and other parameters were measured, and the specific total protein production rate and the yield of the supplied sugar were calculated.

[0987] 5. Stability of CRC08319

[0988] It was found that CRC08319 phospholipase activity (PC-U) was not always stable in Trichoderma culture supernatant.

[0989] The fresh fermentation liquid of about 1ml from 14L AWG09 fermentation is transferred to 1.5ml microcentrifuge tube. These are rotated 3 minutes with 21,000xg in a desktop microcentrifuge, and then the supernatant is divided into 200ul PCR tubes and stored at -20 ℃. The supernatant of 40 microliters (40ul) thawed from 10 independent Trichoderma AWG09 14L fermentation liquids is divided into two groups of 200ul PCR tubes. One group of tubes is stored at 4 ℃ and another group is stored at 33 ℃ for one day, and then the phospholipase activity of both is measured by PC-P determination. The residual activity is calculated as the ratio of the culture liquid activity after incubation at 33 ℃ relative to the culture liquid activity after incubation at 4 ℃.

[0990] like Figure 5 As shown, all samples lost CRC08319 phospholipase activity after incubation at 33°C, ranging from loss of nearly all activity to approximately half.

[0991] 6. Analysis of Recombinant CRC08319 Protein Species Produced by Trichoderma

[0992] Analyze the recombinant CRC08319 protein species as produced by Trichoderma and present in the fermentation broth. It was found that the CRC08319 protein was a mixture of three main species (two mature active species and a truncated inactive species), which differed in their C-terminal processing. Analyze the CRC08319 protein of >90% purity from both high-activity and low-activity fermentation broths to better understand the loss of activity. The phosphatidylcholine activity (PC-U) of the samples was determined, the CRC08319 protein was quantitatively analyzed, and the sequence of the CRC08319 species was deduced by LC-MS.

[0993] The phosphatidylcholine activity (PC-U) of the fractions was measured by the phosphatidylcholine PC-P assay.

[0994] SDS-PAGE gel and using GelDoc TM Proteins were quantified by densitometry using the Go imaging system (Bio-Rad). Reagents used in the assay: concentrated (2x) Laemmli sample buffer (Bio-Rad, catalog number 1610737); 26-well TGX Any kDa gel (Bio-Rad, catalog number 5678125); protein marker "PrecisionPlus Protein TMUnstained protein standards" (Bio-Rad, catalog number 161-0363); protein standards (specified protein concentration by total amino acid analysis, Eurofins Scientific). The analysis was performed as follows: 50 μL of diluted enzyme sample was mixed with 50 μL sample buffer containing 2.7 mg DTT in a 96-well PCR plate. The plate was sealed with Microseal 'B' membrane from Bio-Rad and placed in a PCR machine and heated to 70°C for 10 minutes. Next, the chamber was filled with running buffer and the gel box was set up. Then, 10 μL of each sample and standard (approximately 0.1-1.00 mg / mL protein standard) was loaded on the gel and 10 μL of marker was loaded. Afterwards, the electrophoresis was run at 200 V for 34 min. After electrophoresis, the gel was transferred to a GelDoc Go imager. Image Lab software is used to calculate the intensity of each band. A calibration curve is prepared by using the known protein amount of the sample used as the standard. The content of the target protein in the sample is determined by the band intensity and the calibration curve.

[0995] Samples were analyzed as intact protein by CapLC-MS.The only sample preparation was a 10x dilution in 6 M guanidine HCl, 50 mM ammonium bicarbonate, pH 7.0.

[0996] The masses corresponding to the major components were extracted from the deconvoluted (protein molecular masses calculated using the intact envelope of the protein, detected in several charge states. The Xtract function in Thermo Xcalibur Qual Browser was used for deconvolution) MS spectra and used to calculate the relative ratios between the major components.

[0997] CapLC-ESI-MS Instrument:

[0998] Agilent CapLC System:

[0999] Solvent A: H2O 99.9% / formic acid 1‰

[1000] Solvent B: ACN 99.9% / formic acid 1‰

[1001] Column: 10cm, ID 75μm–3μm C18-A2

[1002] MS-Instrument: LTQ Orbitrap high resolution mass spectrometer (Thermo Finnigan)

[1003] Chromatographic conditions, CapLC

[1004]

[1005]

[1006] MS conditions

[1007]

[1008] This revealed changes in the C-terminal processing of the CRC08319 protein in the Trichoderma culture fluid (Table 8). Two species were identified: SEQ ID NO. 27 and SEQ ID NO: 28, which have high specific activity for phosphatidylcholine, collectively referred to herein as mature CRC08319. The third major species is 6 or 7 amino acids shorter than mature CRC08319 and has a specific activity that is almost 40x lower, referred to herein as truncated CRC08319 (SEQ ID NO: 29).

[1009] Table 8: Specific activity of processed forms of CRC08319 in Trichoderma culture broth (PC-U / mg protein)

[1010]

[1011] Example 23: Stabilization of CRC08319 in Trichoderma clarified culture broth by supplementation with exogenously produced BASI

[1012] 1. Overview

[1013] Clarified broths from Trichoderma strain AWG09 fermented in 14 L fermentors and incubated at warm temperature with and without the addition of BASI produced by Bacillus were analyzed. Inclusion of BASI protein in the fermentation resulted in a 2.4x increase in CRC08319 incubation stability.

[1014] 2. Bacillus subtilis strains used for recombinant expression of BASI

[1015] An expression cassette was developed for integration of a barley amylase subtilisin inhibitor (BASI) expression cassette with the alrA selection marker in Bacillus subtilis at the yhfN locus. A schematic diagram of the expression cassette is shown in Figure 6 , showing the relative position and orientation of the DNA parts in the box. The relevant biological parts of the box are listed in Table 9 in the order in which they are found in the box together with the corresponding SEQ ID. This box can be constructed as described below by those skilled in the art based on the disclosed information and / or commercially synthesized (e.g., GeneArt, IDT).

[1016] Table 9: Portions of the BASI expression cassette for Bacillus expression

[1017]

[1018]

[1019] Primers CF 17-79 and CF 19-20 were used to amplify the yhfN region and rrnI (engineered) promoter from Bacillus subtilis and the aprE signal sequence from Bacillus subtilis from the Bacillus subtilis expression strain (Table 10). Primer CF17-79 also contains the overhang at the end of the alrA box that allows assembly. The 20bp overhang at the end of the aprE signal sequence, the gene (SEQ ID NO:58) encoding barley amylase subtilisin inhibitor (BASI) protein (codon optimized by Geneious software) plus 20 base pairs at the start end of the BPN' terminator from Bacillus amyloliquefaciens were synthesized by an external supplier (Eurofins Genomics). This synthetic DNA fragment (Table 1) was amplified with primers CF 19-19 and CF19-22. The two fragments were fused together using PCR with primers CF 17-79 and CF19-22 (Table 10) to form PCR Fusion 1 using techniques known in the art.

[1020] A DNA fragment containing the BPN' terminator and the alrA expression cassette was amplified from a Bacillus subtilis expression strain using primers CF 19-21 and CF 17-80 (Table 10) (CF 17-80 has an overhang in the upstream region of yhfN for future Gibson assembly). This PCR fragment and PCR fusion 1 were assembled using Gibson assembly (New England Biolabs) to generate a circular DNA cassette using techniques known in the art.

[1021] The assembly was subjected to rolling circle amplification (Evomics), which was used to transform 200ul competent cells of a suitable Bacillus subtilis strain. The transformed cells were incubated at 37°C for 1 hour while shaking at 250rpm. This method is based on the observation that the alrA gene encoding alanine racemase is essential in Bacillus subtilis (Ferrari et al., Bio / Technol. [Biotechnology], 3: 1003-1007, 1987), and can therefore be used as a selective marker. Alanine racemase converts natural L-alanine to D-alanine required for cell wall synthesis. The alanine racemase inhibitor b-chloro-D-alanine (CDA) can be used for selection / amplification of the alrA gene (Heaton et al., Biochem.Biophys.Res.Comm. [Biochemical and Biophysical Research Communications], 149: 576-579, 1987). The alrA gene cassette is integrated into a host lacking the natural alrA gene with the BASI cassette and selected on a plate without supplementing D-alanine. Cells from the transformation mixture are plated on agar plates. Single colonies are selected to grow in Luria broth containing b-chloro-D-alanine (CDA) to an optical density of 1.0 at 600 nm. The strain samples are then frozen at -80°C with 20% glycerol.

[1022] Table 10. PCR primers for Bacillus BASI-alrA cassette

[1023]

[1024] 3. Fermentation of Bacillus subtilis expressing BASI in liquid culture at 14 L scale The inoculum was grown in seed flasks containing LB medium and is shown in Table 11.

[1025]

[1026]

[1027] The production medium for producing BASI protein contained minerals, one or more carbon sources and a complex nitrogen source as shown in Table 12 and Table 13. BASI protein accumulated in the culture medium / cells.

[1028]

[1029] The growth in 14L fermentor is made up of the following 2 steps: generating seed culture, and generating production culture while producing protein.Seed culture is started by inoculating 30mL LB medium into 350mL flask.Seed culture is hatched for about 2h at 180rpm and 37 ℃ until it is turbid.The seed culture of 30mL volume is inoculated into each tank so that final volume reaches the appropriate production medium of 7kg.During the experiment, production culture has unilateral pH control (only adding alkali), and NH4OH is carried out alkali addition and pH is controlled at 7.1.Feed is triggered when OUR reaches 25mmol / L / h, and rises to 1.65g / min from 0.28g / min through 10 hours.

[1030] Various parameters were monitored during the run, including but not limited to: CER (carbon dioxide evolution rate), OUR (oxygen uptake rate), pH, DO (dissolved oxygen), OD (optical density), etc.

[1031] To generate BASI UFC produced by Bacillus, the obtained fermentation broth was diluted with 2 parts of process water. 1% of cationic polymer C581 was added to flocculate the cells. The flocculated cells were removed by depth filtration using a Buchner filter equipped with a HR900 filter pad pre-coated with diatomaceous earth FW12. The clarified filtrate was concentrated using a 10K PES MWCO ultrafiltration membrane.

[1032] 4. Stabilization of Trichoderma-produced CRC08319 with Bacillus-produced BASI Approximately 1 ml of fresh fermentation broth from a 14L AWG09 fermentation was transferred to 1.5 ml microcentrifuge tubes. These were spun at 21,000 x g for 3 minutes in a tabletop microcentrifuge, and the supernatant was then aliquoted into 200 ul PCR tubes and stored at -20°C. Forty microliters (40 ul) of thawed supernatant from six independent Trichoderma AWG0914L fermentations were aliquoted into four sets of 200 ul PCR tubes ("Test Sets" AD), see Table 14.

[1033] Table 14: Experimental conditions for adding BASI to the supernatant of AWG09 culture fluid

[1034]

[1035] To the supernatants of test groups B and D, 1 ul of approximately 20 g / L of BASI UFC produced by Bacillus was added to each tube, mixed briefly, and then pulse spun. Next, test groups A and B were transferred to a 4°C freezer, and test groups C and D were transferred to a 33°C incubator. After incubation for 18 hours, all test group samples were diluted and assayed using the PC-P assay, as generally described in "Assays and Methods". To calculate "residual activity", the activity value of each supernatant test group at 33°C was divided by the activity value of the supernatant test group stored at 4°C, i.e., the ℃ value was divided by the A group value and the D group value was divided by the B group value.

[1036] result

[1037] like Figure 7 As shown, 14 L of clarified supernatant culture broth from strain AWG09 expressing CRC08319 lost an average of 65% of its activity when stored at 33° C. for 18 hours. However, when Bacillus-expressed BASI supernatant was added, these same supernatants only lost an average of 25% of their activity when stored at 33° C. for 18 hours. This shows that BASI can stabilize CRC08319 in Trichoderma culture broth, most likely by inhibiting a co-expressed Trichoderma subtilisin-like protease native to Trichoderma.

[1038] Example 24: Recombinant co-expression of phospholipase CRC08319 and BASI by Trichoderma reesei

[1039] 1. Overview

[1040] A Trichoderma strain expressing the phospholipase CRC08319 was developed. When the expression cassette for BASI was added to this strain, BASI expression was evident by SDS-PAGE analysis and the phospholipase stability was improved.

[1041] 2. Trichoderma strains for recombinant expression of phospholipase CRC08319

[1042] A Trichoderma strain expressing the phospholipase CRC08319 was constructed by co-transformation of an expression cassette tagged with the pyr2 selection marker and Cas9-RNP targeting the carboxypeptidase (cpa5) locus.

[1043] The pyr2-linked CRC08319 expression cassette as described in Example 22 was used to co-transform the Trichoderma strain together with the assembled Cas9 nuclease and synthetic guide RNAs (sgRNA, SEQ ID No. 65 and 66) that target a region within the Trichoderma genome encoding a predicted carboxypeptidase (cpa5, JGIPID 120998). These Cas9-sgRNA complexes were assembled in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma, as generally described in PCT Publication No. WO / 2016 / 100568. Approximately fifteen (15) μg of purified fragments and assembled Cas9-sgRNA complexes were used to transform protoplasts of strain AZP79 (pyr2 mutant Trichoderma reesei strain), in which the four native cellulase genes cbh1, cbh2, egl1, and egl2 had been deleted. Transformation was performed using standard polyethylene glycol (PEG)-mediated protoplast transformation. Transformants were grown on Vogel minimal medium agar plates to select for uridine prototrophy resulting from the pyr2 marker. Transformants were then isolated and grown on Vogel minimal agar plates and screened for phospholipase expression as generally described in Example 22. Phospholipase expressing strain BBS89 was selected to evaluate BASI co-expression.

[1044] 3. Strains used for recombinant co-expression of BASI and CRC08319

[1045] Here, an expression cassette for a BASI fusion protein was developed and used for targeted integration at locus A in Trichoderma strain BBS89 expressing the phospholipase CRC08319.

[1046] Using methods known to those skilled in the art, an expression cassette for barley alpha-amylase subtilisin inhibitor (BASI) was developed to overexpress BASI in Trichoderma as a translational fusion to a catalytically inactive Cbh1_core with a linker. DNA encoding several amino acids intended to promote cleavage of the fusion protein and release of the BASI protein was placed at the end of the Cbh1 linker, just before the start (kexin site) of the mature BASI sequence. Expression of the fusion protein was placed under the regulation of the Trichoderma cbh2 promoter and the Aspergillus nidulans trpC terminator. The Aspergillus nidulans amdS gene was placed at one end of the cassette to facilitate isolation of Trichoderma transformants carrying the expression cassette. The expression cassette was flanked by approximately 1 kb of upstream and downstream homology regions to facilitate integration of the cassette at an intergenic region in the Trichoderma genome referred to herein as locus A. A schematic diagram of the expression cassette is shown in FIG. Figure 8, showing the relative orientation of the DNA portions in the cassette. The relevant biological portions of the cassette are listed in Table 15 in the order in which they are found in the cassette along with the corresponding SEQ IDs. This cassette can be constructed by one skilled in the art based on the disclosed information and / or commercially synthesized (e.g., GeneArt, IDT).

[1047] Table 15: Part of the BASI expression cassette

[1048] part Function Seq ID Locus A upstream homology region (UHR) Promotes homologous integration of the cassette at locus A 67 CBH2 promoter Promotes transcription of BASI mRNA 69 CBH1 catalytic core and linker Promote the secretion of BASI 70 Kexin site Promotes proteolytic cleavage of fusion proteins and release of BASI 71 Codon-optimized BASI BASI coding sequence 124 trpC terminator Promotes termination of mRNA transcription 72 amdS selection marker To isolate transformants 51 Locus A downstream homology region (DHR) Promotes homologous integration of the cassette at locus A 68

[1049] The cassette was used to co-transform strain BBS89 (a Trichoderma strain generated from Section 2) along with the assembled Cas9 nuclease and a synthetic guide RNA (SEQ ID NO: 73) that targets locus A (an intergenic region within the Trichoderma genome). These Cas9-sgRNA complexes were assembled in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma as generally described in PCT Publication No. WO / 2016 / 100568. Approximately five (5) μg of the purified fragment and the assembled Cas9-sgRNA complexes were used to transform protoplasts of BBS89. Transformation was performed using a polyethylene glycol (PEG)-mediated protoplast transformation protocol (Ouedraogo et al., 2015; Penttila et al., 1987). Transformants were grown on Trichoderma minimal medium agar plates with acetamide as the sole nitrogen source to select for acquisition of the amdS marker. Transformants were then isolated and grown on Trichoderma minimal agar plates with acetamide as the sole nitrogen source before testing the transformants.

[1050] 4. Fermentation in microtiter plates

[1051] Transformants from two independent PEG transformations (BASI1 and BASI2), the parent strain (BBS89), and the spontaneous prototrophic revertant of the host strain AZP79 (AZP79pp) were fermented in srMTP, essentially as described in Example 22. After fermentation, the culture filtrate was analyzed by SDS-PAGE and phosphatidylcholine activity assay, essentially as described in Example 22.

[1052] result:

[1053] like Fig. 9As shown, a new band with an apparent molecular weight of approximately 12 kDa was observed in the filtrate of strain BBS89 (lane 2) containing the CRC08319 phospholipase cassette, but not in the filtrate of AZP79pp (lane 1, a pyrimidine prototrophic derivative of the same parent strain). This is consistent with the calculated molecular weight of the mature CRC08319 phospholipase species at 13 kDa. In the combined filtrate of the BBS89 transformants with the BASI expression cassette (lanes 3 and 4), two additional bands were observed relative to the BBS89 parent (lane 2). One band of approximately 60 kDa is consistent with the expected migration of a glycosylated Cbhl-core with a linker. Another major band was found between 14 and 28 kDa consistent with the expected molecular weight of mature BASI of 20 kDa.

[1054] 5. Stability of recombinant CRC08319 expressed by T. reesei with and without co-expression of recombinant BASI

[1055] It was demonstrated that the CRC08319 phospholipase was more stable in Trichoderma filtrate when co-expressed with BASI.

[1056] To assess phospholipase stability in Trichoderma filtrates, aliquots of the filtrate were transferred to non-binding MTPs, sealed, and incubated for three days at 4° C. and 33° C. Activity was then measured using the phosphatidylcholine assay, essentially as described in Example 22. Residual activity was calculated as the ratio of the activity in the broth after incubation at 33° C. relative to the activity in the broth after incubation at 4° C.

[1057] result:

[1058] like Fig.10 As shown, the phospholipase produced by the BBS89 parent strain retained only 48% of its activity after incubation at 33°C, relative to incubation at 4°C. However, in the two groups of transformants (BASI1 and BASI2) derived from BBS89 using the BASI expression cassette, the phospholipase retained 55% of its activity. This represents a 14% increase in phospholipase stability.

[1059] Example 25: Co-expression of BASI and phospholipase CRC08319 in protease-deficient Trichoderma

[1060] 1. Overview

[1061] Here, the protease was knocked out (inactivated) by cas9-mediated mutagenesis of its gene in the genome of Trichoderma strain AWG09 (Example 22) expressing CRC08319 phospholipase by performing 3 consecutive rounds of transformation with a selection marker. In the last round, a BASI expression cassette was introduced at the gef1 locus. Transformants expressing BASI had an average of 6% improved CRC08319 incubation stability.

[1062] 2. Knockout of carboxypeptidase cpa5

[1063] Here, the expression cassette of CRC08319 was targeted to replace a portion of a predicted carboxypeptidase (cpa5, JGIPID 120998) and inactivate it.

[1064] This cpa5 targeting cassette contains a DNA sequence with a 1.0 Kb region that is homologous to a DNA sequence (left wing) spanning exons 1 and 2 and a continuous portion of intron 1 of cpa5. The plasmid also contains a DNA sequence with a 1.0 Kb region that is homologous to a DNA sequence (right wing) spanning a portion of exon 2 and a continuous downstream sequence of the cpa5 gene. These sequences are designed to target the cpa5 gene and replace the region of the genome between the left and right wings with the inserted cassette sequence. Using methods known to those skilled in the art, these inserted sequences include an expression cassette of the phospholipase CRC08319 zymogen coding sequence of a phospholipase under the control of a cbh1 promoter and terminator sequence, and have a signal sequence from Trichoderma pep1, which contains an intron from Trichoderma gla1 and an engineered Trichoderma sdi1 selection marker that can confer resistance to the fungicide carboxin.

[1065] Expression cassette design is basically the same as Figure 8 The same as shown in , except for two changes: 1) the upstream and downstream homology regions of the cpa5 locus are used instead of the regions of locus A, and 2) the sd1 marker is used instead of the amdS marker. The relevant biological parts are listed in Table 16 along with the corresponding SEQ IDs. This cassette can be constructed by those skilled in the art based on the disclosed information and / or commercially synthesized (e.g., GeneArt, IDT).

[1066] Table 16: Portions of the cpa5 targeting cassette with the CRC08319 phospholipase expression cassette

[1067]

[1068] The cpa5 targeting cassette was used to co-transform strain AWG09 (Trichoderma strain generated in Example 22) along with the assembled Cas9 nuclease and synthetic guide RNAs (sgRNA, SEQ ID Nos: 65 and 66) targeting the cpa5 locus. These Cas9-sgRNA complexes were assembled in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma as generally described in PCT Publication No. WO / 2016 / 100568. Protoplasts of strain AWG09 were transformed using approximately ten (10) μg of purified cpa5 targeting cassette DNA and the assembled Cas9-sgRNA complexes. Transformation was performed using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol. Transformants were grown on Vogel minimal medium agar plates with 150 ug / ml carboxin to select for acquisition of the sd1 marker.

[1069] Stable transformants were isolated, propagated, and then screened by PCR for targeted integration at the cpa5 locus by homologous recombination. Homologous integration of the cpa5 disruption cassette at the cpa5 locus was verified by amplifying a DNA fragment of the expected size using two primer pairs. Primer pair RPG2641 and RPG2594 amplified a DNA fragment starting outside the 5′ end of the disruption cassette region and ending within the selection marker.

[1070] RPG2641cgtccctcaaggagtcgtttggc(SEQ ID NO:77)

[1071] RPG2594gagcctgtaccgctgcctcaccattctcaactgcacgcgg(SEQ ID NO:78)

[1072] Primer pair RPG2642 and RPG2537 amplified a DNA fragment that began within the selectable marker of the disruption cassette and ended outside the 3' end of the disruption cassette region.

[1073] RPG2642cgcgtagagccgatagcgaagaat(SEQ ID NO:79)

[1074] RPG2537cgggaatgagtgcctgctactgc(SEQ ID NO:80)

[1075] The resulting strain with confirmed homologous integration of the cpa5 disruption cassette was named BAH83.

[1076] 3. Knockout of proteases amp1, slp3, slp6 and Tr22210

[1077] Here, the cpa5-deleted strain BAH83 was co-transformed with the ALS selection marker and Cas9-sgRNA complexes targeting four protease loci.

[1078] A DNA fragment containing an als tag (SEQ ID NO: 81) was used to co-transform strain BAH83 with assembled Cas9 nuclease and synthetic guide RNAs (SEQ ID NOs: 82-89) targeting amp1 (JGIPID 81070), slp3 (JGIPID 123234), slp6 (JGIPID 121495), and Tr22210 (JGIPID 22210) loci. These Cas9-sgRNA complexes were assembled in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma as generally described in PCT Publication No. WO / 2016 / 100568. Approximately ten (10) μg of purified als-tagged DNA and assembled Cas9-sgRNA complexes were used to transform protoplasts of strain BAH83. Transformation was performed using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol.

[1079] Transformants were selected for resistance to the herbicide chlorimuron-methyl. The amplicon spanning the paired cas9-RNP target site was then amplified by PCR, and transformants were screened for mutation events at the targeted locus by PCR. Table 17 lists the primers used to screen transformants. The selected transformant named BBR87 was selected for additional protease deletions, which showed mutation events at all four loci by PCR and whole genome sequencing analysis.

[1080] Table 17: Primers used to screen BAH83 transformants

[1081] Primers sequence Locus SEQ ID NO RPG2732 cagtgcagcggaatgacgtgc amp1 90 RPG2733 cctccgggtcggtgttgtagatga amp1 91 RPG2736 ctccttgttcccactaccaagcacg slp3 92 RPG2737 ggccgttgccatcagtgttctg slp3 93 RPG2738 ccgctggtggagatcatgtcgac slp6 94 RPG2739 aggccgacaacgtgaggagtg slp6 95 RPG2740 gcaagtcccatcggcattcaatacca Tr22210 96 RPG2741 gcacgagctgccagagttggt Tr22210 97

[1082] 4. Knockout of proteases pep2 and sed2

[1083] Here, the 5-protease knockout strain BBR87 was co-transformed with the sucA selection marker and Cas9-sgRNA complexes targeting two additional proteases, pep2 and sed2, and the cpa5 locus to remove the CRC08319 expression cassette and the sdi1 selection marker.

[1084] A DNA fragment containing a sucA marker (SEQ ID NO: 98) was used to co-transform strain BBR87 with the assembled Cas9 nuclease and synthetic guide RNAs targeting pep2 (JGIPID 53961), sed2 (JGIPID 70962), and cpa5 loci (SEQ ID NO: 99 to 104). These Cas9-sgRNA complexes were assembled in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma. Protoplasts of strain BBR87 were transformed using approximately ten (10) μg of purified sdi1-tagged DNA and assembled Cas9-sgRNA complexes. Transformation was performed using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol.

[1085] Transformants were selected on Vogel minimal medium with sucrose as the sole carbon source. The amplicon across the paired cas9-RNP target site was then amplified by PCR, and transformants were screened for mutation events at the targeted locus by PCR. Table 18 lists the primers used to screen transformants. The selected transformant named BBX71 was selected for additional protease deletions, which showed mutation events at all three loci by PCR and full genome sequencing analysis.

[1086] Table 18: Primers used for analysis of BBR87 transformants

[1087] Primers sequence Locus SEQ ID NO RPG2752 tcacgcatggaacaacaacgcttc cpa5 109 RPG2618 tgccagagcctcatcaagaactgc cpa5 110 RPG2734 cccgtccaagagcacatcttcca pep2 111 RPG2735 gacggctgaataccgccaaaacac pep2 112 RPG2742 tggttgatctgttcgcgcctagc sed2 113 RPG2743 ggcccggtagatgatggaatgttgg sed2 114

[1088] 5. Integration of the BASI expression cassette at the gef1 locus

[1089] Here, the 7-protease knockout strain BBX71 was co-transformed with an expression cassette of BASI containing the sdi1 selection marker and a Cas9-sgRNA complex targeting the gef1 (JGIPID 120482) locus.

[1090] An expression cassette for barley alpha-amylase subtilisin inhibitor (BASI) was developed to overexpress BASI in Trichoderma that is almost identical to the cassette in Example 24, except that the catalytically inactive Cbh1_core with a linker (SEQ ID NO: 70) was replaced with an active catalytic core and linker (SEQ ID NO: 105) and the selection marker (SEQ ID NO: 51) was replaced with an sdil marker (SEQ ID NO: 106). In addition, homology regions (SEQ ID NOs: 67 and 68) were excluded. The relevant biological parts of the cassette are listed in Table 19 in the order in which they are found in the cassette, along with the corresponding SEQ IDs. This cassette can be constructed by one skilled in the art based on the disclosed information and / or commercially synthesized (e.g., GeneArt, IDT).

[1091] Table 19: Part of the BASI expression cassette

[1092] part Function Seq ID CBH2 promoter Promotes transcription of BASI mRNA 69 CBH1 catalytic core and linker Promote the secretion of BASI 105 Kexin site Promotes proteolytic cleavage of fusion proteins and release of BASI 71 Codon-optimized BASI BASI coding sequence 55 trpC terminator Promotes termination of mRNA transcription 72 sdi1 selection marker For the isolation of transformants by resistance to carboxin 106

[1093] This BASI expression cassette and the sd1 marker alone were used to co-transform strain BBX71 along with the assembled Cas9 nuclease and synthetic guide RNAs targeting the gef1 locus (SEQ ID NOs: 107 and 108). These Cas9-sgRNA complexes were assembled in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma as generally described in PCT Publication No. WO / 2016 / 100568. Protoplasts of strain BBX71 were transformed using approximately ten (10) μg of purified BASI expression cassette DNA and assembled Cas9-sgRNA complexes. In a separate transformation, protoplasts of strain BBX71 were transformed using approximately five (5) μg of purified sd1 selection marker DNA (SEQ ID NO: 106) and assembled Cas9-sgRNA complexes. Transformation was performed using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol.

[1094] Transformants were selected on Vogel minimal medium agar plates with 150 ug / ml of the agricultural fungicide carboxin to select for the acquisition of the sd1 marker. Transformants were isolated onto selective media and then screened for phospholipase, Cbh1_core and BASI expression by SDS-PAGE analysis in microtiter plates, essentially as described in Example 22. Four independent transformants showing phospholipase, Cbh1_core and BASI expression were selected for evaluation of CRC08319 stability. Four random isolates with only the sd1 selectable marker targeted to the gef1 locus were analyzed in parallel to control for the effect of gef1 destruction.

[1095] 6. Stability of recombinant CRC08319 expressed by a T. reesei protease knockout strain with and without co-expression of recombinant BASI

[1096] The following strains were evaluated in srMTP fermentation: BBX71, a phospholipase negative control strain; 4 independent BBX71 transformants with only the sd1 selection marker at the gef1 locus; and 4 independent BBX71 transformants in which the BASI expression cassette and the sd1 selection marker were targeted for integration at the gef1 locus. srMTP fermentation and subsequent phosphatidylcholine activity assays were performed essentially as described in Example 22 herein.

[1097] result

[1098] like Fig.11As shown, transformants expressing BASI ("BASI") had an average of 6% higher residual phospholipase activity (0.56 vs. 0.53 residual activity) after two days of incubation at 33°C compared to transformants with only the sdi1 marker integrated at the gef1 locus ("marker only"). Surprisingly, integration of the marker only at the gef1 locus increased the residual phospholipase activity by 26% under the same conditions compared to the BBX71 parent ("BBX71", 0.53 vs. 0.42 residual activity).

[1099] Example 26: Mature form of phospholipase

[1100] According to one aspect of the present invention, as shown in Table 20, active fragments of other phospholipases were also observed.

[1101] Table 20. Mature forms of phospholipases

[1102]

[1103]

[1104] Example 27. Baking experiment to test the effect of application of mature active fragment of phospholipase CRC08319.

[1105] In this experiment, the mature active fragment of CRC08319 phospholipase was tested at increasing doses in a crusty roll experimental setting to show application performance.Crusty roll baking was performed as described above for 'Crusty rolls' in the 'Assays and methods' section.

[1106] Table 21 and Fig.12 The experimental setup of the applied trials and the results from the baking evaluation are presented respectively.

[1107] Table 21. Experimental setup for enzyme dose-response testing in crusty roll baking.

[1108] Crusty bread roll baking in a constant crusty bread roll matrix including a dose-response of the mature active fragment of phospholipase CRC08319.

[1109]

[1110] Fig.12 Shown is a dose-response study of CRC08319 mature active fragment in a crusty bread roll application measuring specific volume after two proofing times of 45 and 60 min. Phospholipase CRC08319 mature active fragment was tested in a constant crusty bread roll matrix, wherein the lowest dose was given as 1, and the other doses were doubled relative to the lowest dose tested. Increasing the dose of phospholipase CRC08319 mature active fragment showed a continuous increase in specific volume.

[1111] Example 28. Experimental setup for xylanase response testing in crusty bread rolls with CRC08319 + POWERBake 4080 combination

[1112] In this experiment, xylanase Bs3 (listed as SEQ ID NO: 118 and as 950, sold by Dupont Nutrition Bioscience (Dupont Nutrition Bioscience, Denmark) to show the supplementation volume response in combination with 'non-lysophospholipases' CRC08319 and POWERBake 4080.

[1113] Crusty roll baking was performed as described above for 'Crusty rolls' in the 'Assays and methods' section.

[1114] Table 22 and Fig.13 The experimental setup of the applied trials and the results from the baking evaluation are presented respectively.

[1115] Table 22. Experimental setup for testing of xylanase response in crusty roll baking.

[1116] Crusty bread roll baking, including phospholipase CRC08319 mature active fragment and POWERBake 4080, with and without xylanase Bs3 (listed as SEQ ID NO: 118 and as product 950 sold).

[1117]

[1118] Fig.13 The volume response of xylanase Bs3 in combination with CRC08319 mature active fragment and POWERBake 4080 in a crusty roll application measuring specific volume is shown.

[1119] Phospholipase CRC08319 mature active fragment was used in combination with POWERBake 4080. Figure 1 The dosage provided in indicates that the dosage of the mature active fragment of phospholipase CRC08319 used is x5.4.

[1120] The combination of xylanase with CRC08319+POWERBake 4080 was observed to have a complementary positive effect as seen by the increase in specific volume of xylanase Bs3 on top of CRC08319+POWERBake 4080 in the crusty rolls.

[1121] Example 29. Experimental setup for xylanase response testing in Tweedy white toast application with CRC08319 + POWERBake 4080 combination

[1122] In this experiment, xylanase Bs3 (listed as SEQ ID NO: 118 and as product 950, DuPont Nutritional Biosciences, Denmark) to show the volume response of supplementation in combination with the ‘non-lysophospholipase’ CRC08319 and POWERBake 4080.

[1123] Tweedy White Toast baking was performed according to the 'Tweedy White Toast' description presented in the 'Assays and Methods' section above.

[1124] Table 23 and Fig.14 The experimental setup of the applied trials and the results from the baking evaluation are presented respectively.

[1125] Table 23. Experimental setup for testing of xylanase response in white toast baking.

[1126] Tweedy white toast baked, including phospholipase CRC08319 mature active fragment and POWERBake 4080, with and without xylanase Bs3 (listed as SEQ ID NO: 118 and as product 950 sold).

[1127]

[1128] Fig.14 Shown is the volumetric response of xylanase Bs3 in combination with CRC08319 mature active fragment and POWERBake 4080 in a Tweedy white toast application measuring unshocked and shaken specific volumes.

[1129] Phospholipase CRC08319 mature active fragment was used in combination with POWERBake 4080. Figure 1 The dosage provided in indicates that the dosage of the mature active fragment of phospholipase CRC08319 used is x5.9.

[1130] The combination of xylanase with CRC08319+POWERBake 4080 was observed to have a complementary positive effect as seen by the increase in specific volume (shaken and unshaken) of xylanase Bs3 on top of CRC08319+POWERBake 4080 in Tweedy White Toast.

[1131] Example 30. Experimental setup of glucose oxidase response test in Tweedy white toast application with CRC08319+POWERBake4080 combination

[1132] In this experiment, glucose oxidase GOX (listed as SEQ ID NO: 117 and as S 860 sold by DuPont Nutritional Biosciences, Denmark) to show the supplementation volume response in combination with the 'non-lysophospholipase' CRC08319 and POWERBake 4080.

[1133] Tweedy White Toast baking was performed according to the 'Tweedy White Toast' description presented in the 'Assays and Methods' section above.

[1134] Table 24 and Fig.15 The experimental setup of the applied trials and the results from the baking evaluation are presented respectively.

[1135] Table 24. Experimental setup for testing of glucose oxidase response in white toast baking.

[1136] Tweedy white toast baked, including phospholipase CRC08319 mature active fragment and POWERBake 4080, with and without glucose oxidase GOX (listed as SEQ ID NO: 117 and as product S 860 for sale).

[1137]

[1138] Fig.15 Glucose oxidase GOX (listed as SEQ ID NO: 117 and as product S 860) in combination with CRC08319 mature active fragment and POWERBake 4080 in measuring the volumetric response of the Tweedy white toast application with unshocked and shaken specific volumes.

[1139] Phospholipase CRC08319 mature active fragment was used in combination with POWERBake 4080. Figure 1 The dosage provided in indicates that the dosage of the mature active fragment of phospholipase CRC08319 used is x5.9.

[1140] The combination of glucose oxidase and CRC08319+POWERBake 4080 was observed to have a complementary positive effect as seen by the increase in specific volume (shaken and unshaken) of glucose oxidase GOX on top of CRC08319+POWERBake 4080 in Tweedy White Toast.

[1141] Example 31. Experimental setup for hexose oxidase response test in Tweedy white toast application with CRC08319+POWERBake 4080 combination

[1142] In this experiment, the hexose oxidase HOX (listed as SEQ ID NO: 116 and as product SUREBake 800 (sold by DuPont Nutritional Biosciences, Denmark) was used to show the volume response of supplementation in combination with the ‘non-lysophospholipase’ CRC08319 and POWERBake 4080.

[1143] Tweedy White Toast baking was performed according to the 'Tweedy White Toast' description presented in the 'Assays and Methods' section above.

[1144] Table 25 and Fig.16 The experimental setup of the applied trials and the results from the baking evaluation are presented respectively.

[1145] Table 25. Experimental setup for testing of hexose oxidase response in Tweedy white toast baking.

[1146] Tweedy white toast baked, including phospholipase CRC08319 mature active fragment and POWERBake 4080, with and without hexose oxidase HOX (listed as SEQ ID NO: 116 and as product SUREBake800 for sale).

[1147]

[1148] Fig.16 Hexose oxidase HOX (listed as SEQ ID NO: 116 and as product SUREBake 800 (sold as SUREBake 800) was combined with CRC08319 mature active fragment and POWERBake 4080 in a Tweedy white toast application measuring the volumetric response of unshocked and shaken specific volumes.

[1149] Phospholipase CRC08319 mature active fragment was used in combination with POWERBake 4080. Figure 1The dosage provided in indicates that the dosage of the mature active fragment of phospholipase CRC08319 used is x5.9.

[1150] The combination of hexose oxidase with CRC08319+POWERBake 4080 was observed to have a complementary positive effect as seen by the increase in specific volume (shaken and unshaken) of hexose oxidase HOX on top of CRC08319+POWERBake 4080 in Tweedy White Toast.

[1151] Example 32. Experimental analysis of the effect of CRC08319 and amylase on gelatinization temperature using RVA analysis

[1152] RVA analysis was performed according to the RVA analysis in the Assays and Methods section, including CRC08319, with and without different amylases (NBA, VERON MAXIMA, WAAA245, WAAA249, and SAS3).

[1153] Table 26. Experimental setup for testing of amylase response in RVA analysis.

[1154] RVA (Rapid Visco Analyzer) analysis, including phospholipase CRC08319 mature active fragments without and with different amylases - NBA (listed as SEQ ID NO: 120 and used as product Bread 8100, DuPont Nutrition Biosciences, Denmark), VERON MAXIMA (listed as SEQ ID NO: 122 and as product MAXIMA, sold by AB Enzymes), WAAA245 (listed as SEQ ID NO: 123), WAAA249 (listed as SEQ ID NO: 119), or SAS3 (listed as SEQ ID NO: 121 and sold as product CAPTIVE TS-E 1514 (sold by DuPont Nutritional Biosciences, Denmark).

[1155] Relative to Example 19 Figure 1 The dosage provided in indicates that the dosage of the mature active fragment of phospholipase CRC08319 used is x7.9.

[1156] Doses of WAAA245 and WAAA249 are presented relative to Bread8100's dose of dose.

[1157] Dose correlation is based on activity units / kg flour, where enzyme activity is measured using blocked p-nitrophenyl-α-D-maltoheptaglycoside (Megazyme, α-amylase reagent (Ceralpha), product code: R-CAAR4, substrate preparation according to the manufacturer's instructions). Activity assays were run at pH 5.6 (malate buffer), 30°C for 5 min.

[1158] Will The activity of Bread 8100, 250 ppm was defined as 1, and the doses of WAAA245 and WAAA249 are presented relative to it.

[1159]

[1160] # Doses expressed as relative doses based on activity measured using blocked p-nitrophenyl-α-D-maltoheptaglycoside (Megazyme, α-amylase reagent (Ceralpha), product code: R-CAAR4, substrate preparation according to manufacturer's instructions). The assay was run at pH 5.6 (malate buffer), 30°C for 5 min. The activity of Bread 8100, 250 ppm was defined as 1, and the doses of WAAA245 and WAAA249 are presented relative to it.

[1161] Fig.17 The gelatinization temperatures of RVA samples containing CRC08319 in combination with different amylases are shown. CRC08319 alone provided higher gelatinization temperatures compared to the control dough. Surprisingly, even higher gelatinization temperatures were observed when CRC08319 was combined with an amylase.

[1162] Although the foregoing invention has been described in detail by way of illustration and example for the purpose of clear understanding, certain changes and modifications may be implemented within the scope of the appended claims. In addition, each reference provided herein is incorporated by reference in its entirety for all purposes to the same extent as if each reference was incorporated individually by reference. To the extent that any reference (including website or accession number) may change over time, the effective version refers to the version effective on the date of filing of this application. Unless otherwise apparent from the context, any step, element, aspect, embodiment feature may be used in combination with any other.

Claims

1. An isolated polypeptide having phospholipase A1 activity, the isolated polypeptide comprising a protein sequence having at least 80% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:

45.

2. The isolated polypeptide of claim 1, comprising a protein sequence having at least 80% sequence identity to SEQ ID NO:

27.

3. The isolated polypeptide of claim 1, comprising a protein sequence having at least 90% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:

45.

4. The isolated polypeptide of claim 3, comprising a protein sequence having at least 90% sequence identity to SEQ ID NO:

27.

5. The isolated polypeptide of claim 3, comprising a protein sequence having at least 95% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:

45.

6. The isolated polypeptide of claim 5, comprising a protein sequence having at least 95% sequence identity to SEQ ID NO:

27.

7. An isolated polypeptide as described in claim 5, comprising a protein sequence having 100% sequence identity to SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 or SEQ ID NO:

45.

8. The isolated polypeptide of claim 7, comprising a protein sequence having 100% sequence identity to SEQ ID NO:

27.

9. A method of making dough, the method comprising mixing dough ingredients selected from the group consisting of flour, salt, water, sugar, fat, lecithin, oil emulsifier and yeast with the isolated polypeptide of any one of claims 1 to 8.

10. The method of making dough according to claim 9, further comprising adding at least one additional enzyme for improving the dough and / or the baked product made from the dough.

11. The method for making dough according to claim 10, wherein the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

12. The method of claim 11, wherein the amylase is an exoamylase.

13. The method of claim 12, wherein the exoamylase is a maltogenic amylase.

14. The method of claim 12, wherein the exoamylase is a non-maltogenic amylase.

15. The method of claim 14, wherein the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides comprising mainly four to eight D-glucopyranosyl units from the non-reducing ends of amylopectin side chains.

16. The method of claim 11, wherein the additional enzyme is a phospholipase.

17. The method of claim 16, wherein the phospholipase has galactolipase activity.

18. The method of claim 16 or 17, wherein the phospholipase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 17 and / or SEQ ID NO:

18.

19. A dough comprising the isolated polypeptide of any one of claims 1 to 8.

20. The dough of claim 19 having improved dough extensibility and / or stability.

21. The dough of claim 20, further comprising at least one additional enzyme for improving the dough and / or a baked product made from the dough.

22. The dough of claim 21, wherein the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX), or an oxidase.

23. The dough of claim 22, wherein the amylase is an exoamylase.

24. The dough of claim 23, wherein the exoamylase is a maltogenic amylase.

25. The dough of claim 23, wherein the exoamylase is a non-maltogenic amylase.

26. The dough of claim 25, wherein the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear malto-oligosaccharides comprising primarily four to eight D-glucopyranosyl units from the non-reducing ends of amylopectin side chains.

27. The dough of claim 22, wherein the additional enzyme is a phospholipase.

28. The dough of claim 27, wherein the phospholipase has galactolipase activity.

29. The dough of claim 27 or 28, wherein the phospholipase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 17 and / or SEQ ID NO:

18.

30. A method of preparing a baked product, the method comprising baking a dough as claimed in any one of claims 19 to 29.

31. A baked product obtainable by the method according to claim 30.

32. The baked product of claim 31 having at least one improved property selected from the group consisting of: improved crumb pore size, improved uniformity of gas bubbles, no separation between crust and crumb, increased volume, increased crust crispness, and Improved baking elasticity.

33. The baked product of claim 32, wherein the improved property is crust crispness.

34. A premix for baking, comprising flour and the isolated polypeptide of any one of claims 1 to 8.

35. The premix of claim 34, further comprising at least one additional enzyme for improving the dough and / or the baked product made from the dough.

36. The premix of claim 35, wherein the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX), or an oxidase.

37. The premix of claim 36, wherein the amylase is an exoamylase.

38. The premix of claim 37, wherein the exoamylase is a maltogenic amylase.

39. The premix of claim 37, wherein the exoamylase is a non-maltogenic amylase.

40. The premix of claim 39, wherein the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides comprising predominantly four to eight D-glucopyranosyl units from the non-reducing ends of amylopectin side chains.

41. The premix of claim 36, wherein the additional enzyme is a phospholipase.

42. The premix of claim 41, wherein the phospholipase has galactolipase activity.

43. The premix of claim 41 or 42, wherein the phospholipase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 17 and / or SEQ ID NO:

18.

44. A baking improver comprising granules or agglomerated powder containing the isolated polypeptide according to any one of claims 1 to 9.

45. The baking improver according to claim 44, further comprising at least one additional enzyme for improving dough and / or baked products made from said dough.

46. ​​The baking improver according to claim 45, wherein the additional enzyme is one or more of an amylase, a cyclodextrin glucanotransferase, a peptidase, a transglutaminase, a lipase, a galactolipase, a phospholipase different from the phospholipase A1, a cellulase, a hemicellulase, a protease, a protein disulfide isomerase, a glycosyltransferase, a peroxidase, a lipoxygenase, a laccase, a xylanase, a glucose oxidase (GOX), a hexose oxidase (HOX) or an oxidase.

47. The baking improver of claim 46, wherein the amylase is an exoamylase.

48. The baking improver according to claim 47, wherein the exoamylase is a maltogenic amylase.

49. The baking improver of claim 47, wherein the exoamylase is a non-maltogenic amylase.

50. The baking improver according to claim 49, wherein the non-maltogenic amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides from the non-reducing ends of the amylopectin side chains, the one or more linear maltooligosaccharides comprising mainly four to eight D-pyranoglucopyranosyl units.

51. The baking improver of claim 46, wherein the additional enzyme is a phospholipase.

52. The baking improver of claim 51, wherein the phospholipase has galactolipase activity.

53. The baking improver according to claim 51 or 52, wherein the phospholipase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 17 and / or SEQ ID NO:

18.

54. An isolated polynucleotide comprising a nucleic acid sequence encoding the isolated polypeptide of any one of claims 1 to 8.

55. A recombinant expression vector comprising the polynucleotide of claim 54. A host cell comprising the recombinant expression vector of claim 55 .

57. A method of modifying a phospholipid emulsifier, the method comprising treating the emulsifier with an enzyme comprising the isolated polypeptide of any one of claims 1 to 8.

58. The method of claim 57, wherein the phospholipid emulsifier is lecithin or lysolecithin.

59. A method for producing lysophospholipids in a lipid-containing food matrix, the method comprising adding to the lipid-containing food matrix an isolated polypeptide as claimed in any one of claims 1 to 8.

60. The method for producing lysophospholipids in a lipid-containing food matrix as claimed in claim 59, wherein the lipid-containing food matrix is ​​selected from the group consisting of eggs and food products containing eggs, dough for baked desserts, processed meats, milk-based products, and vegetable oils.

61. A recombinant cell comprising a) a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide; and b) a heterologously expressed protein.

62. The recombinant cell of claim 61, wherein the heterologously expressed protein comprises an aminopeptidase, an α-amylase, an arabinanase, an arabinofuranosidase, a carbohydrase, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a cyclodextrin glycosyltransferase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an α-galactosidase, a β-galactosidase, a glucose oxidase (GOX), an α-glucosidase, a β-glucosidase, a glucose uronidase, glycosyltransferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase.

63. The recombinant cell of claim 62, wherein the heterologously expressed protein is a phospholipase.

64. The recombinant cell of claim 63, wherein the phospholipase comprises an isolated polypeptide as described in any one of claims 1 to 8.

65. The recombinant cell of any one of claims 61 to 64, wherein the cell is a bacterial, fungal, yeast, plant, or mammalian cell.

66. The recombinant cell of claim 65, wherein the cell is a Trichoderma, Aspergillus, Bacillus, or Myceliophthera.

67. The recombinant cell of claim 66, wherein the cell is Trichoderma reesei.

68. The recombinant cell of claim 66, wherein the cell is Aspergillus niger or Aspergillus oryzae.

69. The recombinant cell of claim 66, wherein the cell is Bacillus subtilis or Bacillus licheniformis.

70. The recombinant cell of any one of claims 61 to 69, wherein the BASI polypeptide comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

58.

71. A fermentation broth comprising the cells of any one of claims 61 to 70.

72. A method for reducing proteolysis of a heterologously expressed protein, the method comprising culturing a recombinant cell under conditions suitable for production of the heterologously expressed protein and a heterologously expressed barley alpha-amylase subtilisin inhibitor (BASI) polypeptide, the recombinant cell comprising a) the BASI polypeptide; and b) the heterologously expressed protein.

73. The method of claim 72, further comprising isolating the heterologous protein.

74. The method of claim 72 or 73, wherein the heterologously expressed proteins comprise aminopeptidases, α-amylases, arabinanases, arabinofuranosidases, carbohydrases, carboxypeptidases, catalases, cellobiohydrolases, cellulases, cyclodextrin glycosyltransferases, cyclodextrin glycosyltransferases, deoxyribonucleases, endoglucanases, α-galactosidases, β-galactosidases, glucose oxidase (GOX), α-glucosidases, β-glucosidases, glucose uronidase, glycosyltransferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenoloxidase, polyphenoloxidase, protein disulfide isomerase, proteolytic enzyme, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase.

75. The method of claim 74, wherein the heterologously expressed protein is a phospholipase.

76. The method of claim 70, wherein the phospholipase comprises an isolated polypeptide as described in any one of claims 1 to 8.

77. The method of any one of claims 72 to 76, wherein the cell is a bacterial, fungal, yeast, plant, or mammalian cell.

78. The method of claim 77, wherein the cell is a Trichoderma, Aspergillus, Bacillus, or Myceliophthora.

79. The method of claim 78, wherein the cell is Trichoderma reesei.

80. The method of claim 78, wherein the cell is Aspergillus niger or Aspergillus oryzae.

81. The method of claim 78, wherein the cell is Bacillus subtilis or Bacillus licheniformis.

82. The method of any one of claims 72 to 81, wherein the BASI polypeptide comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

58.

83. A method for reducing proteolysis of a recombinantly expressed protein, the method comprising isolating the recombinantly expressed protein in the presence of an exogenously added barley alpha-amylase subtilisin inhibitor (BASI) polypeptide.

84. The method of claim 83, wherein the heterologously expressed proteins include aminopeptidases, α-amylases, arabinanases, arabinofuranosidases, carbohydrases, carboxypeptidases, catalases, cellobiohydrolases, cellulases, cyclodextrin glycosyltransferases, cyclodextrin glycosyltransferases, deoxyribonucleases, endoglucanases, α-galactosidases, β-galactosidases, glucose oxidase (GOX), α-glucosidases, β-glucosidases, glucose A glycosidase, a glycosyltransferase, a hemicellulase, a hexose oxidase (HOX), an invertase, an isomerase, a laccase, a ligase, a lipase, a lipoxygenase, a mannanase, a mannosidase, a peroxidase, a phospholipase, a galactolipase, an oxidase, a phytase, a phenoloxidase, a polyphenoloxidase, a protein disulfide isomerase, a proteolytic enzyme, a ribonuclease, an α-1,6-transglucosidase, a transglutaminase, a urokinase, a xylanase, or a β-xylosidase.

85. The method of claim 84, wherein the heterologously expressed protein is a phospholipase.

86. The method of claim 84, wherein the phospholipase comprises an isolated polypeptide as described in any one of claims 1 to 8.

87. The method of any one of claims 83 to 86, wherein the cell is a bacterial, fungal, yeast, plant, or mammalian cell.

88. The method of claim 87, wherein the cell is a Trichoderma, Aspergillus, Bacillus, or Myceliophthora.

89. The method of claim 88, wherein the cell is Trichoderma reesei.

90. The method of claim 88, wherein the cell is Aspergillus niger or Aspergillus oryzae.

91. The method of claim 88, wherein the cell is Bacillus subtilis or Bacillus licheniformis.

92. The method of any one of claims 83 to 91, wherein the BASI polypeptide comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

58.

93. The recombinant cell of claim 66, wherein the cell is Myceliophthora thermomophila.

94. The method of claim 78, wherein the cell is Myceliophthora thermophila.

95. The method of claim 88, wherein the cell is Myceliophthora thermophila.

96. The method of claim 11, wherein the amylase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:

123.

97. The method of claim 11, wherein the xylanase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

118.

98. The method of claim 11, wherein the glucose oxidase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

117.

99. The method of claim 11, wherein the hexose oxidase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

116.

100. The dough of claim 22, wherein the amylase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:

123.

101. The dough of claim 22, wherein the xylanase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

118.

102. The dough of claim 22, wherein the glucose oxidase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

117.

103. The dough of claim 22, wherein the hexose oxidase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

116.

104. The premix of claim 36, wherein the amylase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:

123.

105. The premix of claim 36, wherein the xylanase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

118.

106. The premix of claim 36, wherein the glucose oxidase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

117.

107. The premix of claim 36, wherein the hexose oxidase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

116.

108. The baking improver of claim 46, wherein the amylase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:

123.

109. The baking improver of claim 46, wherein the xylanase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

118.

110. The baking improver of claim 46, wherein the glucose oxidase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:

117.

111. The baking improver of claim 46, wherein the hexose oxidase comprises a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 116.

Images