Enzyme electrode, reduction device, reduction method, modified protein, and method for producing modified protein

Abstract

The present disclosure provides an enzyme electrode or the like in which an enzyme is immobilized by more appropriate binding. An enzyme electrode according to the present disclosure is provided with an electrode and a modified protein having an amino acid sequence in which at least one lysine residue in a fusion protein of thioredoxin reductase and thioredoxin is replaced with another amino acid residue, wherein the modified protein is immobilized on the surface of the electrode.

Description

Technical Field

[0001] The present disclosure relates to an enzyme electrode, a reduction device, a reduction method, a modified protein, and a method for producing the modified protein. Background Art

[0002] As a method for immobilizing an enzyme on an electrode, there is a method for immobilizing an enzyme on an electrode surface by chemical bonding. For example, Patent Document 1 discloses a method for immobilizing a protein on a metal substrate surface by connecting a peptide having metal binding ability as a binding agent to a protein.

[0003] In addition, thioredoxin in a reduced state reduces the disulfide bonds of a target protein to cause structural changes, thereby changing the properties of the protein. For example, Patent Document 2 discloses a method for inactivating allergens by converting oxidized thioredoxin to a reduced form through activation of thioredoxin reductase using electrons supplied from an electrode, thereby continuously reducing the disulfide bonds of an allergen.

[0004] Prior art literature

[0005] Patent Literature

[0006] Patent Document 1: Japanese Patent Application Publication No. 2017-37014

[0007] Patent Document 2: International Publication No. 2021 / 261511

[0008] Summary of the invention

[0009] Problems to be solved by the invention

[0010] However, since the side chain of a certain amino acid originally contained in the amino acid constituting the enzyme can form a covalent bond with other molecules, the enzyme can be used in the immobilization of the enzyme to the electrode. However, when the amino acid constituting the enzyme is used for the immobilization of the electrode, sometimes an appropriate bond cannot be formed.

[0011] Therefore, the present disclosure provides an enzyme electrode and the like in which an enzyme is immobilized by more appropriate bonding.

[0012] Means for solving problems

[0013] An enzyme electrode according to one embodiment of the present disclosure comprises an electrode and a modified protein having an amino acid sequence in which at least one lysine residue in a fusion protein of thioredoxin reductase and thioredoxin is replaced with another amino acid residue, wherein the modified protein is immobilized on the surface of the electrode.

[0014] In addition, a reduction device according to one aspect of the present disclosure includes the enzyme electrode described above and a power source for applying a voltage to the electrode, and reduces the target molecule by bringing a sample containing a target molecule into contact with the enzyme electrode and applying a voltage to the electrode.

[0015] In addition, a reduction method according to one embodiment of the present disclosure is to bring a sample that may contain a target molecule into contact with the enzyme electrode described above, and reduce the target molecule while applying a voltage to the electrode.

[0016] In addition, an engineered protein according to one embodiment of the present disclosure has an amino acid sequence in which at least one lysine residue in a fusion protein of thioredoxin reductase and thioredoxin is replaced with another amino acid residue.

[0017] In a method for producing a modified protein according to one embodiment of the present disclosure, a fusion protein of thioredoxin reductase and thioredoxin is prepared, and at least one lysine residue in the fusion protein is replaced with another amino acid residue.

[0018] Effects of the Invention

[0019] According to the present disclosure, it is possible to provide an enzyme electrode or the like in which an enzyme is immobilized by more appropriate bonding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a diagram showing an example of the configuration of the allergen inactivating device according to the embodiment.

[0021] Figure 2 This is a block diagram showing an example of the functional configuration of the allergen inactivating device according to the embodiment.

[0022] Figure 3 This is a diagram for explaining the mechanism of the reducing action of the fusion protein according to the embodiment.

[0023] Figure 4 This is a flowchart showing a method for producing a fusion protein according to an embodiment.

[0024] Figure 5 This is a conceptual diagram of an expression vector for a fusion protein according to an embodiment.

[0025] Figure 6 This is a conceptual diagram of a fusion protein according to an embodiment.

[0026] Figure 7 It is a diagram showing the amino acid sequence of the fusion protein involved in the embodiment.

[0027] Figure 8This is a flowchart showing an example of the operation of the allergen inactivating device according to the embodiment.

[0028] Fig. 9 This is a graph showing the results of decomposition of the allergen according to Example 1.

[0029] Fig.10 This is a graph showing the results of decomposition of the allergen according to Example 2.

[0030] Fig.11 This is a graph showing the results of decomposition of allergens according to Example 3.

[0031] Fig.12 It is a figure which shows the decomposition result of the allergen which concerns on a comparative example. DETAILED DESCRIPTION

[0032] (Reaching the understanding of this disclosure)

[0033] In order to reduce and cut the disulfide bonds of the target molecule using the electrons provided by the electrode, it is necessary to be able to accept the electrons provided by the electrode and use the electrons as reducing force to cut the disulfide bonds of the target molecule. As such a molecular species, it is known that a combination of enzymes and proteins such as thioredoxin reductase (i.e., thioredoxin reductase) and thioredoxin can be used. Thioredoxin can change between two states of oxidation and reduction. In addition, the reduced thioredoxin has the function of cutting the disulfide bonds of the target molecule. The thioredoxin with the disulfide bonds cut is oxidized in exchange for the cutting of the disulfide bonds and is converted into oxidized thioredoxin.

[0034] Thioredoxin reductase has the function of reducing oxidized thioredoxin using electrons to convert it into reduced thioredoxin. Therefore, if electrons from an electrode can be supplied to thioredoxin reductase, oxidized thioredoxin can be converted into reduced thioredoxin. That is, the following cycle can be turned over: the disulfide bond of the target molecule is cut, the oxidized thioredoxin is converted into the reduced form, and the disulfide bond of the target molecule is cut again.

[0035] It is also known that thioredoxin reductase has difficulty in directly accepting electrons from an electrode and generally requires the presence of an electron mediator called an electron transfer mediator (or simply a mediator).

[0036] On the other hand, there is also a use of cutting disulfide bonds of allergens (causative substances that trigger allergic reactions) contained in food by utilizing the function of thioredoxin to cut disulfide bonds. If the disulfide bonds of the allergens can be cut, the three-dimensional structure of the allergens changes or becomes easy to change, so that allergic reactions may become less likely to occur. That is, the development of a technology to produce food that contains allergens but is less likely to trigger allergic reactions by cutting disulfide bonds has been carried out. As allergens, prolamin, ovalbumin, β-lactoglobulin, etc. are representative, but the above technology can be effectively applied to all allergens, not limited to these, especially allergens with disulfide bonds present near the molecular surface.

[0037] For the food produced in the above process, thioredoxin and thioredoxin reductase can be immobilized on the electrode so as not to be mixed into the food. In addition, the same is true for the medium. When such an enzyme or protein (hereinafter collectively referred to as protein) is immobilized on the electrode, the following method can be used: using the lysine residue contained in the amino acids constituting the protein, the amino group of the side chain of the lysine residue is amino-coupled with the carboxyl group provided on the electrode side to form a covalent bond, thereby immobilizing the protein on the electrode. However, sometimes a plurality of lysine residues are contained in the protein, and it is difficult to control which of them is amino-coupled.

[0038] Therefore, in the present disclosure, at least one lysine residue in a position that is not suitable for amino-coupling of the amino acids constituting the protein is replaced with other amino acids, and the replaced protein is used for immobilization on the electrode. Thus, since the orientation of the protein when immobilized on the electrode can be controlled, for example, the part of the protein that participates in the electron acceptance from the medium and the part that participates in the severance of the disulfide bond of the protein can be properly oriented. Thus, from the viewpoint of reaction efficiency, an enzyme electrode in which the enzyme is immobilized by more appropriate binding can be realized.

[0039] (Overview of the present disclosure)

[0040] A summary of the present disclosure is as follows.

[0041] The enzyme electrode according to the first aspect of the present disclosure comprises an electrode and a modified protein having an amino acid sequence in which at least one lysine residue in a fusion protein of thioredoxin reductase and thioredoxin is replaced with another amino acid residue, wherein the modified protein is immobilized on the surface of the electrode.

[0042] According to such an enzyme electrode, there is an advantage that it is easy to avoid a situation where the presence of the lysine residue replaced in the modified protein would cause an adverse effect such as inappropriate binding of the enzyme (the fusion protein of thioredoxin reductase and thioredoxin) if the lysine residue replaced in the modified protein is not replaced. Therefore, the enzyme can be immobilized by more appropriate binding with reduced adverse effects such as inappropriate binding of the enzyme.

[0043] In addition, the enzyme electrode according to the second aspect of the present disclosure is the enzyme electrode according to the first aspect, wherein the other amino acid residue is an arginine residue.

[0044] According to the present embodiment, since the lysine residue is replaced by an amino acid residue having properties relatively close to those of the lysine residue, the properties of the fusion protein are easily maintained in the modified protein after the replacement.

[0045] Furthermore, the enzyme electrode according to the third aspect of the present disclosure is the enzyme electrode according to the first or second aspect, wherein the side chain of at least one lysine residue is oriented outward on the surface of the fusion protein.

[0046] According to this embodiment, it is possible to replace a lysine residue that is highly likely to affect the immobilization of the fusion protein on the surface of the electrode.

[0047] In addition, the enzyme electrode involved in the fourth scheme of the present disclosure is an enzyme electrode described in any one of the first to third schemes, wherein the thioredoxin reductase is composed of a first subunit containing an active center involved in electron transfer and a second subunit different from the first subunit, and at least one lysine residue is included in the amino acid residues constituting the second subunit.

[0048] According to this embodiment, since the lysine residue included in the amino acid residues constituting the second subunit is replaced, it is easy to avoid the replacement of the lysine residue in the active center involved in electron transfer. Therefore, it has the advantage that the activity involved in electron transfer is easily maintained in the modified protein after replacement.

[0049] In addition, the enzyme electrode involved in the fifth scheme of the present disclosure is an enzyme electrode described in any one of the first to fourth schemes, wherein the fusion protein comprises a first lysine residue and a second lysine residue, the first lysine residue of the modified protein is replaced with other amino acid residues, and is immobilized on the surface of the electrode via the second lysine residue.

[0050] According to this embodiment, there are advantages such as being able to easily avoid a situation where the first lysine residue replaced in the modified protein, if not replaced, causes the enzyme binding to become inappropriate due to the presence of the first lysine residue. More specifically, it is easy to avoid a situation where the positional relationship between the fusion protein and the electrode surface becomes inappropriate and the efficiency of various reactions between the electrode surface and the fusion protein is reduced if the fusion protein is immobilized on the surface of the electrode at the position of the first lysine residue.

[0051] Furthermore, the enzyme electrode according to the sixth aspect of the present disclosure is the enzyme electrode according to the fifth aspect, wherein one of the second lysine residues is arranged on the side farther from thioredoxin in thioredoxin reductase.

[0052] According to this embodiment, the modified protein can be immobilized on the electrode surface at the side of thioredoxin reductase that is farther from thioredoxin.

[0053] Furthermore, the enzyme electrode according to the seventh aspect of the present disclosure is the enzyme electrode according to the fifth or sixth aspect, wherein one of the second lysine residues is arranged on the side closer to the active center involved in electron transfer in thioredoxin reductase.

[0054] According to this embodiment, the modified protein can be immobilized on the electrode surface at the side of thioredoxin reductase that is closer to the active center involved in electron transfer.

[0055] The reduction device according to the eighth aspect of the present disclosure comprises the enzyme electrode according to any one of the first to seventh aspects and a power source for applying a voltage to the electrode, and a sample containing a target molecule is brought into contact with the enzyme electrode, and the target molecule is reduced while applying a voltage to the electrode.

[0056] According to such a reduction device, it is possible to reduce the target molecule while achieving the same effects as the above-described enzyme electrode.

[0057] In the reduction method according to the ninth aspect of the present disclosure, a sample that may contain a target molecule is brought into contact with the enzyme electrode according to any one of the first to seventh aspects, and the target molecule is reduced while a voltage is applied to the electrode.

[0058] According to such a reduction method, the same effects as those of the reduction device described above can be achieved.

[0059] The modified protein according to the tenth aspect of the present disclosure has an amino acid sequence in which at least one lysine residue in a fusion protein of thioredoxin reductase and thioredoxin is replaced with another amino acid residue.

[0060] According to such a modified protein, a more appropriate bond can be formed when the protein is immobilized on the electrode surface in the enzyme electrode.

[0061] In the method for producing a modified protein according to the eleventh aspect of the present disclosure, a fusion protein of thioredoxin reductase and thioredoxin is prepared, and at least one lysine residue in the fusion protein is replaced with another amino acid residue.

[0062] According to such a method for producing a modified protein, it is possible to produce a modified protein that can form a more appropriate bond when immobilized on the electrode surface of an enzyme electrode.

[0063] In addition, these comprehensive or specific solutions can be implemented through systems, methods, devices, integrated circuits, computer programs, or computer-readable storage media such as CD-ROMs, or through any combination of systems, methods, devices, integrated circuits, computer programs, and storage media.

[0064] Hereinafter, embodiments will be described in detail with reference to the drawings.

[0065] In addition, the embodiments described below are all comprehensive or specific examples. The numerical values, shapes, materials, constituent elements, configuration positions and connection forms of constituent elements, steps, the order of steps, etc. shown in the following embodiments are examples and do not limit the subject matter of the claims. In addition, for the constituent elements in the following embodiments that are not recorded in the independent claims showing the highest concept, they are described as arbitrary constituent elements. In addition, the figures are not necessarily strictly illustrated. In each figure, the same symbols are attached to substantially the same structures, and repeated descriptions are sometimes omitted or simplified.

[0066] In the present disclosure, terms such as parallel and perpendicular indicating the relationship between elements, terms such as rectangle indicating the shape of elements, and numerical values ​​do not have strict meanings but include substantially equivalent ranges, for example, differences of several %.

[0067] In addition, in the drawings of the present disclosure, dotted lines indicate the boundaries of parts and regions that are not visible from the surface.

[0068] (Implementation Method)

[0069] For the following embodiments, refer to Figures 1 to 8 Provide specific instructions.

[0070] [Target molecule reduction device]

[0071] [1. Summary]

[0072] First, refer to Figure 1, an overview of the allergen inactivating device in the embodiment will be described. Figure 1 It is a diagram showing an example of the configuration of the allergen inactivating device according to the embodiment.

[0073] The allergen inactivation device 100a is a device that supplies electrons to a fusion protein (a modified protein after amino acid substitution, which will be described in detail later) that reduces and inactivates allergens, thereby repeatedly activating the fusion protein that has lost its reducing power, thereby continuously inactivating allergens. That is, the allergen inactivation device 100a is an example of a reducing device. The allergen inactivation device 100a controls the voltage applied to the electrode (working electrode 1a) by the power supply 20, thereby being able to adjust the movement speed and energy of the electrons supplied from the electrode (working electrode 1a) to the fusion protein.

[0074] In addition, as mentioned above, allergen is a component that induces allergic reaction (or, has allergic activity). Allergen has a site (specific binding site) that specifically binds to an antibody (e.g., IgE antibody) of a person suffering from an allergic disease. So-called allergen inactivation means that the allergenicity of the allergen is weakened, for example, refers to the specific binding site of the allergen that is difficult to recognize by changing the structure (e.g., interaction of amino acid residues) of the specific binding site of the allergen.

[0075] For example, the allergen that is the object of inactivation in the embodiment has a disulfide bond. The allergen with a disulfide bond is, for example, an allergenic protein. As shown above, a disulfide bond is a very strong bond and is not easily cut by heat, acid and enzymes (e.g., digestive enzymes of the stomach). Therefore, the allergen with a disulfide bond has a high possibility of causing an allergic reaction. When the allergen has a disulfide bond, the so-called allergen reduction is to reduce the disulfide bond of the allergen. In addition, the reduction of the allergen will be described in detail later.

[0076] [2. Composition]

[0077] Next, the configuration of the allergen inactivation device 100a according to the embodiment is described in detail. Figure 1 and Figure 2 Provide explanation. Figure 2 This is a block diagram showing an example of the functional configuration of the allergen inactivating device 100a according to the embodiment.

[0078] The allergen inactivation device 100a according to the embodiment includes an electrode (working electrode 1a) for supplying electrons to a fusion protein that reduces an allergen and thereby inactivates the allergen by application of voltage, a power source 20 for applying voltage to the electrode (working electrode 1a), and a control unit 30 for controlling the application of voltage by the power source 20. The electrode (hereinafter, also simply referred to as the working electrode 1a) for supplying electrons to the fusion protein is one component of the voltage application unit 10a.

[0079] [Voltage application unit]

[0080] The voltage applying unit 10a provides electrons to the fusion protein by an electrode (working electrode 1a). The voltage applying unit 10a is, for example, a three-electrode unit including a working electrode 1a, a reference electrode 2, a counter electrode 3, a cell 4, a cover 5, terminals 6a, 6b, 6c, and wires 7a, 7b, 7c. In addition, the voltage applying unit 10a may also be, for example, a two-electrode unit including a working electrode 1a and a counter electrode 3.

[0081] The working electrode 1a is an electrode that sensitively performs electrochemical response to trace components in the sample solution 9a on the electrode surface. Fusion proteins and mediators (described later) are immobilized on the working electrode 1a. The counter electrode 3 is an electrode that sets a potential difference with the working electrode 1a. The working electrode 1a and the counter electrode 3 are composed of conductive substances. As conductive substances, for example, carbon materials, conductive polymer materials, semiconductors, or metals can be used. For example, as carbon materials, carbon nanotubes, carbon fiber (registered trademark), glassy carbon, graphene, fullerene, carbon fibers (carbon fiber), carbon fabric (carbon fabric), or carbon aerogels can be used. In addition, for example, as conductive polymer materials, polyaniline, polyacetylene, polypyrrole, poly (3,4-ethylenedioxythiophene), poly (p-phenylene vinylene), polythiophene, or poly (p-phenylene sulfide)) can be used. In addition, for example, as a semiconductor, it can be organic silicon, germanium, indium tin oxide (ITO: Indium Tin Oxide), titanium oxide, copper oxide, or silver oxide. In addition, for example, as a metal, it can be gold, platinum, silver, titanium, aluminum, tungsten, copper, iron, or palladium. Here, the working electrode 1a is, for example, a glassy carbon electrode, and the counter electrode 3 is a platinum electrode. In addition, the conductive material is not particularly limited as long as it is a conductive material that is not decomposed by its own oxidation reaction.

[0082] The reference electrode 2 is an electrode that does not react with components in the sample solution 9a and maintains a constant potential, and is used to control the potential difference between the working electrode 1a and the reference electrode 2 to be constant by the power supply 20. Here, the reference electrode 2 is a silver / silver chloride electrode.

[0083] The cell 4 is a holding portion that holds a sample solution 9a in which the allergen exists. The sample solution 9a contains at least the allergen and is in contact with the working electrode 1a.

[0084] Here, refer to Figure 3 The mechanism of allergen reduction using fusion protein is described. Figure 3 This is a diagram for explaining the mechanism of the reduction effect of the fusion protein involved in the embodiment. The electron donation reaction is a reaction accompanied by electron donation, so-called redox reaction. If each component present in the reaction system accepts electrons, it is reduced, and if it provides electrons, it is oxidized. Therefore, each component has two forms: oxidized (ox) and reduced (red).

[0085] For example, Figure 3 As shown in Figure 1, allergens have a disulfide bond (-SS-). Examples of allergenic proteins having a disulfide bond (hereinafter also simply referred to as allergenic proteins) include foods such as beans, wheat, milk, seafood, eggs, and rice, pollen, animals, nematodes, filamentous fungi, molds, and mites, or animal hair, dandruff, and other animal allergens.

[0086] The disulfide bonds of the allergen are reduced to thiol groups (—SH) by the donation of electrons from the active FTR. Figure 3 In the figure, the portion (a) containing the disulfide bond of the allergen before reduction is schematically shown above the allergen (active type). In addition, the portion (b) corresponding to the above (a) in the allergen after reduction is schematically shown below the allergen (inactive type). The 0 shown in (a) and (b) represents one amino acid residue, and the shaded 0 represents the amino acid residue (epitope) recognized by the IgE antibody. As shown in (a) and (b), if the disulfide bond of the allergen is reduced, the loop portion of the amino acid sequence is unlocked, and a different amino acid sequence is inserted midway in the amino acid sequence recognized by the IgE antibody. As a result, the possibility that the IgE antibody becomes unable to recognize the specific binding site increases. Therefore, the allergenicity of the allergen is weakened.

[0087] In addition, in (a) and (b) above, the loop part is cited as an example for explanation, but it is not limited to this. In the three-dimensional structure of the protein, the amino acid residues located at distant positions in the amino acid sequence of the peptide chain of the protein are brought close to each other to form a functional site. Therefore, the disulfide bond is reduced, so that the connection between the secondary structures of the protein connected by the disulfide bond is disconnected, and the functional site formed by the connection between the secondary structures cannot be maintained. If described more specifically, the disulfide bond is a bond that connects the secondary structures of the protein to each other, thereby making the three-dimensional structure of the protein more solid.

[0088] Therefore, if the disulfide bond is cut, the connection between the secondary structures is disconnected, and the degree of freedom (wobbling) of the three-dimensional structure of the allergenic protein increases. As a result, the functional site (e.g., three-dimensional structural epitope) of the allergenic protein cannot be maintained, and the possibility that the IgE antibody cannot recognize the specific binding site of the allergenic protein increases.

[0089] Furthermore, as a result of the increase in the degree of freedom (wobbling) of the steric structure of the allergenic protein due to the reduction of the disulfide bonds, digestive enzymes can more easily act on the cleavage sites in the peptide chains of the allergenic protein that are cleaved by the digestive enzymes, and thus the allergenic protein can be easily digested by the digestive enzymes.

[0090] In this embodiment, a fusion protein is used as a fusion protein in which several lysine residues are replaced with other amino acid residues based on a fusion protein before amino acid substitution in which a linker is integrated between thioredoxin reductase and thioredoxin (Trx). Hereinafter, the characteristics that are almost unchanged before and after the substitution of lysine residues will be described, and therefore, for convenience, the names of thioredoxin reductase and thioredoxin before substitution will be used for description.

[0091] Thioredoxin is a low molecular weight redox protein having an active site motif consisting of an amino acid sequence of Trp (tryptophan) -Cys (cysteine) -Gly (glycine) -Pro (proline) -Cys (cysteine). Thioredoxin takes two forms: a reduced form and an oxidized form, depending on the redox state of the thiol groups of the two Cys in the active site.

[0092] Thioredoxin reductase is an enzyme that catalyzes a reaction that reduces thioredoxin. Thioredoxin reductase provides electrons to thioredoxin. More specifically, thioredoxin reductase provides electrons provided by the working electrode 1a to oxidized thioredoxin. Thioredoxin reductase can also be provided with electrons by the working electrode 1a via a medium. Thioredoxin reductase, for example, is (i) an enzyme that catalyzes the reduction of oxidized thioredoxin, including NADPH (nicotinamide adenine dinucleotide phosphate)-thioredoxin reductase or ferredoxin-thioredoxin reductase (i.e., FTR in the figure).

[0093] The linker is a connecting peptide used to fuse the above-mentioned thioredoxin reductase with thioredoxin to produce a fusion protein before amino acid substitution. The connecting peptide fuses thioredoxin reductase with thioredoxin in such a way that the redox-active disulfide of thioredoxin can interact with the redox-active disulfide of thioredoxin reductase.

[0094] like Figure 3As shown, when the fusion protein is used for inactivation of allergens, the fusion protein accepts electrons provided to the medium by the electrode and then provides electrons to the allergens. Then, the disulfide bonds of the allergens are reduced to thiol groups by the electrons provided by the active fusion protein. Thus, the allergens are inactivated.

[0095] Here, use Figures 4 to 8 The details of the fusion protein described above and the method for producing it are described below. Figure 4 FIG. 1 is a flow chart showing a method for producing a fusion protein according to an embodiment. Figure 4 As shown, when producing a fusion protein, first, a fusion protein before amino acid substitution is prepared by fusing thioredoxin reductase to thioredoxin (S401). Here, preparing a fusion protein means preparing an expression vector for expressing the fusion protein before amino acid substitution.

[0096] Figure 5 : is a conceptual diagram of an expression vector of a fusion protein according to an embodiment. Figure 6 is a conceptual diagram of the fusion protein involved in the embodiment. Figure 6 In FIG. 1 , (a) shows a conceptual diagram of the first subunit, and (2) shows a conceptual diagram of the second subunit. Figure 5 As shown, a gene encoding amino acids at positions 32 to 146 of FTRB (sequence number 1) was introduced into the 5' side of the multi-cloning site 1 of the enzyme expression vector (pETDuet-1: manufactured by Novagen), and a gene encoding amino acids at positions 59 to 167 of TrxY2 (sequence number 2) was introduced into the 3' side. A gene encoding a connecting peptide (sequence numbers 3 to 5) was introduced between the two genes so that they were expressed in necessary units and in an appropriate order. A gene encoding amino acids at positions 73 to 184 of FTRA2 (sequence number 6) and a gene encoding a histidine tag (His-Tag) (sequence number 7) were introduced into the multi-cloning site 2. Figure 6 As can be seen from the above description, the thioredoxin reductase involved in this embodiment is composed of: FTRB, which is the first subunit containing the active center involved in electron transfer; and FTRA2, which is not integrated with FTRB (no covalent bond is formed) and has a supporting function for the three-dimensional structure of FTRB.

[0097] Each base sequence of the inserted gene for expression vector preparation

[0098] (1) Gene encoding amino acids 32 to 146 of FTRB (SEQ ID NO: 1)

[0099] ATGGCGAAAACGGAACCGTCGGAGAAATCAGTAGAGATTATGAGGAAATTCTCCGAG

[0100] CAATATGCTCGTCGCTCTGGGACTTACTTCTGTGTTGATAAAGGAGTTACTTCAGTCGT

[0101] TATTAAGGGTTTGGCTGAGCATAAAGATTCATATGGTGCACCGCTTTGCCCTTGCAGAC

[0102] ACTATGATGATAAAGCTGCTGAGGTTGGACAAGGCTTTTGGAATTGTCCGTGTGTTCCA

[0103] ATGAGAGAGAGGAAGGAGTGCCATTGTATGCTTTTCTTAACTCCTGATAATGATTTCGC

[0104] TGGAAAAGATCAGACGATTACATCGGATGAAATAAAAGAAACTACAGCTAACATG

[0105] (2) Gene encoding amino acids 59 to 167 of TrxY2 (the underlined portion is a stop codon) (SEQ ID NO: 2)

[0106]

[0107] (3) Gene encoding connecting peptide (SEQ ID NOs: 3 to 5)

[0108] (GGGGS)1:ggcggcggcggcagc (sequence number 3)

[0109] (GGGGS)2:ggcggcggcggcagcggcggcggcggcagc (sequence number 4)

[0110] (GGGGS)3: ggcggcggcggcagcggcggcggcggcagcggcggcggcggcagc (serial number 5)

[0111] (4) Gene encoding amino acids 73 to 184 of FTRA2 (SEQ ID NO: 6)

[0112] ATGGATATTGCTGTGAAATCGGCGGCTTCTGTAGACGCGGACGCTGATCTATCGTCATC

[0113] TACGTCGTTGGAGACGGAGGAAGACGAGAAAGCGAAGGAGAAGATTGGAGCTAGGGT

[0114] TAGGGTTACGGTTCCGTTGAAAGTTTACCATGTGGTTTCGTGTACCGGAGGTTGAATTGA

[0115] TGGGAATGGAAGGTTTTATCAAAGATTACGTCGTTCTTTGGAAAGGAAAGAAAATCTC

[0116] AGCTAATCTGCCGTTTAAGGTACAGTTCGTGAAAGAGATCGAAGGTCGTGGTCCTGTC

[0117] AAATTCTTCACGCATCTTAAGGAAGACGAGTTCGAGTTAATTGATCCG

[0118] (5) Gene encoding histidine tag (His-Tag) (the underlined part is the stop codon) (SEQ ID NO: 7)

[0119]

[0120] Back to Figure 4 Then, at least one lysine residue of the prepared amino acid constituting the fusion protein before the amino acid substitution is replaced with another amino acid (S402). The amino acid substitution here refers to base substitution on the gene encoding the fusion protein before the amino acid substitution, and when the gene after the substitution is expressed, the replaced fusion protein is produced.

[0121] Therefore, the expression vector of the fusion protein before the amino acid substitution made as described above is cloned using a primer that replaces the lysine residue with another amino acid residue to make the expression vector of the fusion protein of interest. Here, the primer design for replacing the arginine residue that has less influence on the three-dimensional structure after the amino acid substitution is performed.

[0122] In addition, in the selection of the replaced lysine residues, the lysine residues whose side chains are oriented outward on the surface of the fusion protein before the amino acid replacement can be selected. In addition, in order to orient thioredoxin to the opposite side of the electrode, it is preferred that the lysine residues on the side of the thioredoxin reductase, for example, the distance from thioredoxin is farther than the center of gravity are retained (not replaced). Furthermore, in order to orient the active center participating in electron transfer to one side of the electrode, it is preferred that the lysine residues on the side of the thioredoxin reductase, for example, the distance from the active center participating in electron transfer is closer than the center of gravity are retained (not replaced). On the other hand, in the selection of the replaced lysine residues, the lysine residues participating in the cutting effect of disulfide bonds, the lysine residues that can make the three-dimensional structure of the protein change greatly, and the lysine residues near the active center participating in electron transfer (for example, within a dozen angstroms) should not be selected.

[0123] Four kinds of amino acid substitutions were designed, and the primers used in each substitution had a primer set with complementary chains in the forward (Fwd) and reverse (Rev). Specifically, amino acid substitutions were performed using the K30R / K32R / K34R primer set (SEQ ID NOs. 8 and 9) in which Lys (K) at positions 30, 32, and 34 of FTRA2 was replaced with Arg (R), the K104R primer set (SEQ ID NOs. 10 and 11) in which Lys (K) at position 104 of FTRA2 was replaced with Arg (R), the K119R primer set (SEQ ID NOs. 12 and 13) in which Lys (K) at position 199 of FTRB-TrxY2 was replaced with Arg (R), and the K212R / K215R primer set (SEQ ID NOs. 14 and 15) in which Lys (K) at positions 212 and 215 of FTRB-TrxY2 was replaced with Arg (R).

[0124] In this embodiment, a fusion protein comprising K119R FTRB-TrxY2 (SEQ ID NO: 16), a fusion protein comprising K119R / K212R / K215R FTRB-TrxY2 (SEQ ID NO: 17), and a fusion protein comprising K30R / K32R / K34R / K104R FTRA2 (SEQ ID NO: 18) and K119R / K212R / K215R FTRB-TrxY2 were prepared and used. For example, Figure 7 The figure shows the amino acid sequence of a fusion protein comprising K30R / K32R / K34R / K104R FTRA2 and K119R / K212R / K215RFTRB-TrxY2. Figure 7 In the figure, (a) shows the amino acid sequence of the first subunit, and (2) shows the amino acid sequence of the second subunit.

[0125] Base sequences of primers for expression vector preparation

[0126] (1) Fwd primer for amino acid substitution of K199R in FTRA2 (SEQ ID NO: 8)

[0127] GGAGACGGGAGGAAGACGAGGCAGCGGCGGAGGCGATTGGAGCTAGGGTTAGG

[0128] (2) Rev primer for amino acid replacement of K199R in FTRA2 (SEQ ID NO: 9)

[0129] CCTAACCCTAGCTCCAATCGCCTCCGCCGCTGCCTCGTCTTCCTCCGTCTC

[0130] (3) Fwd primer for amino acid substitution of K199R in FTRA2 (SEQ ID NO: 10)

[0131] TCCTGTCAAATTCTTCACGCATCTTCGTGAAGACGAGTTCGAGTTAATTGATC

[0132] (4) Rev primer for amino acid substitution of K199R in FTRA2 (SEQ ID NO: 11)

[0133] GATCAATTAACTCGAACTCGTCTTCACGAAGATGCGTGAAGAATTTGACAGGA

[0134] (5) Fwd primer for amino acid substitution of K199R in FTRB-TrxY2 (SEQ ID NO: 12)

[0135] AAGTACCCAAGTCTTGCTAACCGTTACCAGATTGAGGCTTTGCCC

[0136] (6) Rev primer for amino acid replacement of K199R of FTRB-TrxY2 (SEQ ID NO: 13)

[0137] GGGCAAAGCCTCAATCTGGTAACGGTTAGCAAGACTTGGGTACTT

[0138] (7) Fwd primer for K212R / K215R amino acid substitution of FTRB-TrxY2 (SEQ ID NO: 14)

[0139] TTGAGGCTTTGCCCACATTCATCTTATTCCGTGACGGCCGTCTCTGGGACCGTTTCGAG

[0140] (8) Rev primer for K212R / K215R amino acid substitution of FTRB-TrxY2 (SEQ ID NO: 15)

[0141] CTCGAAACGGTCCCAGAGACGGCCGTCACGGAATAAGATGAATGTGGGCAAAGCCTC

[0142] AA

[0143] Amino acid sequence of fusion protein

[0144] (1) K199R FTRB-TrxY2 (the underlined portion indicates the arginine residue after substitution) (SEQ ID NO: 16)

[0145]

[0146] (2) K199R / K212R / K215R FTRB-TrxY2 (the underlined portion indicates the arginine residue after substitution) (SEQ ID NO: 17)

[0147]

[0148] (3) K30R / K32R / K34R / K104R FTRA2 (the underlined part is the arginine residue after substitution) (SEQ ID NO: 18)

[0149]

[0150] Refer again Figure 3 , the medium is a redox substance that mediates the electron transfer between the electrode and the fusion protein. The medium provides electrons to the fusion protein. More specifically, the medium provides the electrons provided by the working electrode 1a to the fusion protein. In addition, the medium can also indirectly provide electrons to the oxidized fusion protein via other redox molecules. The medium is not particularly limited as long as it is a substance that can transfer electrons between the electrode and the fusion protein. The medium can also be selected based on the redox potential of the target molecule (i.e., the FTR of the fusion protein here) to which the medium is to provide electrons. The medium, for example, can be a compound having a bipyridine skeleton, a compound having a quinone skeleton, or a compound having a phenylenediamine skeleton. In addition, these compounds can be used alone or in combination of two or more.

[0151] The compound with a bipyridine skeleton, for example, may be a compound with a 2,2'-bipyridine skeleton, a compound with a 2,4'-bipyridine skeleton, a compound with a 4,4'-bipyridine skeleton, or a derivative thereof (e.g., a 4,4'-bipyridinium derivative, etc.). The compound with a bipyridine skeleton may be a bipyridine compound having a substituent on the bipyridine skeleton (so-called bipyridine derivative), or a bipyridine compound having no substituent on the bipyridine skeleton. As a substituent, hydrogen, halogen, hydroxyl, nitro, carboxyl, carbonyl, amino, amide or sulfonic acid group, or alkyl, aryl, heteroaromatic alkyl, or phenyl substituted by them may be cited. In addition, an aromatic ring may be formed between two adjacent substituents. Regarding substituents, the same is true for the compound with a quinone skeleton and the compound with a phenylenediamine skeleton described later. When the electron transfer mediator is a compound having a bipyridine skeleton, the electron transfer mediator may be, for example, 1,1'-dimethyl-4,4'-bipyridinium (methyl viologen), 1-methyl-1'-carboxymethyl-4,4'-bipyridinium, 1,1'-dicarboxymethyl-4,4'-bipyridinium, 1-methyl-1'-aminoethyl-4,4'-bipyridinium, 1,1'-diaminoethyl-4,4'-bipyridinium, 1-methyl-1'-ethyl-4,4'-bipyridinium, 1-methyl-1'-propyl-4,4'-bipyridinium, 4'-bipyridinium, 1-methyl-1'-butyl-4,4'-bipyridinium, 1-methyl-1'-pentylhexyl-4,4'-bipyridinium, 1-methyl-1'-hexyl-4,4'-bipyridinium, 1-methyl-1'-heptyl-4,4'-bipyridinium, 1-methyl-1'-octyl-4,4'-bipyridinium, 1-methyl-1'-nonyl-4,4'-bipyridinium, 1-methyl-1'-decyl-4,4'-bipyridinium, and compounds wherein the methyl group at position 1 of these compounds is replaced with an ethyl group.

[0152] The compound having a quinone skeleton may be, for example, a compound having a benzoquinone skeleton, a compound having a naphthoquinone skeleton, a compound having an anthraquinone skeleton, or a derivative thereof. The compound having a quinone skeleton may or may not have a substituent. The substituent has been described above, so the description here is omitted. In the case where the electron transfer mediator is a compound having a quinone skeleton, the electron transfer mediator may be, for example, methyl benzoquinone, dimethyl benzoquinone (e.g., 2,5-dimethyl-1,4-benzoquinone, 2,3-dimethyl-1,4-benzoquinone, and 2,6-dimethyl-1,4-benzoquinone, etc.), 2,3-dichloro-5,6-dicyano-1,4-benzoquinone, 2,3,5,6-tetramethyl-1,4-benzoquinone, 2,3,5,6-tetrachloro-1,4-benzoquinone (chloranil), ubiquinone (CoQ), pyrroloquinoline quinone (PQQ), 1,2-naphthoquinone-4-sulfonic acid, 2-methyl-1,4-naphthoquinone (vitamin K3), 2-hydroxy-1,4-naphthoquinone, 1,2-dihydroxyanthraquinone (alizarin), 1,2,4-trihydroxyanthraquinone (purpurin), 9,10-phenanthrenequinone. In addition, the electron transfer medium may be, for example, a hydroquinone in which the keto group of the benzoquinone skeleton is replaced by a hydroxyl group, more specifically, a hydroquinone (1,4-hydroquinone) in which the keto group of 1,4-benzoquinone is replaced by a hydroxyl group, or a hydroquinone (1,3-hydroquinone) in which the keto group of 1,3-benzoquinone is replaced by a hydroxyl group.

[0153] The compound having a phenylenediamine skeleton may or may not have a substituent. When the electron transfer mediator is a compound having a phenylenediamine skeleton, the electron transfer mediator may be, for example, p-phenylenediamine, 2,3,5,6-tetramethyl-1,4-phenylenediamine, N,N-dimethyl-p-phenylenediamine, N,N'-diphenyl-p-phenylenediamine (DPPD), N-isopropyl-N'-phenyl-p-phenylenediamine (IPPD), N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine (6PPD), etc.

[0154] If you refer to it again Figure 1 , the cover 5 is provided with a terminal 6a, a terminal 6b, and a terminal 6c which are electrically connected to the working electrode 1a, the reference electrode 2, and the counter electrode 3, respectively. A wire extends from each terminal to connect the terminal to the unit. The working electrode 1a is connected to the terminal 6a via a wire 7a, the reference electrode 2 is connected to the terminal 6b via a wire 7b, and the counter electrode 3 is connected to the terminal 6c via a wire 7c.

[0155] [power supply]

[0156] The power supply 20 applies a voltage to the electrode (working electrode 1a). More specifically, the power supply 20 applies a voltage between the working electrode 1a and the counter electrode 3 of the voltage applying unit 10a according to the control signal output from the control unit 30, and controls the potential difference between the working electrode 1a and the reference electrode 2 to a predetermined value. For example, the power supply 20 can apply a voltage in a manner such that the voltage applied to the working electrode 1a is greater than -1.0V and less than 0V, with the reference electrode 2 as a reference (0V). At this time, the reference electrode 2 is, for example, a silver / silver chloride electrode.

[0157] like Figure 2 As shown, the power supply 20 includes, for example, an acquisition unit 21 , an information processing unit 22 , and a voltage control unit 23 .

[0158] The acquisition unit 21 acquires the control signal outputted from the control unit 30. Alternatively, the acquisition unit 21 may acquire measurement data such as the potential of each electrode in the voltage application unit 10a and the value of the current flowing in the sample solution 9a.

[0159] The information processing unit 22 processes the information obtained by the acquisition unit 21. For example, if the information processing unit 22 obtains a control signal from the acquisition unit 21, it outputs the obtained control signal to the voltage control unit 23. If the voltage control unit 23 starts to apply voltage to each electrode of the voltage application unit 10a, the information processing unit 22 obtains the measurement data such as the potential of each electrode in the voltage application unit 10a and the current value flowing in the sample solution 9a obtained from the acquisition unit 21, and derives the voltage applied to the working electrode 1a based on the obtained data in a manner that the potential difference between the working electrode 1a and the reference electrode 2 is maintained at a predetermined value. Then, a control signal for controlling the voltage of the working electrode 1a with the derived voltage is output to the voltage control unit 23.

[0160] The voltage control unit 23 applies a voltage to each electrode of the voltage applying unit 10 a based on the control signal output from the information processing unit 22 .

[0161] In addition, Figure 1 , an example is shown in which the power supply 20 and the control unit 30 are separate bodies, but the power supply 20 may also include the control unit 30.

[0162] [Control Department]

[0163] The control unit 30 performs information processing for controlling the voltage application of the power supply 20. The control unit 30 is implemented, for example, by a processor, a microcomputer, or a dedicated circuit. Figure 1 , an example in which the control unit 30 is a computer device is shown.

[0164] The control unit 30 includes, for example, an acquisition unit 31 , an information processing unit 32 , a storage unit 33 , and an output unit 34 .

[0165] The acquisition unit 31 acquires information regarding an instruction input by a user (hereinafter, instruction information), for example, and outputs the acquired instruction information to the information processing unit 32 .

[0166] The information processing unit 32 derives conditions for applying voltage to each electrode of the voltage applying unit 10a (also referred to as voltage application conditions), for example, based on the instruction information obtained by the obtaining unit 31. The instruction information may be, for example, the type of allergen, the amount of the sample solution 9a, the completion time of the treatment, the completion time, or the degree of inactivation (reduction) (for example, percentage or five-stage display), etc.

[0167] Furthermore, the information processing unit 32 may output to the output unit 34 a control signal for controlling voltage application under conditions derived from the instruction information, or may output to the output unit 34 a control signal for controlling voltage application under voltage application conditions preset by the user.

[0168] The output unit 34 outputs the control signal obtained from the information processing unit 32 to the power supply 20 .

[0169] The storage unit 33 stores data such as instruction information obtained by the obtaining unit 31 , a computer program (for example, an application program for controlling the power source 20 ) executed by the control unit 30 , and the like.

[0170] [3. Work]

[0171] Next, regarding the operation of the allergen inactivation device 100a according to the embodiment, refer to Figure 8 Please explain in detail. Figure 8 This is a flowchart showing an example of the operation of the allergen inactivating device 100a according to the embodiment.

[0172] First, the preparation process (not shown) before operating the allergen inactivation device 100a is described. For example, the preparation process can also be performed by the user. In the preparation process, first, the sample solution 9a is prepared. The user introduces a sample that may contain an allergen into the cell 4 of the voltage application unit 10a.

[0173] Next, the user inserts the electrodes into the sample solution 9a and places them in such a way that each electrode contacts the sample solution 9a. The electrodes are a working electrode 1a, a reference electrode 2, and a counter electrode 3. The working electrode 1a is connected to a lead 7a extending from a terminal 6a configured on the cover 5, the reference electrode 2 is connected to a lead 7b extending from a terminal 6b configured on the cover 5, and the counter electrode 3 is connected to a lead 7c extending from a terminal 6c configured on the cover 5.

[0174] Next, the user inputs information (so-called instruction information) indicating, for example, the type of allergen, the amount of the sample solution 9a, the completion time of the treatment, the completion point, or the degree of inactivation (reduction) into the allergen inactivation device 100a.

[0175] Next, the operation of the allergen inactivation device 100a will be described. When the user inputs instruction information, the control unit 30 sets the conditions for applying voltage to each electrode of the voltage application unit 10a (step S101). In setting the conditions, the control unit 30 derives the voltage application conditions based on the input instruction information, and outputs a control signal for controlling the voltage application of the power supply 20 under the derived voltage application conditions to the power supply 20. In addition, in step S101, the user may select a program number corresponding to the voltage application condition, so that the control unit 30 obtains the program number and sets the voltage application condition.

[0176] Next, if the power supply 20 obtains the control signal output from the control unit 30, the voltage application to the electrode starts according to the control signal (step S102). For example, the power supply 20 applies a voltage between the working electrode 1a and the counter electrode 3 of the voltage application unit 10a, and controls the potential difference between the working electrode 1a and the reference electrode 2 to a specified value (for example, a value within the range of -1.0V or more and 0V or less). That is, the power supply 20 uses the reference electrode 2 as a reference (0V) and applies a voltage in a manner such that the voltage applied to the working electrode 1a is -1.0V or more and 0V or less. At this time, the reference electrode 2 is, for example, a silver / silver chloride electrode. Thus, the working electrode 1a provides electrons to the oxidized fusion protein in the sample solution 9a. As a result, the oxidized fusion protein is reduced to a reduced fusion protein (step S103). Next, the reduced fusion protein inactivates the allergen in the sample solution 9a by reducing it (step S104). During the period when the power supply 20 applies voltage to the electrodes, steps S103 and S104 are repeated. Furthermore, in step S103, first, the medium is reduced from an oxidized form to a reduced form, and the thioredoxin reductase and thioredoxin of the fusion protein are reduced from an oxidized form to a reduced form in sequence by the reducing power of the medium.

[0177] Next, the control unit 30 determines whether the processing under the set conditions is completed (step S105). The set conditions are, for example, the period (time) of voltage application or the number of voltage applications (e.g., pulse voltage). When the control unit 30 determines that the processing under the set conditions is not completed (no in step S105), the power supply 20 continues to apply voltage (step S106). And, during the period until the next determination (step S105), steps S103 and S104 are repeated. On the other hand, when the control unit 30 determines that the processing under the set conditions is completed (yes in step S105), the power supply 20 ends the voltage application (step S107). Thus, the inactivation of the allergen in the sample solution 9a is completed.

[0178] In addition, the above-mentioned preparation process is described as an example performed by the user, but it can also be performed by the allergen inactivation device 100a. In this case, the allergen inactivation device 100a can further include an introduction part (not shown), a recovery part (not shown), an introduction port (not shown) and a discharge port (not shown). For example, the introduction part can also introduce a sample that can contain an allergen into the unit 4 from the introduction port provided in the unit 4. In addition, for example, the recovery part can also recover the sample solution 9a after the allergen is inactivated from the discharge port provided in the unit 4 to the outside of the unit 4.

[0179] [4. Example]

[0180] In this example, a fusion protein comprising K119R FTRB-TrxY2 (Example 1), a fusion protein comprising K119R / K212R / K215R FTRB-TrxY2 (Example 2), and a fusion protein comprising K30R / K32R / K34R / K104R FTRA2 and K119R / K212R / K215R FTRB-TrxY2 (Example 3) were prepared. In addition, as a comparative example, a fusion protein without any amino acid substitution was prepared.

[0181] The fusion protein is prepared as follows. The expression vector of the prepared fusion protein is integrated into Escherichia coli BL21 (DE3) (manufactured by Nippondin), and the Escherichia coli is pre-cultured at 37°C overnight using LB medium. An appropriate amount of the pre-cultured Escherichia coli is inoculated into MagicMedia E.coli Expression Medium (Invitrogen), and cultured at 16°C overnight to express the fusion protein in the bacteria. Then, the cultured bacteria are collected by centrifugation. The collected Escherichia coli is suspended in xTractor Buffer (Clontech) and incubated using a rotor for 10 minutes at 4°C. Centrifuge at 12,000×g and 4°C for 20 minutes to remove the cell sheet. The expressed fusion protein is purified from the supernatant after centrifugation using Ni2+ affinity chromatography.

[0182] In order to verify the effect of amino acid substitution, an enzyme electrode was prepared by immobilizing various purified fusion proteins via the remaining lysine residues. Using the enzyme electrode, a sample solution containing an allergen was brought into contact with the enzyme electrode and a voltage was applied to verify the decomposition rate (digestibility) of the allergen. Hereinafter, a sample solution prepared by dissolving an allergenic protein having a disulfide bond in a phosphate buffered saline (PBS) at pH 7.4 was used as an allergen.

[0183] First, a fusion protein solution containing a fusion protein and a medium is prepared. Next, 25 μL of the fusion protein solution is mixed with 4.1 μL of a 20% (w / v) poly-L-lysine solution, 4.4 μL of a 2.5% glutaraldehyde solution, 7.2 μL of a 10 mM Tris-HCl buffer, 1.5 μL of a 50 mg / mL BSA (Bovine serum albumin) solution, and 12.8 μL of distilled water to prepare an immobilization solution. After the base substrate is impregnated with the immobilization solution, the base substrate is left to stand at 4°C for more than 8 hours and then dried. Thus, an enzyme electrode (corresponding to the working electrode 1a) in which the fusion protein and the medium are immobilized on the surface of the base substrate is obtained.

[0184] The same three-electrode voltage applying unit (corresponding to the voltage applying unit 10a) and the potentiostat (corresponding to the power supply 20) as described in the embodiment are used to apply a predetermined voltage to the sample solution for 0 hours, 4 hours or 8 hours. The working electrode 1a in the three electrodes uses the enzyme electrode produced as described above, and the reference electrode 2 uses the Ag / AgCl electrode. The predetermined voltage applied to the sample solution is controlled by the potentiostat in such a way that the potential of the working electrode 1a relative to the reference electrode 2 becomes the reduction potential of the medium.

[0185] The sample solution after the voltage was applied for each time was recovered, and digestive enzymes were added to the sample solution recovered and incubated at 37°C for 2 hours. Next, the sample solution after incubation and the molecular weight marker were subjected to SDS-PAGE (Sodium dodecyl sulfate-Polyaclamide gel electrophoresis) of the conventional method. Next, the gel after electrophoresis was stained, and the area and concentration of the band of the allergenic protein were digitized by image analysis. In addition, SDS-PAGE and image analysis were also performed in the same manner for the sample solution containing the untreated allergen that was not subjected to the decomposition treatment with the enzyme electrode (hereinafter, also referred to as the control sample solution), as an index of 100% residual rate.

[0186] The calculation results of the decomposition rate are shown in Figures 9 to 12 . Fig. 9 This is a graph showing the results of decomposition of the allergen according to Example 1. Fig.10 This is a graph showing the results of decomposition of the allergen according to Example 2. Fig.11 This is a graph showing the results of decomposition of allergens according to Example 3. Fig.12 is a graph showing the results of decomposition of allergens involved in the comparative example. Figures 9 to 12 In the figure, (a) shows the electrophoresis image after SDS-PAGE, and (b) shows the bar graph of the calculation results of the degradation rate at each time.

[0187] like Fig. 9 As shown, in Example 1, the degradation of allergens by the fusion protein containing K119R FTRB-TrxY2 was carried out, and 100% of the allergens remained at 0 hours, 99% of the allergens remained at 4 hours, and 21% of the allergens remained at 8 hours. If converted into degradation rate, 0% of the allergens were degraded at 0 hours, 1% of the allergens were degraded at 4 hours, and 79% of the allergens were degraded at 8 hours.

[0188] like Fig.10 As shown, in Example 2, the degradation of allergens by the fusion protein containing K119R / K212R / K215R FTRB-TrxY2 was carried out, and 99% of the allergens remained at 0 hours, 52% of the allergens remained at 4 hours, and 6% of the allergens remained at 8 hours. If converted into degradation rate, 1% of the allergens were degraded at 0 hours, 48% of the allergens were degraded at 4 hours, and 94% of the allergens were degraded at 8 hours.

[0189] like Fig.11As shown, in Example 3, the degradation of allergens by the fusion protein containing K30R / K32R / K34R / K104R FTRA2 and K119R / K212R / K215R FTRB-TrxY2 was performed, and 99% of the allergens remained at 0 hours, 36% of the allergens remained at 4 hours, and 2% of the allergens remained at 8 hours. If converted into degradation rates, 1% of the allergens were degraded at 0 hours, 64% of the allergens were degraded at 4 hours, and 98% of the allergens were degraded at 8 hours.

[0190] like Fig.12 As shown, in the comparative example, the degradation of allergens by the fusion protein without amino acid substitution was performed, and 100% of the allergens remained at 0 hours, 100% of the allergens remained at 4 hours, and 29% of the allergens remained at 8 hours. If converted into degradation rate, 0% of the allergens were degraded at 0 hours, 0% of the allergens were degraded at 4 hours, and 71% of the allergens were degraded at 8 hours.

[0191] like Figures 9 to 12 As shown, compared with the comparative example, in the enzyme electrode immobilized with the fusion protein having carried out the amino acid replacement, the decomposition of the allergen is shown to be carried out in a shorter time for any amino acid replacement. Considering that, the fusion protein having the amino acid composition of the amino acid replacement of at least one lysine residue replaced with other amino acids, when being immobilized on the electrode and used as the enzyme electrode, is not easy to form the combination of the scheme of hindering the electron donation and the effect of cutting the disulfide bond because it is immobilized on the electrode by a more appropriate lysine residue. That is, from the viewpoint of the decomposition rate, it is shown that the enzyme electrode immobilized by a more appropriate combination is realized.

[0192] In addition, in Examples 1 to 3, the efficiency of decomposition decreased in the order of Example 3, Example 2, and Example 1, and it was found that the more lysine residues were replaced by amino acids, the higher the decomposition rate. That is, since the effects of individual amino acid replacements have their own exclusive effects, the effect of improving the decomposition rate can be increased by combining them.

[0193] The enzyme electrode, reduction device, reduction method, fusion protein (modified protein replaced by amino acids) and fusion protein manufacturing method involved in the present disclosure are described above based on the embodiments, but the present disclosure is not limited to these embodiments. As long as it does not exceed the purpose of the present disclosure, the various deformation modes that a person skilled in the art thinks of in the embodiments and other modes constructed by combining some of the constituent elements in the embodiments are also included in the scope of the present disclosure.

[0194] Industrial Availability

[0195] According to the present disclosure, it is useful in a device that performs reduction of a target molecule using an electrode.

[0196] Explanation of symbols

[0197] 1a Working electrode

[0198] 2 Reference electrode

[0199] 3 pairs of electrodes

[0200] 4 units

[0201] 5 cover

[0202] 6a, 6b, 6c terminals

[0203] 7a, 7b, 7c wires

[0204] 9a Sample solution

[0205] 10a Voltage applying unit

[0206] 20 Power Supply

[0207] 21, 31 Get Department

[0208] 22 Information Processing Department

[0209] 23 Voltage control unit

[0210] 30 Control Department

[0211] 32 Information Processing Department

[0212] 33 Storage

[0213] 34 Output

[0214] 100a Allergen inactivation device

Claims

1. Enzyme electrode, with: Electrodes, and A modified protein having an amino acid sequence in which at least one lysine residue in a fusion protein of thioredoxin reductase and thioredoxin is replaced with another amino acid residue, The modified protein is immobilized on the surface of the electrode.

2. The enzyme electrode according to claim 1, The other amino acid residue is an arginine residue.

3. The enzyme electrode according to claim 1, The side chain of the at least one lysine residue is oriented outward on the surface of the fusion protein.

4. The enzyme electrode according to claim 1, The thioredoxin reductase is composed of a first subunit including an active center involved in electron transfer and a second subunit different from the first subunit. The at least one lysine residue is included in the amino acid residues constituting the second subunit.

5. The enzyme electrode according to any one of claims 1 to 4, The fusion protein comprises a first lysine residue and a second lysine residue, The first lysine residue of the modified protein is replaced with another amino acid residue, and the modified protein is immobilized on the surface of the electrode via the second lysine residue.

6. The enzyme electrode according to claim 5, One of the second lysine residues is arranged on the side of the thioredoxin reductase that is farther from the thioredoxin.

7. The enzyme electrode according to claim 5, One of the second lysine residues is arranged on a side closer to an active center involved in electron transfer in the thioredoxin reductase.

8. Reduction device, having: The enzyme electrode according to claim 1, and a power source for applying a voltage to the electrodes, A sample containing a target molecule is brought into contact with the enzyme electrode, and a voltage is applied to the electrode to reduce the target molecule.

9. A reduction method, wherein: contacting a sample that may contain a target molecule with the enzyme electrode according to claim 1, While a voltage is applied to the electrodes, the target molecule is reduced.

10. Modify proteins, The present invention has an amino acid sequence in which at least one lysine residue in a fusion protein of thioredoxin reductase and thioredoxin is replaced with another amino acid residue.

11. A method for producing a modified protein, wherein: preparing a fusion protein of thioredoxin reductase and thioredoxin, At least one lysine residue in the fusion protein is replaced with other amino acid residues.

Images