Methods and compositions for nucleic acid sequencing

Abstract

In one aspect, the invention relates to library preparation methods and compositions suitable for use in library preparation methods. The invention also relates to a sequencing method and the use of the library in sequencing.

Description

Technical Field

[0001] In one aspect, the present invention relates to a method for preparing a library and a composition suitable for use in the method for preparing a library. The present invention also relates to a sequencing method and the use of a library in sequencing. Background Art

[0002] Current nucleic acid sequencing methods, such as next generation sequencing (NGS), can obtain sequence information from extremely large samples. For example, it is possible to collect whole genome sequence information. However, both sample preparation methods and sequencing methods are prone to errors. This is particularly problematic for applications that require detection of small changes in large samples, such as detecting single base pair changes in a genome, because even very low error rates may affect the results.

[0003] Considering the increasing application of gene editing technologies such as CRISPR-Cas9, there is a growing demand for detecting rare mutations. CRISPR genome editing uses synthetic guide RNA to target the Cas9 enzyme (a nuclease acting as a gene scissors) to specific sites in the genome where genetic changes are required. Genome editing relies on accurate targeting of these sites to produce small insertions or deletions, thereby showing genetic changes. However, this involves the introduction of DNA double-strand breaks (DSBs) in DNA molecules. Such breaks may have a harmful effect on human health and may cause cancer, depending on their location and the ability of cells to repair them. The system is very accurate in its targeting, but during the editing process, secondary, so-called off-target sites in the genome may also be unintentionally targeted. These positions are often similar to the target sequence, but the similarity is not yet fully understood. In fact, bioinformatics off-target predictions based only on guide RNA sequences are often not accurate enough to reveal all experimentally detected off-target sites. This is necessary for improving guide design and preventing off-target editing. Importantly, it is noted that the specificity of guide RNA is highly variable, which is of great significance for its safe use in gene therapy. In fact, off-target sites can break and / or mutate throughout the genome, which poses a significant and inherent risk to genome editing as a whole. This in turn poses a serious challenge to current traditional cell-based genotoxicity risk assessment methods, which evaluate the effects of chemicals on genome stability. However, genome editing uses a new class of targeted biologics, which poses a needle-in-a-haystack type problem: how to identify rare off-target editing events in a complex genome when they are unpredictable by sequence alone. CRISPR-Cas9 genome editing has exacerbated the off-target problem, as introduced off-targets are now so rare that they cannot be detected by current cell-based methods.

[0004] To assess the long-term impact of these off-target breaks, it is important to measure their mutational consequences, which are determined by their accurate repair. Existing methods, such as amplicon sequencing, have reported approximately 1 / 10 3 Therefore, amplicon sequencing is not sensitive enough to detect rare mutations at novel, low-frequency off-target sites.

[0005] Schmitt et al. (PNAS, September 4, 2012, Vol. 109, No. 36, pp. 14508-14513) disclose a method for detecting ultra-rare mutations by next generation sequencing. Kennedy, SR, et al. (Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc, 2014. 9 (11): pp. 2586-606) are further described in detail. Schmitt et al. disclose that each of the two strands of a DNA duplex is independently labeled and sequenced. The disclosed method requires attaching a double-stranded, randomized duplex tag sequence to a sequencing linker by using a DNA polymerase to replicate a degenerate sequence in one strand of the linker. A similar approach includes NanoSeq disclosed by Abascal et al. (Somatic mutation landscapes at single-molecule resolution. Nature, 593, 405-4102021), which describes an optimized version of the BotSeqS method that applies enzymatic fragmentation and an improved end repair procedure to improve error correction sequencing using UMI tags as described above. However, for larger genomes, using these methods to detect whole-genome mutations is currently too expensive because the method requires high coverage (>10 4 times) (Kennedy, SR, et al. 2014), limiting its use to targeted sequencing of off-targets that have been identified, such as by DSB-detection methods. In addition, the choice of DNA fragmentation restriction enzymes used in NanoSeq only provides partial coverage of the genome. The use of sonication and exonuclease inactivation has been proposed as an alternative, but this approach would be affected by the same over-coverage requirement described previously.

[0006] WO 2013 / 142389 A1 discloses a method for reducing the error rate of massively parallel DNA sequencing using duplex consensus sequencing. WO 2013 / 142389 A1 discloses forming a library by ligating adapters to DNA, thereby generating three products (referred to as "Product I", "Product II" and "Product III").

[0007] Additional methods are needed that can generate error-corrected sequence information. Specifically, methods are needed that can unbiasedly and independently determine gene editing-induced mutations at low frequency off-target sites and near background levels throughout the genome. Summary of the invention

[0008] In one aspect, a method for preparing a library for nucleic acid sequencing is provided, the method comprising:

[0009] a) providing a plurality of nucleic acids;

[0010] b) exposing the plurality of nucleic acids to a non-hairpin adaptor under conditions favorable for ligation;

[0011] c) fragmenting the plurality of nucleic acids; and

[0012] d) exposing the plurality of nucleic acids to a hairpin adaptor under conditions favorable for ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at the end of a nucleic acid molecule;

[0013] Wherein steps b) and d) are performed separately.

[0014] The plurality of nucleic acids are fragmented after the first linker ligation step and before or as part of the second linker ligation step. The first linking step is the first of steps b) or d) to be performed. The second linking step is the second of steps d) or b) to be performed. Thus, the first linking step is: i) step b), in which case step d) is the second linking step, or ii) step d), in which case step b) is the second linking step.

[0015] The steps may be performed sequentially and in the order of a), b), c), d). The steps may be performed sequentially and in the order of a), d), c), b). The steps may be performed in the order of step a), step b), and the combined steps c) and d). The steps may be performed in the order of step a), step d), and the combined steps c) and b).

[0016] The non-hairpin adapter may comprise a sequence that is at least partially complementary to a first primer that is fixed to a substrate. The sequence that is at least partially complementary to a first primer that is fixed to a substrate may comprise at least 5, 10, 15, 16, 17, 18, 19, 20, or all 21 bases of SEQ ID NO: 1 or at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 3.

[0017] The non-hairpin adapter can be a Y-adapter. The Y-adapter can include: a first strand comprising a sequence at least partially complementary to a first primer fixed to a substrate; and a second strand comprising a sequence identical to at least one region of the second primer. The sequence identical to at least one region of the second primer can include at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO:2 or at least 5, 10, 15, 16, 17, 18, 19 or all 20 bases of SEQ ID NO:4. The non-hairpin adapter is a Y-adapter comprising: a first strand comprising a first hybridization site to which a first sequencing primer can bind in the 5' to 3' direction, and a sequence at least partially complementary to a first immobilized primer; and a second strand comprising a sequence identical to a region of a second immobilized primer in the 5' to 3' direction, and a second hybridization site to which a second sequencing primer can bind.

[0018] The non-hairpin adapter may comprise a 5' and / or 3' protection feature.The non-hairpin adapter may comprise: a first strand comprising a 3' protection feature; and a second strand comprising a 5' protection feature.

[0019] The non-hairpin linker can be a Y-linker, which comprises: a first chain, which comprises a first hybridization site in the 5' to 3' direction to which a first sequencing primer can bind, a sequence that is at least partially complementary to the first immobilized primer, and a 3' protection feature; and a second chain, which comprises a 5' protection feature in the 5' to 3' direction, a sequence that is identical to at least one region of a second primer, and a second hybridization site to which a second sequencing primer can bind.

[0020] The plurality of nucleic acids may be DNA or genomic DNA (gDNA).

[0021] The method may further comprise: e) contacting the plurality of nucleic acids with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; wherein the non-hairpin adapter comprises a sequence at least partially complementary to the first immobilized primer. Optionally, a nucleic acid amplification step is not performed prior to step e). The substrate may be a flow cell or a bead.

[0022] The non-hairpin adaptor may comprise a sequence identical to at least one region of a second primer and the second primer is immobilized to the substrate. The first and second immobilized primers may be capable of acting as forward and reverse primers for bridge amplification, and wherein the method may comprise bridge amplification.

[0023] The method may further comprise: f) obtaining sequence information of any nucleic acid hybridized to the substrate in step e).

[0024] After steps a), b), c) and d) have been performed, the method may further comprise obtaining sequence information from the prepared library.

[0025] In another aspect, a nucleic acid library obtained or obtainable by a method of the disclosure is provided.

[0026] In another aspect, a nucleic acid library is provided, comprising target nucleic acids having a non-hairpin linker attached to one end and a hairpin at the other end, wherein the nucleic acid library contains less than 99.9%, 99%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 3%, 1%, 0.1% or 0.01% (by mass) or no target nucleic acids having non-hairpin linkers attached to both ends.

[0027] In another aspect, a sequencing method is provided, wherein the method comprises obtaining sequence information of a nucleic acid within a library of the present disclosure.

[0028] In another aspect, a method for obtaining sequencing information is provided, wherein the method comprises:

[0029] 1) contacting the library of the present disclosure with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; and

[0030] 2) Obtaining sequence information of any nucleic acid hybridized to the substrate in step 1).

[0031] In another aspect, use of a nucleic acid library of the present disclosure or a nucleic acid library obtained or obtainable by a method of the present disclosure in a nucleic acid sequencing method is provided.

[0032] In another aspect, a method for preparing a library for nucleic acid sequencing is provided, the method comprising:

[0033] i) providing a plurality of nucleic acids;

[0034] ii) exposing the plurality of nucleic acids to non-hairpin adapters under conditions favorable for ligation; and

[0035] iii) exposing the plurality of nucleic acids to a hairpin adaptor under conditions that favor ligation, or exposing the plurality of nucleic acids to conditions that enable the formation of a hairpin at the end of a nucleic acid molecule;

[0036] wherein the nucleic acid is not amplified during the preparation of the library. Optionally, wherein the method further comprises:

[0037] iv) contacting the plurality of nucleic acids with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid;

[0038] wherein the non-hairpin adaptor comprises a sequence that is at least partially complementary to a first primer immobilized to the substrate; and

[0039] wherein the nucleic acid is not amplified prior to step iv).

[0040] The non-hairpin adaptor may comprise a sequence identical to at least one region of a second primer and the second primer is immobilized to the substrate. The first and second immobilized primers may be capable of acting as forward and reverse primers for bridge amplification, and wherein the method may comprise bridge amplification.

[0041] The method may comprise obtaining sequence information of any nucleic acid hybridised to the substrate in step iv). Steps ii) and iii) may be performed separately, and a fragmentation step may be performed after step ii) and before step iii) or after step iii) and before step ii).

[0042] In another aspect, a nucleic acid library obtained or obtainable by the above method is provided. In another aspect, a sequencing method is provided, wherein the method comprises obtaining sequence information of nucleic acids in the library. In another aspect, a method for obtaining sequencing information is provided, wherein the method comprises: 1) contacting the library with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; and 2) obtaining sequence information of any nucleic acid hybridized to the substrate in step 1). Also provided is the use of the nucleic acid library or the nucleic acid library obtained or obtainable by the method in a nucleic acid sequencing method. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 . An exemplary representation of one embodiment of "DEDUCE-seq" (DuplEx Determination by Unbiased flow Cell Enrichment and sequencing).

[0045] Figure 2 . Schematic representation of sequencing. Due to the ligation of the DNA double strands, the mutation is read twice.

[0046] Figure 3 . Exemplary representation of binding to a matrix (in this case, a flow cell). DNA from Y-adapter ligated fragments is bound to the flow cell and only the hairpin ligated fragments are washed away.

[0047] Figure 4 . An exemplary overview of one embodiment of the method of the present disclosure.

[0048] Figure 5 DEDUCE-seq library preparation for pilot-1; DNA size distribution and quantification. 1) Left panel - Genomic DNA was size selected to approximately 100-500 bp (black trace) by removing DNA >300 bp (grey trace). 2) Middle panel - Ligated DNA (black trace) and re-sonicated DNA (grey trace) were tested by gel electrophoresis. 3) Right panel - Post-sonicated DNA (black trace) and final library DNA of the DEDUCE-seq library are shown here.

[0049] Figure 6 Distribution of HP sequences across the entire length of 9.5M forward reads (left) and reverse reads (right) from pilot-1.

[0050] Figure 7 .Discordant read pairs from a DEDUCE-seq library. Three examples of discordant parallel read pairs from a DEDUCE-seq library are shown here. The leftmost read pair (F1F2, reads are stacked) consists of a left-aligned (read F1, SAM marker 67) and a right-aligned (read F2, SAM marker 131), both mapped to the forward stand. The right read pair (R2R1) consists of a left-aligned (read R2, SAM marker 115) and a right-aligned (read R1, SAM marker 179). Details of the second reverse-aligned read on the right are not shown.

[0051] Figure 8 DEDUCE-seq library preparation for pilot-2; DNA size distribution and quantification. 1) Left panel - Genomic DNA was size selected to approximately 100-500 bp (black trace) by removing DNA >300 bp (grey trace). 2) Middle panel - Y-linker ligated DNA (black trace) and re-sonicated DNA (grey trace) were tested by gel electrophoresis. 3) Right panel - Final library DNA of DEDUCE-seq sample is shown here.

[0052] Fig. 9 .Distribution of hairpin sequences in reads R1 and R2 of DEDUCE-seq library molecules sequenced in pilot-2. DETAILED DESCRIPTION

[0053] The inventors herein provide techniques for preparing nucleic acid libraries suitable for generating error correction sequencing data. When sequencing the nucleic acid libraries of the present disclosure, sequencing information of the two chains of the nucleic acid duplex is provided. This allows error correction, including errors introduced by library preparation or errors occurring as a result of sequencing.

[0054] In a first aspect, a method for preparing a library for nucleic acid sequencing is provided, the method comprising:

[0055] a) providing a plurality of nucleic acids;

[0056] b) exposing the plurality of nucleic acids to a non-hairpin adaptor under conditions favorable for ligation;

[0057] c) fragmenting the plurality of nucleic acids; and

[0058] d) exposing the plurality of nucleic acids to a hairpin adaptor under conditions favorable for ligation or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at the end of a nucleic acid molecule;

[0059] Wherein steps b) and d) are performed separately.

[0060] Steps b) and d) of the method of the first aspect are performed separately, and thus the non-hairpin adapter and the hairpin adapter are not attached to the nucleic acid as part of the same reaction. In other words, steps b) and d) are not performed simultaneously.

[0061] However, as further discussed herein, the adapter ligation and fragmentation steps can be performed simultaneously, in combination, or in parallel. For example, a labeling step can be used to ligate adapters and fragment multiple nucleic acids. Thus, steps b) and c), or steps d) and c) can be performed simultaneously, in combination, or in parallel.

[0062] For all embodiments, after the first adaptor ligation step and before or as part of the second adaptor ligation step, the plurality of nucleic acids are fragmented.

[0063] Steps b), c) and d) of the method of the first aspect may be performed sequentially. The steps of the method may, but need not, be performed in the order of a), b), c) and then d). Specifically, steps b) and d) may be interchanged so that the order may be a), d), c) and then b). The fragmentation step (step c)) may be performed between the connection of one type of linker and the connection of another type of linker. The fragmentation step is performed before or during the second connection of the linker.

[0064] The term "sequentially" as used herein means that the steps are not simultaneous. However, sequential steps are not necessarily continuous, and additional steps may be performed between the explicitly listed steps.

[0065] In other embodiments, the steps may be in the following order: step b) and then steps c) and d) in parallel, in combination or simultaneously. The steps may be in the following order: step d) and then steps c) and b) in parallel, in combination or simultaneously.

[0066] Due to the fact that steps b) and d) are performed separately, the non-hairpin adapter and the hairpin adapter are not attached to the nucleic acid at the same time or as part of the same step. For embodiments in which a hairpin is formed, this process does not occur at the same time or as part of the same step as the attachment of the non-hairpin adapter.

[0067] Therefore, in one embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising:

[0068] a) providing a plurality of nucleic acids;

[0069] b) exposing the plurality of nucleic acids to non-hairpin adapters under conditions that favor ligation to generate a first library;

[0070] c) fragmenting said first library; and

[0071] d) exposing the fragmented first library to a hairpin adapter under conditions favorable for ligation to produce a second library, or exposing the plurality of nucleic acids to conditions capable of forming hairpins at the ends of nucleic acid molecules to produce a second library. The fragmentation of the first library and the generation of the second library may be sequential or simultaneous steps.

[0072] In an alternative embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising:

[0073] a) providing a plurality of nucleic acids;

[0074] b) exposing the plurality of nucleic acids to hairpin adapters under conditions that favor ligation to produce a first library, or exposing the plurality of nucleic acids to conditions that enable the formation of hairpins at the ends of the nucleic acid molecules to produce a first library;

[0075] c) fragmenting said first library; and

[0076] d) exposing the fragmented first library to non-hairpin adapters under conditions that favor ligation to produce a second library. The fragmentation of the first library and the production of the second library may be sequential or simultaneous steps.

[0077] A nucleic acid library is a collection or plurality of nucleic acids to which at least one type of adaptor has been ligated.

[0078] The library provided by the method for the first aspect has a reduced amount of sequenceable nucleic acid, and these nucleic acids will produce only the non-error-correctable sequence information related to one chain of a duplex. Such undesirable nucleic acids include those comprising, for example, non-hairpin adapters connected to nucleic acid ends. This is advantageous because it eliminates the need for enrichment and / or amplification before sequencing or before the step based on substrate. In addition, the quality of the library is improved. The ability to obtain sequence information from the library without the need for amplification steps before sequencing (for example, before contacting the library with substrates such as flow cells) is advantageous, because such a step itself may introduce mutations and deviations. In some embodiments, the library provided by the method for the first aspect has the presence of sequenceable nucleic acid that is significantly reduced, and these nucleic acids will produce only the non-error-correctable sequence information related to one chain of a duplex, for example, being enough to make the library sequenced on substrate without the reduction of enrichment or amplification before being applied to substrate. In some embodiments, it is desirable to produce the library of the first aspect, which does not include sequenceable nucleic acid, and the nucleic acid will produce only the non-error-correctable sequence information related to one chain of a duplex. However, any reduction in their presence (eg rendering amplification unnecessary) is advantageous. Prior art methods leading to libraries containing undesired products are disclosed, for example, in WO 2013 / 142389 A1.

[0079] The provision of multiple nucleic acids can be performed as the first step of the method. This step can include purifying nucleic acids, such as DNA, from a sample. The nucleic acid purified or separated from the sample may be genomic DNA (gDNA). Therefore, the provision of multiple nucleic acids can be the provision of DNA or gDNA molecules to be sequenced, which can be referred to as target nucleic acids. The sample can be a biological sample, such as a sample obtained from a patient or a sample obtained from a biological cell. The sample can be a tissue sample, a biological fluid sample, a cell line, or any other suitable sample. The sample can include normal cells, tumor cells, malignant cells, or cancer cells. The sample can include nucleic acids from normal cells, tumor cells, malignant cells, or cancer cells. The sample can be a tumor sample or a sample of a tissue containing tumor cells or cancer cells. The sample can be blood or a blood portion, such as a plasma portion. The sample can be blood or a blood portion, such as plasma, containing circulating tumor DNA or suspected containing circulating tumor DNA. The sample can contain circulating tumor DNA or suspected containing circulating tumor DNA. The sample can be blood or a blood portion, such as plasma, containing circulating fetal DNA or suspected containing circulating fetal DNA. The sample can contain circulating fetal DNA or suspected containing circulating fetal DNA. The sample may have been genetically modified or gene-edited. For example, the sample may have been subjected to an editing technique capable of inducing DSBs, such as CRISPR-Cas9, TALEN or other nucleases. Thus, the library may be generated to allow detection of off-target mutations induced by the editing technique.

[0080] If necessary due to the nature of the isolated nucleic acid, the nucleic acid can be sheared or fragmented as part of step a). Methods for fragmenting nucleic acids are known in the art and can be, for example, mechanical shearing or enzymatic shearing. The fragmentation can include ultrasonic treatment, for example, using a Bioruptor ultrasonic breaker or a Covaris ultrasonic breaker. The fragmentation can be enzyme-based, and enzyme-based reagents can be used that shear DNA in a time-dependent manner to produce fragments of the desired size. Suitable commercially available reagents include NEBNext dsDNA fragmentase (NEB). The fragmentation can be performed simultaneously with the first linker connection step, for example by labeling. The fragmentation can include the use of a nuclease, for example, an endonuclease, multiple endonucleases, a restriction enzyme or multiple restriction enzymes. The fragmentation can include the use of a nucleic acid-guided endonuclease, such as an RNA-guided DNA endonuclease. The fragmentation can include the use of a Cas protein or a derivative or variant. The fragmentation may comprise the use of Cas9, Cpf1, C2c2, C2c1, CasM, CasMini, retrotransposons, prokaryotic argonautes, TALENs, or meganucleases.

[0081] For all embodiments, it may not be necessary to fragment as part of step a). For example, some nucleic acid sources do not require fragmentation. For example, samples obtained from plasma may not require fragmentation. Alternatively, nucleic acids may contain double strand breaks (DSBs), which may be naturally occurring or induced, and such samples may not require fragmentation in step a). In some embodiments, linkers may be directly attached to DSBs.

[0082] The fragmentation can produce nucleic acid fragments of a specific size or a specific size distribution, and a size selection step can be performed subsequently. The method wherein step a) does not include fragmentation can also include a size selection step. Many systems or reagents for size selection and / or purification steps are known in the art. For example, beads are used for size selection to remove or select fragments of a specific size. The beads can be solid phase reversible immobilization (SPRI) beads. Commercially available beads include "SPRIselect" (Beckman Coulter) or SPRI beads (GC Biotech, CNGS-0005). Capillary DNA electrophoresis can be used for size selection. Capillary DNA electrophoresis can also be used to assess successful connection and the removal of excess adapters. Other alternatives include gel-based electrophoresis size selection steps or systems, for example, including the use of agarose gel or polyacrylamide gel. Suitable systems are commercially available, such as the BluePippin system (Sage Science). Other examples of systems for size selection and / or purification include systems based on DNA extraction columns.

[0083] The method may comprise removing fragments having a size of less than about 100 bp or less than about 150 bp, and / or retaining fragments having a size of greater than about 150 bp.

[0084] In some embodiments, the resulting fragments are 100 to 1500 bp, 200 to 1300 bp, 300 to 1100 bp, 400 to 1000 bp, 500 to 900 bp or 600 to 800 bp. In a specific embodiment, the nucleic acid is a fragment of about 600 to 800 bp in size.

[0085] Thus, in one embodiment, step a) may be as follows:

[0086] a) providing a plurality of nucleic acids; wherein said providing comprises:

[0087] i) isolating a plurality of nucleic acids from a sample;

[0088] ii) fragmenting the plurality of nucleic acids; and

[0089] iii) selecting fragments of the plurality of nucleic acids based on size.

[0090] The fragmented nucleic acid can be treated to be suitable for linker ligation. For example, a binding feature or multiple binding features can be added to the nucleic acid. The binding feature can include a 5' feature and / or a 3' feature. The binding feature can be any binding feature suitable for promoting linker ligation.

[0091] For example, the 5' or 3' binding feature can comprise one of: a phosphate group; a triphosphate "T-tail", such as a deoxythymidine triphosphate "T-tail"; a triphosphate "A-tail", such as a deoxyadenosine triphosphate "A-tail"; at least one random N nucleotide, such as a plurality of N nucleotides, or any other known binding group to allow attachment of a linker to a nucleic acid.

[0092] In a specific embodiment, the fragmented nucleic acid is blunt-ended and carries an A-tail. Thus, a 5' phosphate and / or a 3' A-tail may be added to the fragmented nucleic acid.

[0093] Thus, in one embodiment, step a) may be as follows:

[0094] a) providing a plurality of nucleic acids; wherein said providing comprises:

[0095] i) isolating a plurality of nucleic acids from a sample;

[0096] Optionally ii) fragmenting the plurality of nucleic acids;

[0097] Optionally iii) selecting fragments of said plurality of nucleic acids based on size; and

[0098] iv) adding 5' and / or 3' binding features to said plurality of nucleic acids.

[0099] Steps i), ii), iii) and iv) can be performed in the order i), ii), iii) and then iv). However, any order can be followed that allows the preparation of multiple nucleic acids suitable for the downstream steps disclosed herein. For example, the order can be i), ii), iv) and then iii).

[0100] In a specific non-limiting embodiment, step a) may be as follows:

[0101] a) providing a plurality of nucleic acids; wherein said providing comprises:

[0102] i) isolating a plurality of nucleic acids from a sample, wherein the plurality of nucleic acids is gDNA;

[0103] ii) fragmenting the separated plurality of nucleic acids;

[0104] iii) selecting fragments of the plurality of nucleic acids based on size;

[0105] iii) blunting the ends of the selected nucleic acid; and

[0106] iv) adding an A-tail to the blunt-ended nucleic acid.

[0107] In another non-limiting embodiment, step a) may be as follows:

[0108] a) providing a plurality of nucleic acids; wherein said providing comprises:

[0109] i) isolating a plurality of nucleic acids from a sample, wherein the plurality of nucleic acids is gDNA;

[0110] ii) fragmenting the separated plurality of nucleic acids;

[0111] iii) selecting fragments of the plurality of nucleic acids based on size;

[0112] iii) blunting the ends of the selected nucleic acid and 5' phosphorylating the nucleic acid; and

[0113] iv) adding an A-tail to the blunt-ended nucleic acid.

[0114] In other embodiments, step a) comprises fragmentation of the nucleic acid and ligation of adapters. For example, a labeling step. The ligated adapters can be the non-hairpin adapters or the hairpin adapters, depending on the order in which the steps are performed.

[0115] Step a) and step b) can be combined as follows:

[0116] i) isolating a plurality of nucleic acids from a sample; and

[0117] ii) fragmenting and ligating non-hairpin adaptors to the plurality of nucleic acids; and

[0118] Optionally iii) selecting fragments of said plurality of nucleic acids based on size.

[0119] Alternatively, step a) and step d) may be combined as follows:

[0120] i) isolating a plurality of nucleic acids from a sample; and

[0121] ii) fragmenting and ligating hairpin adaptors to the plurality of nucleic acids; and

[0122] Optionally iii) selecting fragments of said plurality of nucleic acids based on size.

[0123] In one embodiment, step a) and step b) are combined as follows:

[0124] 1) providing a plurality of nucleic acids; and

[0125] 2) exposing the plurality of nucleic acids to non-hairpin linkers under conditions that favor ligation and fragmentation.

[0126] In another embodiment, step a) and step d) are combined as follows:

[0127] 1) providing a plurality of nucleic acids; and

[0128] 2) exposing the plurality of nucleic acids to hairpin adaptors under conditions that favor ligation and fragmentation.

[0129] In some embodiments, at least one type of linker is connected in situ. In this case, step a) may include permeabilization of a cell or tissue sample. For example, step a) may include exposing the sample to a permeabilizing agent. After connecting the linker, nucleic acids, such as DNA or gDNA, may be isolated from the sample. In these embodiments, the linker may be connected to a DSB. The DSB may be naturally occurring or induced.

[0130] Step b) comprises exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to connection. Thus, in some embodiments, the non-hairpin adapter will be connected to the available or unprotected ends of the nucleic acid. In embodiments where step b) is performed before step d), this will result in the non-hairpin adapter being connected to both ends of at least a portion of the plurality of nucleic acids. In embodiments where step b) is performed after step d), this will result in the non-hairpin adapter being connected to the ends of the nucleic acid where a hairpin is not present.

[0131] As discussed, step b) can be performed separately from or simultaneously with fragmentation. In embodiments where step b) is performed simultaneously with fragmentation, this can be the fragmentation of step a), and therefore as part of the initial library preparation, or, if step b) is performed after step d), step b) can be combined with step c) (i.e., fragmentation occurs after the first adapter ligation step). "Non-hairpin adapters" are adapters that do not contain hairpin loops. For example, the non-hairpin adapter will not contain a single nucleic acid chain that forms a duplex due to hybridization of a portion of the single nucleic acid chain with another portion of the same single nucleic acid chain. A double-stranded non-hairpin adapter can contain two separate nucleic acid chains that can form a duplex due to hybridization between at least a portion of one chain and at least a portion of the other chain.

[0132] In some embodiments, the non-hairpin adapter is or comprises a nucleic acid. In some embodiments, the non-hairpin adapter is or comprises a DNA, an RNA and / or a heterologous nucleic acid (XNA). The non-hairpin adapter may comprise modified and / or unmodified nucleotides. In some embodiments, the non-hairpin adapter is double-stranded. In a specific embodiment, the non-hairpin adapter comprises double-stranded DNA.

[0133] The non-hairpin adapter can include a sequence that can be combined with a primer fixed to a substrate by hybridization. For example, the non-hairpin adapter can include a sequence that is at least partially complementary to a primer fixed to a substrate. In certain embodiments, the sequence can be referred to as a hybridization site of a primer of a flow cell primer or a bead combination. In such an embodiment, the method can be a library preparation method for nucleic acid sequencing, wherein the preparation includes modified nucleic acids to be suitable for being combined to a substrate comprising an immobilized primer. The length of the complementary region can be 5, 10, 15, 20, 21, 22, 23, 24 or more bases. Alternatively, the complementary region can include 5, 10, 15, 20, 21, 22, 23, 24 or more complementary bases.

[0134] The non-hairpin adapter may comprise a sequence identical to at least a portion or all of a second primer. The second primer may be immobilized to the substrate or may be in solution. The length of the identical region may be 5, 10, 15, 20, 21, 22, 23, 24 or more bases. The first primer and the second primer may be configured to allow nucleic acid to be amplified on the substrate.

[0135] In certain embodiments, the non-hairpin adapter is connected as a complete adapter. Therefore, in these embodiments, no additional steps need to be performed to add the features of the adapter. Therefore, the non-hairpin adapter can be connected to the multiple nucleic acids as a complete adapter without the need for a polymerase step or the step of adding or filling any nucleic acid sequence. Specifically, the non-hairpin adapter can be connected to the multiple nucleic acids as a molecule comprising a sequence that can hybridize with the substrate and a sequence that can achieve amplification on the substrate.

[0136] In a preferred embodiment, the non-hairpin adapter is a Y-adapter. A "Y-adapter" comprises two strands that are only partially complementary, such that the Y-adapter comprises a portion that includes two non-complementary single strands and a double-stranded complementary portion (e.g., forming a "Y" shape). The end of the double-stranded portion can be connected to another nucleic acid, and due to the single-stranded portion, this can result in one sequence being connected to the 5' end of the nucleic acid, and a different sequence being connected to the 3' end of the nucleic acid.

[0137] For example, the Y-linker can include a first nucleic acid (e.g., DNA) strand and a second nucleic acid (e.g., DNA) strand. In one embodiment, the first strand includes a portion complementary to the second strand and a portion not complementary to the second strand in the 5' to 3' direction; and the second strand includes a portion not complementary to the first strand and a portion complementary to the first strand in the 5' to 3' direction.

[0138] In a specific embodiment, the Y-linker is connected as a complete linker. Therefore, in these embodiments, it is not necessary to perform other steps to add the characteristics of the Y-linker. Therefore, the Y-linker can be connected to the multiple nucleic acids as a complete linker without the need for a polymerase step or the step of adding or filling any nucleic acid sequence. Specifically, the Y-linker can be connected to the multiple nucleic acids as a molecule, and the molecule comprises a sequence that can hybridize with the substrate and a sequence that can realize amplification on the substrate.

[0139] Y-linkers are known in the art. For example, the Y-linker can be an Illumina Y-linker comprising a P5 binding sequence and a P7 binding sequence. In one embodiment, the Y-linker comprises the sequence GTGTAGATCTCGGTGGTCGCCGTATCATT (SEQ ID NO: 1) and / or the sequence CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 2). In another embodiment, the Y-linker comprises the sequence ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 3) and / or AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 4). In one embodiment, the Y-linker comprises at least 5, 10, 15, 16, 17, 18, 19, 20 or all 21 bases of SEQ ID NO: 1. In one embodiment, the Y-linker comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO: 2. In one embodiment, the Y-linker comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO: 3. In one embodiment, the Y-linker comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO: 4. In one embodiment, the Y-linker comprises at least 5, 10, 15, 16, 17, 18, 19, 20 or all 21 bases of SEQ ID NO: 1 and at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO: 2. In one embodiment, the Y-linker comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO: 3 and at least 5, 10, 15, 16, 17, 18, 19 or all 20 bases of SEQ ID NO: 4. The Y-linker may comprise enough bases of any one of SEQ ID NOs: 1 to 4 to allow hybridization with a complementary primer.

[0140] The Y-linker may include a sequence that can be combined with the first primer by hybridization and an optional sequence that can be combined with the second primer by hybridization. The first primer and the second primer may be used for clonal amplification of nucleic acid, for example, by bridge amplification. The Y-linker may include a sequence that can be combined with the first primer fixed to the substrate by hybridization and a sequence identical to at least a portion or all of the second primer fixed to the substrate. For example, the Y-linker may include a sequence that is at least partially complementary to the first primer fixed to the substrate. A sequence that is at least partially complementary to the first immobilized primer and a sequence identical to at least a portion of the second immobilized primer may be present on different chains of the Y-linker so that they form at least a portion of the non-complementary portion of the Y-linker. In these embodiments, the method may be a library preparation method for nucleic acid sequencing, wherein the preparation includes modified nucleic acids to be suitable for binding to a substrate comprising a first type of immobilized primer and a second type of immobilized primer. In such an embodiment, the complementary portion of the first immobilized primer and the Y-linker and the same portion of the second immobilized primer and the Y-linker may be suitable for performing bridge amplification of a target nucleic acid.

[0141] Thus, in one embodiment, the Y-linker comprises: a first strand comprising a sequence at least partially complementary to a first primer fixed to a substrate; and a second strand comprising a sequence identical to at least one region of a second primer fixed to a substrate. In one embodiment, the Y-linker comprises: a first strand comprising at least 5, 10, 15, 16, 17, 18, 19, 20 or all 21 bases of SEQ ID NO: 1; and a second strand comprising at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO: 2. In one embodiment, the Y-linker comprises: a first strand comprising at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO: 3; and a second strand comprising at least 5, 10, 15, 16, 17, 18, 19 or all 20 bases of SEQ ID NO: 4. In one embodiment, the Y-linker comprises: a first strand comprising a sequence according to SEQ ID NO: 1; and a second strand comprising a sequence according to SEQ ID NO: 2. In one embodiment, the Y-linker comprises: a first strand comprising a sequence according to SEQ ID NO: 3; and a second strand comprising a sequence according to SEQ ID NO: 4.

[0142] In other embodiments, the Y-linker may comprise a sequence capable of binding to a first primer immobilized to a substrate by hybridization and a sequence identical to at least a portion of a second primer not immobilized to a substrate. In one embodiment, the substrate may be a bead.

[0143] The non-hairpin adapter may include a hybridization site to which a sequencing primer may bind. The non-hairpin adapter may include a first hybridization site to which a first sequencing primer may bind and a second hybridization site to which a second sequencing primer may bind. The first hybridization site and the second hybridization site may be present on different chains of the non-hairpin adapter. The first and second hybridization sites may be at least partially complementary.

[0144] Thus, in one embodiment, the non-hairpin linker (e.g., a Y-linker) may comprise: a first strand comprising a first hybridization site to which a first sequencing primer can bind; and a second strand comprising a second hybridization site to which a second sequencing primer can bind.

[0145] Examples of suitable hybridization sites are provided herein as SEQ ID NO:5-8. These sequences are purely exemplary. SEQ ID NO:5-8 can each comprise 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2 or 1 modification such as displacement, deletion or insertion. In one embodiment, the modification is displacement. However, it will be appreciated by the skilled person that any modification is acceptable as long as the homologous primers for sequencing can be complementary modified, or as long as the modification does not affect the hybridization and function of the homologous primers.

[0146] In an embodiment in which the non-hairpin linker comprises a sequence capable of binding to a primer fixed to a substrate by hybridization and a hybridization site to which a sequencing primer can bind, after ligation, the linker can be oriented so that the sequence capable of binding to a primer fixed to a substrate by hybridization is located closer to the end and the hybridization site to which a sequencing primer can bind is located closer to the ligation site.

[0147] In a specific embodiment, the non-hairpin adaptor is a Y-adapter comprising:

[0148] a first strand comprising, in the 5' to 3' direction, a first hybridization site to which a first sequencing primer can bind, and a sequence at least partially complementary to the first immobilized primer; and

[0149] A second strand comprising in the 5' to 3' direction the same sequence as the second immobilized primer and a second hybridization site to which the second sequencing primer can bind. The first and second hybridization sites may be at least partially complementary.

[0150] The non-hairpin adapter may comprise one or more 5' and / or 3' binding features. The binding feature may be any one suitable for facilitating the connection of the adapter. For example, the 5' or 3' binding feature may comprise one of: a phosphate group; a triphosphate "T-tail", such as a deoxythymidine triphosphate "T-tail"; a triphosphate "A-tail", such as a deoxyadenosine triphosphate "A-tail"; at least one random N-nucleotide, such as a plurality of N-nucleotides, or any other known binding group to allow the adapter to be connected to the nucleic acid. In a specific embodiment, the 5' binding feature is a phosphate group and the 3' binding feature is a T-tail.

[0151] In a specific embodiment, the non-hairpin adapter (eg, a Y-adapter) comprises a first strand comprising a 5' binding feature, such as a phosphate group, and a second strand comprising a 3' binding feature, such as a T-tail.

[0152] The non-hairpin adapter may comprise one or more 5' and / or 3' protection features, particularly in embodiments where step b) is performed before step d). The protection feature may be any feature that can prevent another adapter from connecting to the protected adapter. For example, the one or more protection features may prevent the connection of a hairpin adapter to a non-hairpin adapter. The non-hairpin adapter may comprise two different end protection features. Not all embodiments require protection features, for example, embodiments with a marker feature may not require the presence of a protection feature.

[0153] In a specific embodiment, the non-hairpin linker (e.g., a Y-linker) comprises: a first strand comprising a sequence at least partially complementary to a first primer fixed to a substrate and a 3' protection feature; and a second strand comprising a sequence identical to at least a region of a second primer fixed to a substrate and a 5' protection feature.

[0154] The 5' and / or 3' protection features can include features that provide resistance to any one or more of the following: phosphorylation activity, phosphatase activity, terminal transferase activity, nucleic acid hybridization, endonuclease activity, exonuclease activity, ligase activity, polymerase activity and protein binding. This can be achieved by any means known to those skilled in the art, such as, but not limited to, thiophosphate bonds, phosphoramidite spacers, phosphate groups, 2'-O-methyl groups, reverse deoxy and dideoxy-T modifications, locked nucleic acid bases, dideoxynucleotides, etc. The protection feature can be a C3 spacer phosphoramidite (3SpC3). Examples of the activities provided by these features are shown in Table 1.

[0155] In a specific embodiment, the non-hairpin adapter comprises a 5' inverted ddT and a 3' C3 spacer phosphoramidite. In one embodiment, the non-hairpin adapter is a Y-adapter comprising a 5' inverted ddT and a 3' C3 spacer phosphoramidite.

[0156] In a specific embodiment, the non-hairpin linker (eg, a Y-linker) comprises a first strand comprising a 3' protection feature, eg, a C3 spacer phosphoramidite, and a second strand comprising a 5' protection feature, eg, an inverted ddT.

[0157] In a specific embodiment, the non-hairpin adapter is a Y-adapter comprising: a first strand comprising a first hybridization site in the 5' to 3' direction to which a first sequencing primer can bind, a sequence at least partially complementary to a first immobilized primer, and a 3' protection feature (e.g., a C3 spacer phosphoramidite); and a second strand comprising a 5' protection feature in the 5' to 3' direction (e.g., reverse ddT), a sequence identical to at least one region of a second immobilized primer, and a second hybridization site to which a second sequencing primer can bind. Optionally, the first and second hybridization sites are at least partially complementary.

[0158] In a specific embodiment, the non-hairpin adapter is a Y-adapter comprising: a first strand comprising a 5' binding feature (e.g., a phosphate group), a first hybridization site to which a first sequencing primer can bind, a sequence at least partially complementary to a first immobilized primer, and a 3' protection feature (e.g., a C3 spacer phosphoramidite) in the 5' to 3' direction; and a second strand comprising a 5' protection feature (e.g., reverse ddT), a sequence identical to at least one region of a second immobilized primer, a second hybridization site to which a second sequencing primer can bind, and a 3' binding feature (e.g., a T-tail) in the 5' to 3' direction. Optionally, the first and second hybridization sites are at least partially complementary.

[0159] The non-hairpin adapter may optionally include an index sequence, which may be referred to as a barcode. The index sequence may allow identification of a sequence from a particular sample. For example, different samples may be merged before sequencing, and the index may allow identification of the sample from which the sequence originated later. This may be referred to as demultiplexing after sequencing. The index sequence may be positioned so that it may be read during sequencing, for example, it may be positioned at the 3' side of the hybridization site of a sequencing primer. The index sequence may be a sequence of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or more nucleotides in length. The index sequence may be a known sequence of at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 20 or more nucleotides in length. The index sequence may be a random sequence of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or more nucleotides in length. The index sequence may be a degenerate or semi-degenerate sequence. The index sequence can be 5 to 10 base pairs in length. The index can be 5 or 7 nucleotides long. The index sequence can be present on both strands of the double-stranded portion of the adapter and can be complementary. The non-hairpin adapter can contain two indexes for dual-index sequencing.

[0160] The non-hairpin adapter may optionally include a single molecule identifier (SMI). Examples of SMIs are disclosed in WO2013 / 142389 (incorporated herein by reference). The SMI may allow identification of amplified nucleic acid molecules that have been derived from a single parent molecule. The SMI sequence may be a double-stranded, complementary SMI sequence or a single-stranded SMI sequence. The SMI sequence may be degenerate or semi-degenerate, and may be a random degenerate sequence. A double-stranded SMI sequence may include a first degenerate or semi-degenerate nucleotide n-polymer sequence and a second n-polymer sequence complementary to the first degenerate or semi-degenerate nucleotide n-polymer sequence, while a single-stranded SMI sequence may include a first degenerate or semi-degenerate nucleotide n-polymer sequence. The first and / or second degenerate or semi-degenerate nucleotide n-polymer sequence may be of any suitable length to produce a sufficiently large number of unique tags to mark a group of sheared DNA fragments from a DNA segment. Each n-polymer sequence may be approximately 3 to 20 nucleotides in length. Thus, each n-mer sequence can be about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides in length. In one embodiment, the SMI sequence is a random degenerate nucleotide n-mer sequence that is 12 nucleotides in length. Inclusion of an SMI sequence is not essential for the present invention, as no nucleic acid amplification step is required prior to binding to the matrix. Thus, in some embodiments, the non-hairpin linker does not comprise an SMI sequence.

[0161] The Y-linker may comprise the sequence GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (SEQ ID NO:5), an index, and SEQ ID NO:1, and these features may be arranged in the order described from 5' to 3'. The index may be seven bases long. The Y-linker may comprise the sequence SEQ ID NO:2, an index, and the sequence GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:6), and these features may be arranged in the order described from 5' to 3'. The index may be five bases long.

[0162] The Y-linker may comprise the sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (SEQ ID NO:7), an index, and SEQ ID NO:3, and these features may be arranged in the order described from 5' to 3'. The index may be seven bases long. The Y-linker may comprise SEQ ID NO:4, an index, and ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:8), and these features may be arranged in the order described from 5' to 3'. The index may be five bases long.

[0163] In a specific embodiment, the non-hairpin adaptor is a Y-adapter comprising:

[0164] a first strand comprising, in the 5' to 3' direction, SEQ ID NO: 5, an optional index, and SEQ ID NO: 1; and

[0165] The second strand comprises, in the 5' to 3' direction, SEQ ID NO: 2, an optional index and SEQ ID NO: 6. SEQ ID NO: 1, 2, 5 and 6 may each comprise 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2 or 1 modification such as a substitution, deletion or insertion. In one embodiment, the modification is a substitution.

[0166] In a specific embodiment, the non-hairpin adaptor is a Y-adapter comprising:

[0167] a first strand comprising, in the 5' to 3' direction, SEQ ID NO: 7, an optional index, and SEQ ID NO: 3; and

[0168] The second strand comprises, in the 5' to 3' direction, SEQ ID NO: 4, an optional index and SEQ ID NO: 8. SEQ ID NOs: 3, 4, 7 and 8 may each comprise 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2 or 1 modification such as a substitution, deletion or insertion. In one embodiment, the modification is a substitution.

[0169] Under conditions that are conducive to the connection of the linker to the nucleic acids in the multiple nucleic acids, the non-hairpin linker is provided to the multiple nucleic acids. The conditions can vary according to the nature of the ligation reaction and the binding characteristics of the non-hairpin linker and the binding characteristics of the multiple nucleic acids. For example, the conditions can promote the connection between two double-stranded nucleic acids, each of which contains a 5' phosphate, and one of which contains a 3' A-tail and the other contains a 3' T-tail. Other suitable methods and necessary conditions for connecting the linker to the nucleic acid are known in the art. A purification step may be included after the linker connection. This step can remove excess linker molecules. The linker connection can be by a technology that also contains fragmentation (e.g., labeling).

[0170] In the embodiment where step b) is performed before step d), the ligation reaction causes a non-hairpin adapter to be connected to the two ends of at least a portion of a plurality of nucleic acids. This can be referred to as the first library. In the embodiment where the non-hairpin adapter is a Y-adapter, the first library comprises a fragment of the nucleic acid to be sequenced, wherein the Y-adapter is connected to each end of at least a portion of the fragment. Therefore, the first nucleic acid sequence can be connected to the 5' end of the chain in the fragment, and the second nucleic acid sequence can be connected to the 3' end of the chain in the fragment.

[0171] In the embodiment where step b) is performed after step d), the ligation reaction causes the non-hairpin adapter to be connected to the nucleic acid end where there is no hairpin. Therefore, at least a portion of the nucleic acid to be sequenced comprises a hairpin at one end and a non-hairpin adapter at the other end. This can be referred to as the second library. In the embodiment where the non-hairpin adapter is a Y-adapter, the second library comprises fragments of the nucleic acid to be sequenced, wherein at least a portion of the fragment comprises a Y-adapter connected to one end and a hairpin connected to the other end.

[0172] Step c) comprises fragmenting the plurality of nucleic acids and can be performed after step b) or step d). Step c) is applied to the first library and is performed before or during the formation of the second library.

[0173] Methods for nucleic acid fragmentation are known in the art, and can be, for example, mechanical shearing or enzymatic shearing. The fragmentation can include ultrasonic treatment, for example, using a Bioruptor ultrasonic breaker or a Covaris ultrasonic breaker. The fragmentation can be enzyme-based, and can utilize an enzyme-based reagent that shears DNA in a time-dependent manner to produce fragments of a desired size. Suitable commercially available reagents include NEBNext dsDNA fragmentase (NEB). The fragmentation can be performed simultaneously with the second linker connection step, for example, by labeling. The fragmentation may cause double-strand breaks in multiple nucleic acids. The fragmentation may not be site-specific, and therefore may induce random breaks, such as random double-strand breaks. The fragmentation causes double-strand breaks to which the linker can be connected, optionally after end repair or similar steps. The fragmentation may cause double-strand breaks to which the linker can be connected, without the need to utilize a chain as a previous step based on a polymerase as a template. In some embodiments, the fragmentation does not include the use of a site-specific nickase. In some embodiments, the fragmentation does not comprise using a site-specific nickase to generate single-stranded portions that are then repaired using a template-based polymerase.

[0174] The fragmentation may comprise the use of a nuclease, e.g., an endonuclease, a plurality of endonucleases, a restriction enzyme or a plurality of restriction enzymes. The fragmentation may comprise the use of a nucleic acid-guided endonuclease, such as an RNA-guided DNA endonuclease. The fragmentation may comprise the use of a Cas protein or derivative or variant. The fragmentation may comprise the use of Cas9, Cpf1, C2c2, C2c1, CasM, CasMini, a retrotransposon, a prokaryotic argonaute, a TALEN, or a meganuclease.

[0175] The fragmentation can produce nucleic acid fragments with a specific size or with a specific size distribution, and a size selection step can be performed subsequently. Many systems or reagents for size selection and / or purification steps are known in the art. For example, beads are used to perform size selection to remove or select fragments of a specific size. The beads can be solid phase reversible immobilization (SPRI) beads. Commercially available beads include "SPRIselect" (Beckman Coulter) or SPRI beads (GCBiotech, CNGS-0005). Capillary DNA electrophoresis can be used for size selection. Capillary DNA electrophoresis can also be used to assess successful connection and the removal of excess adapters. Other alternatives include gel-based electrophoresis size selection steps or systems, such as including the use of agarose gels or polyacrylamide gels. Suitable systems are commercially available, such as the BluePippin system (Sage Science). Other examples of systems for size selection and / or purification include systems based on DNA extraction columns.

[0176] If the sample was fragmented before or during the first linker ligation, step c) may comprise selecting fragments that are approximately half the size of the previous fragmentation step.

[0177] Step c) may comprise removing fragments having a size of less than about 100 bp or less than about 150 bp, and / or retaining fragments having a size of greater than about 150 bp.

[0178] In some embodiments, the resulting fragment is 100 to 700bp, 150 to 650bp, 200 to 600bp, 250 to 550bp, 300 to 500bp or 350 to 450bp. In some embodiments, the resulting fragment is 150 to 600bp, 200 to 550bp, 250 to 500bp, 275 to 450bp or 300 to 400bp.

[0179] The fragmented nucleic acids can be treated to be suitable for linker ligation. For example, a binding feature or multiple binding features can be added to the nucleic acid. The binding feature can include a 5' feature and / or a 3' feature. The binding feature can be any one suitable for facilitating the connection of linkers, including any binding feature disclosed herein. If step b) is performed to generate the first library, then due to the presence of the protection feature on the non-hairpin linker, the binding feature may not be added to the non-hairpin linker.

[0180] In a specific embodiment, the fragmented nucleic acid is blunt-ended and carries an A-tail. Thus, a 5' phosphate and / or a 3' A-tail may be added to the fragmented nucleic acid.

[0181] Therefore, in one embodiment, step c) may be as follows:

[0182] c) fragmenting the plurality of nucleic acids; and further comprising:

[0183] Optionally i) selecting fragments of said plurality of nucleic acids based on size; and

[0184] ii) adding 5' and / or 3' binding features to the plurality of nucleic acids.

[0185] Steps i) and ii) may be performed in the order i) and then ii). However, any order may be followed which allows for the preparation of multiple nucleic acids suitable for the downstream steps disclosed herein.

[0186] In a specific non-limiting embodiment, step c) may be as follows:

[0187] c) fragmenting the plurality of nucleic acids; and further comprising:

[0188] i) selecting fragments of the plurality of nucleic acids based on size;

[0189] ii) blunting the ends of the selected nucleic acid; and

[0190] iii) adding an A-tail to the blunt-ended nucleic acid.

[0191] In other embodiments, step c) comprises the steps of fragmenting the nucleic acid and connecting adapters. For example, a labeling step. The connected adapters can be the non-hairpin adapters or the hairpin adapters, depending on the order in which the steps are performed.

[0192] Therefore, step c) and step b) can be combined as follows:

[0193] i) fragmenting and ligating non-hairpin adapters to the plurality of nucleic acids; and

[0194] Optionally ii) selecting fragments of said plurality of nucleic acids based on size.

[0195] Alternatively, step c) and step d) may be combined as follows:

[0196] i) fragmenting and ligating hairpin adapters to the plurality of nucleic acids; and

[0197] Optionally ii) selecting fragments of said plurality of nucleic acids based on size.

[0198] In other embodiments, step c) may comprise a labelling step of inserting a recognition site into the fragmented nucleic acid. For example, a recognition site of an enzyme capable of forming a hairpin, such as protelomerase. The protelomerase may be TelN.

[0199] In some embodiments, step d) comprises exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to connection. Thus, the hairpin adapter will be connected to the available end or unprotected end of the nucleic acid. In embodiments where step d) is performed before step b), this will result in the hairpin adapter being connected to both ends of at least a portion of the plurality of nucleic acids. In embodiments where step d) is performed after step b), this will result in the non-hairpin adapter being connected to the ends of the nucleic acids to which the hairpin adapter is not connected.

[0200] In other embodiments, step d) comprises exposing the multiple nucleic acids to conditions that can form hairpins at the nucleic acid molecule ends. For example, step d) can comprise using conditions or enzymes that can produce covalently closed ends in double-stranded nucleic acid molecules. An example of a suitable enzyme is protelomerase, such as TelN. The TelN recognition sequence can be present in multiple nucleic acids, or can have been introduced into multiple nucleic acids. For example, the TelN recognition sequence can be introduced as a fragmented part by labeling.

[0201] As discussed, step d) can be performed separately from or simultaneously with fragmentation. In embodiments where step d) is performed simultaneously with fragmentation, this can be the fragmentation of step a) and thus part of the initial library preparation, or, if step d) is performed after step b), step d) can be combined with step c) (i.e., fragmentation occurs after the first linker ligation step).

[0202] A "hairpin" adapter comprises a hairpin loop. A hairpin adapter may comprise a single nucleic acid strand that forms a duplex by hybridization of a portion of the single nucleic acid strand with another portion of the same single nucleic acid strand. Hairpin adapters are known in the art. Hairpin adapters may be referred to as "U-adapters".

[0203] A double-stranded nucleic acid having a hairpin at only one end can be denatured to form a unit single-stranded molecule comprising both strands of the original double-stranded nucleic acid.

[0204] In some embodiments, the hairpin adapter is or comprises a nucleic acid. In some embodiments, the hairpin adapter is or comprises DNA, RNA and / or XNA. The hairpin adapter may comprise modified and / or unmodified nucleotides. In a specific embodiment, the hairpin adapter comprises DNA.

[0205] A non-limiting example of a hairpin linker is: GGGCCTADDDDDDDDTAGGCCCT (SEQ ID NO:9), wherein D is G, A, or T (but not C).

[0206] Hairpin adapters can be provided to multiple nucleic acids under conditions that are conducive to the connection of the adapter to nucleic acids in multiple nucleic acids. The conditions can vary depending on the nature of the ligation reaction and the binding characteristics of non-hairpin adapters and the binding characteristics of multiple nucleic acids. For example, the conditions can promote the connection between two double-stranded nucleic acids, each of which contains a 5' phosphate, and one of which contains a 3' A-tail and the other contains a 3' T-tail. Other suitable methods and necessary conditions for connecting the adapter to nucleic acids are known in the art. A purification step may be included after the adapter is connected. This step can remove excess adapter molecules.

[0207] In the embodiment where step d) is performed before step b), step d) causes the hairpin adapter to be connected to the two ends of at least a portion of a plurality of nucleic acids, or forms a hairpin at the two ends of at least a portion of a plurality of nucleic acids. This can be referred to as the first library. In such an embodiment, the method may include the step of removing any linear nucleic acid. This step may result in retaining only nucleic acids with hairpins at both ends, which are essentially nucleic acid loops.

[0208] In an embodiment where step d) is performed after step b), step d) results in the attachment of a hairpin adapter to the end of the nucleic acid to which a non-hairpin adapter is not attached, or the formation of a hairpin at the end of the nucleic acid to which a non-hairpin adapter is not attached. Thus, at least a portion of the nucleic acid to be sequenced comprises a hairpin at one end and a non-hairpin adapter at the other end. This may be referred to as a second library.

[0209] As discussed, step d) can be performed separately from or simultaneously with fragmentation. In embodiments where step d) is performed simultaneously with fragmentation, this can be the fragmentation of step a) and thus as part of the initial library preparation, or, if step d) is performed after step b), step d) can be combined with step c) (i.e., fragmentation occurs after the first linker ligation step).

[0210] In one embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising the following steps in order:

[0211] providing a plurality of nucleic acids;

[0212] exposing the plurality of nucleic acids to a non-hairpin adaptor under conditions favorable for ligation;

[0213] fragmenting the plurality of nucleic acids; and

[0214] The plurality of nucleic acids are exposed to hairpin linkers under conditions favorable for ligation.

[0215] In one embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising the following steps in order:

[0216] providing a plurality of nucleic acids;

[0217] exposing the plurality of nucleic acids to a non-hairpin adaptor under conditions favorable for ligation;

[0218] fragmenting the plurality of nucleic acids; and

[0219] The plurality of nucleic acids is exposed to conditions capable of forming hairpins at the ends of the nucleic acid molecules.

[0220] In another embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising the following steps in order:

[0221] providing a plurality of nucleic acids;

[0222] exposing the plurality of nucleic acids to non-hairpin adapters under conditions favorable for ligation; and

[0223] The plurality of nucleic acids are exposed to hairpin adaptors under conditions that favor ligation and fragmentation.

[0224] In one embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising the following steps in order:

[0225] providing a plurality of nucleic acids;

[0226] exposing the plurality of nucleic acids to a hairpin adaptor under conditions favorable for ligation;

[0227] fragmenting the plurality of nucleic acids; and

[0228] The plurality of nucleic acids are exposed to non-hairpin linkers under conditions favorable for ligation.

[0229] In one embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising the following steps in order:

[0230] providing a plurality of nucleic acids;

[0231] exposing the plurality of nucleic acids to conditions capable of forming hairpins at the ends of the nucleic acid molecules;

[0232] fragmenting the plurality of nucleic acids; and

[0233] The plurality of nucleic acids are exposed to non-hairpin linkers under conditions favorable for ligation.

[0234] In another embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising the following steps in order:

[0235] providing a plurality of nucleic acids;

[0236] exposing the plurality of nucleic acids to a hairpin adaptor under conditions favorable for ligation; and

[0237] The plurality of nucleic acids are exposed to non-hairpin linkers under conditions that favor ligation and fragmentation.

[0238] In some embodiments, the method may further comprise contacting the plurality of nucleic acids (which at this stage may be referred to as a second library) with a matrix comprising immobilized primers under conditions suitable for hybridization of a portion of the non-hairpin linker to at least a portion of the immobilized primers.

[0239] Any nucleic acid lacking a ligated non-hairpin adapter will not hybridize to the flow cell. For example, any nucleic acid including hairpin adapters at both ends.

[0240] The substrate can be a solid surface such as a flow cell, a bead, a slide or a membrane. Specifically, the substrate can be a flow cell. The substrate can be a patterned or non-patterned flow cell. The substrate can comprise glass, quartz, silicon dioxide, metal, ceramic or plastic. The substrate surface can comprise a polyacrylamide substrate or a coating.

[0241] As used herein, the term "flow cell" is intended to have its ordinary meaning in the art, particularly in the field of synthetic sequencing. Exemplary flow cells include, but are not limited to, flow cells used in nucleic acid sequencing devices, such as those used in the Genome Sequencing System commercialized by Illumina, Inc. (San Diego, Calif.). or or for SOLiD commercialized by Life Technologies (Carlsbad, Calif.) TM or Ion Torrent TM Flow cells for sequencing platforms. Exemplary flow cells and methods of making and using the same are also described in, for example, WO 2014 / 142841 A1, US Patent Application Publication No. 2010 / 0111768 A1, and US Patent No. 8,951,781.

[0242] The substrate can include immobilized primers, for example, two types of primers that can act together as a forward primer and a reverse primer for bridge amplification. Being fixed to a "substrate" means that the primer is bound to the substrate even under conditions that denature the double-stranded nucleic acid. For example, the primer can be covalently bound to the substrate. The primer is oriented so that the 5' end is located proximal to the fixed point and the 3' end is located distal to the fixed point. Such an arrangement is standard in the art.

[0243] In a specific embodiment, the matrix can include the first and second immobilized primers. In some embodiments, the immobilized primers can be suitable for serving as primers in bridge amplification processes. Bridge amplification can result in the clonal amplification of the nucleic acid fixed to the matrix. The non-hairpin adapter can be a Y-adapter, which includes a sequence complementary to the first immobilized primer and a sequence identical to the second immobilized primer. Therefore, in such an embodiment, the second library includes such nucleic acid: it includes a hairpin adapter at one end, and includes a sequence complementary to the first immobilized primer connected to a chain and a sequence identical to the second immobilized primer connected to another chain at the other end. The sequence complementary to the first immobilized primer can be connected to the 3' end of nucleic acid, and the sequence identical to the second immobilized primer can be connected to the 5' end of nucleic acid.

[0244] In some embodiments, the second library can be denatured prior to contacting the matrix, such that the nucleic acids of the second library are single-stranded. In some embodiments, the second library can be contacted with the matrix under denaturing conditions, such that the nucleic acids within the library are single-stranded upon contact.

[0245] In a specific embodiment, a method of preparing a library for nucleic acid sequencing is disclosed, wherein the preparation comprises modifying a nucleic acid to be suitable for binding to a matrix comprising a first immobilized primer, the method comprising:

[0246] a) providing a plurality of nucleic acids;

[0247] b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that favor ligation, wherein the non-hairpin adapter comprises a sequence complementary to the first immobilized primer;

[0248] c) fragmenting the plurality of nucleic acids; and

[0249] d) exposing the multiple nucleic acids to hairpin adapters under conditions that are conducive to connection, or exposing the multiple nucleic acids to conditions that can form hairpins at the ends of nucleic acid molecules. In one embodiment, the steps can be performed in the order of a), b), c) and then d). These steps can be in sequence, or steps c) and d) can be combined, for example, as a labeling step. Step b) can be combined with an earlier fragmentation step. In another embodiment, the steps can be performed in the order of a), d), c) and then b). These steps can be in sequence, or steps c) and b) can be combined, for example, as a labeling step. Step d) can be combined with an earlier fragmentation step.

[0250] After the above steps, the method may further comprise:

[0251] e) contacting the plurality of nucleic acids with the substrate under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid. As an example, the substrate may be a flow cell suitable for nucleic acid sequencing.

[0252] In a specific embodiment, a nucleic acid amplification step, such as PCR, is not performed before step e). For example, the method can be performed starting from a tissue sample and ending with the gDNA fragments in the sample being bound to a sequencing flow cell via a connected adapter that hybridizes to an immobilized primer; wherein, a nucleic acid amplification step, such as a PCR step, is not performed during this process. Although a PCR step can be included to amplify the target, the inventors were surprised to find that this is not a requirement of the method of the present invention. The exclusion of the amplification step can advantageously avoid the introduction of bias or sequence errors due to amplification. Therefore, the method of excluding the amplification step of the present invention can be used for whole genome error correction sequencing.

[0253] Thus, in one embodiment, a method for preparing a library for nucleic acid sequencing is disclosed, wherein the preparation comprises modifying the nucleic acid to be suitable for binding to a matrix comprising a first immobilized primer, the method comprising the following steps in the order listed, wherein steps c) and d) may be combined:

[0254] a) providing a plurality of nucleic acids;

[0255] b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that favor ligation, wherein the non-hairpin adapter comprises a sequence complementary to the first immobilized primer;

[0256] c) fragmenting the plurality of nucleic acids;

[0257] d) exposing the plurality of nucleic acids to a hairpin adaptor under conditions that favor ligation, or exposing the plurality of nucleic acids to conditions that enable the formation of a hairpin at the end of a nucleic acid molecule; and

[0258] e) contacting the plurality of nucleic acids with the substrate under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid;

[0259] Wherein no nucleic acid amplification step, such as PCR, is performed before step e). The non-hairpin adapter can be any disclosed herein, such as a Y-adapter. The matrix can be any disclosed herein, such as a flow cell.

[0260] In an alternative embodiment, a method for preparing a library for nucleic acid sequencing is disclosed, wherein the preparation comprises modifying the nucleic acid to be suitable for binding to a matrix comprising a first immobilized primer, the method comprising the following steps in the order listed, wherein steps c) and d) may be combined:

[0261] a) providing a plurality of nucleic acids;

[0262] b) exposing the plurality of nucleic acids to a hairpin adaptor under conditions favorable for ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at the end of a nucleic acid molecule;

[0263] c) fragmenting the plurality of nucleic acids;

[0264] d) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that favor ligation, wherein the non-hairpin adapter comprises a sequence complementary to the first immobilized primer; and

[0265] e) contacting the plurality of nucleic acids with the substrate under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid;

[0266] Wherein no nucleic acid amplification step, such as PCR, is performed before step e). The non-hairpin adapter can be any disclosed herein, such as a Y-adapter. The matrix can be any disclosed herein, such as a flow cell.

[0267] After step e), the method may further include contacting any hybridized nucleic acid with a polymerase under conditions suitable for extending an immobilized primer to synthesize nucleic acid, which is a nucleotide chain complementary to the hybridized nucleic acid. The newly formed nucleic acid can then be amplified. In some embodiments, the primers used for amplification are also fixed to a substrate, and can, for example, be suitable for bridge amplification. This process is known in the art and forms a clonal cluster of nucleic acid. In other embodiments, the primers used for amplification can be in a solution, for example, for an embodiment in which the substrate is a bead. The amplified nucleic acid can then be sequenced according to the usual method, for example, by sequencing by synthesis. The non-hairpin adapter can include a site for binding a sequencing primer to assist the process. The non-hairpin adapter can also include an index.

[0268] Therefore, in one embodiment, the method may further comprise:

[0269] f) obtaining sequence information of any nucleic acid that hybridized to the substrate in step e).

[0270] In embodiments where step e) is not performed, sequence information may be obtained by sequencing the second library.

[0271] Methods that include the step of obtaining sequence information may be referred to as nucleic acid sequencing methods or error-corrected nucleic acid sequencing methods. Such methods are "error-corrected" because the sequence information is derived from both strands of a portion of a double-stranded nucleic acid, and therefore, any errors introduced after providing the nucleic acid for sequencing can be corrected by comparing the sequence obtained for one strand to the sequence obtained for the other strand. Essentially, each portion of the original nucleic acid sample is read twice, and each read is an independent sequence, thus allowing error correction for any differences that exist only in a single read.

[0272] In one embodiment, the method is used to identify mutations, and the method includes identifying any changes in the expected sequence that are consistent on the two chains of the DNA molecule as mutations, and if the changes are inconsistent on the two chains of the DNA molecule, any changes in the expected sequence are not identified as mutations. Such methods may include bioinformatics comparison of sequence reads with reference sequences to identify deviations from the expected sequence. The reference sequence may be a known sequence such as a human genome, such as the human genome reference sequence Human Build 38 patch version 14 (GRCh38.p14; Genome Reference Consortium) in the NCBI database.

[0273] In certain embodiments, the method can be applied to gDNA obtained from a sample and can be used for unbiased whole genome error correction sequencing. In some embodiments, the method can be used to detect the off-target effects of gene editing technology. For example, the method can be used to detect the off-target effects of CRISPR-Cas9 editing, TALEN editing, or any other method of changing a nucleic acid sequence.

[0274] Methods for sequencing nucleic acids, such as immobilized nucleic acid clusters, are known in the art. In some embodiments, the sequencing may involve the use of a sequencing primer or a plurality of sequencing primers. For example, embodiments of the non-hairpin adapters described herein may include a first hybridization site to which a first sequencing primer may bind, and step f) may include the use of the first sequencing primer. In some embodiments, the non-hairpin adapters described herein may also include a second hybridization site to which a second sequencing primer may bind, and step f) may also include the use of a second sequencing primer.

[0275] The sequencing may be next generation sequencing or may be massively parallel sequencing.

[0276] In a specific embodiment, a method for preparing a library for nucleic acid sequencing is provided, wherein the preparation comprises modifying the nucleic acid to be suitable for binding to a matrix comprising immobilized primers, the method comprising:

[0277] a) providing a plurality of nucleic acids;

[0278] b) exposing the plurality of nucleic acids to a Y-adapter under conditions that favor ligation to produce a first library; wherein the Y-adapter comprises:

[0279] a first strand comprising a sequence at least partially complementary to a first primer immobilized to a substrate and an optional 3' protection feature, and

[0280] a second strand comprising a sequence identical to at least a region of a second primer immobilized to the substrate and an optional 5' protection feature;

[0281] c) fragmenting the first library, and further comprising:

[0282] i) selecting fragments of the plurality of nucleic acids based on size; and

[0283] d) exposing the selected fragments to hairpin adaptors under conditions that favor ligation to produce a second library, or exposing the plurality of nucleic acids to conditions that enable the formation of hairpins at the ends of nucleic acid molecules.

[0284] In another embodiment, a method for preparing a library for nucleic acid sequencing is provided, wherein the preparation comprises modifying the nucleic acid to be suitable for binding to a matrix comprising immobilized primers, the method comprising:

[0285] a) providing a plurality of nucleic acids;

[0286] b) exposing the plurality of nucleic acids to a Y-adapter under conditions that favor ligation to produce a first library; wherein the Y-adapter comprises:

[0287] a first strand comprising a sequence at least partially complementary to a first primer immobilized to a substrate and an optional 3' protection feature, and

[0288] a second strand comprising a sequence identical to at least a region of a second primer immobilized to the substrate and an optional 5' protection feature; and

[0289] (Combined steps) c) and d) exposing said first library to hairpin adapters under conditions favouring ligation and fragmentation to produce a second library; optionally wherein tagmentation is performed.

[0290] The above two embodiments may be a method for obtaining sequence information from a nucleic acid, wherein the method further comprises:

[0291] e) denaturing the second library to generate single-stranded nucleic acids, and contacting the single-stranded nucleic acids with the substrate under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid, and optionally generating immobilized nucleic acid clusters by bridge amplification, wherein the first and second immobilized primers serve as primers for bridge amplification; and

[0292] f) obtaining sequence information of any nucleic acid that hybridized to the substrate in step e).

[0293] In a second aspect, there is provided a nucleic acid library obtained or obtainable by any method of the first aspect of the disclosure. The library of the second aspect is referred to as a second library relative to the first aspect of the disclosure.

[0294] The nucleic acid library of the second aspect comprises nucleic acids for which sequence information is required, which may be referred to as target nucleic acids and may be DNA derived from a sample (or derived from the DNA). The DNA may be derived from a mammalian or human sample. The target nucleic acid may be a fragment of a gDNA or may be derived from the gDNA.

[0295] The library comprises a portion of the target nucleic acid having a non-hairpin adapter connected at one end as disclosed herein and a hairpin adapter connected at the other end. The non-hairpin adapter connected to the nucleic acid of the library of the present invention can be any of those disclosed herein. In one embodiment, the portion of the target nucleic acid has a Y- adapter connected at one end as disclosed herein and a hairpin adapter connected at the other end. The Y- adapter can be an Illumina Y- adapter comprising a P5 binding sequence and a P7 binding sequence.

[0296] The present disclosure encompasses the library of the second aspect which has been denatured to form a single strand such that the portion forming the hairpin forms a linker between the two strands of the target nucleic acid and the non-hairpin linker is present as a sequence at the 5' end and a sequence at the 3' end.

[0297] In addition to the above substances, the nucleic acid library of the second aspect may contain target nucleic acids having hairpins at both ends. Such substances will not bind to the matrix and are therefore not sequenceable.

[0298] Compared with prior art, the nucleic acid library of described second aspect comprises the target nucleic acid with the non-hair clip adapter being connected to two ends of reduction.In some embodiments, described nucleic acid library does not comprise or does not comprise a large amount of target nucleic acid with the non-hair clip adapter being connected to two ends.Such material is sequenceable, but can not error correction, and therefore the reduction of this material or avoidance allows to improve sequencing accuracy.In addition, the reduction of this material can allow to order-check the library when there is no previous amplification step, for example, it can allow to order-check the library on substrate when there is no amplification before being applied to substrate.

[0299] In an example, the library can contain less than 99.9%, 99%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 3%, 1%, 0.1% or 0.01% (by mass) of target nucleic acids having non-hairpin linkers attached to both ends.

[0300] Thus, in a specific embodiment, a nucleic acid library is disclosed comprising target nucleic acids having a non-hairpin adapter attached to one end and a hairpin at the other end. The nucleic acid library does not contain, contains a reduced amount, or does not contain a large amount of target nucleic acids having a non-hairpin adapter attached to one end and a non-hairpin adapter attached to the other end. The reduction can be relative to a library prepared in the same manner, but wherein the first and second adapter ligation steps are performed simultaneously.

[0301] Specifically, the nucleic acid library of the second aspect may be suitable for comprising contacting the library with a substrate so that part of the library is bound to a sequencing method of the substrate. The non-hairpin adapter may include a sequence that is at least partially complementary to the first primer that is fixed to the substrate. Therefore, in one embodiment, a nucleic acid library is disclosed, which is suitable for comprising contacting the library with a substrate so that part of the library is bound to the sequencing method of the substrate, the nucleic acid library comprising: i) a target nucleic acid having a non-hairpin adapter connected to one end and a hairpin at the other end, wherein the non-hairpin adapter includes a sequence that is at least partially complementary to the first primer that is fixed to the substrate; and optional ii) a target nucleic acid having a hairpin at one end and a hairpin at the other end.

[0302] In a third aspect, a sequencing method is disclosed, wherein the method comprises obtaining sequence information of nucleic acids within the library of the second aspect of the present disclosure.

[0303] In one embodiment, a method for obtaining sequencing information is disclosed, wherein the method comprises:

[0304] 1) contacting the library of the second aspect of the present disclosure with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; and

[0305] 2) Obtaining sequence information of any nucleic acid hybridized to the substrate in step 1).

[0306] Step 1) of the third aspect has the same features as step e) of the first aspect of the present disclosure. Step 2) of the third aspect has the same features as step f) of the first aspect of the present disclosure.

[0307] In one embodiment, a method for obtaining sequencing information is disclosed, wherein the method comprises:

[0308] 1) contacting the nucleic acid library with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; and

[0309] 2) obtaining sequence information of any nucleic acid hybridized to the substrate in step 1);

[0310] The nucleic acid library is prepared or obtainable by a method comprising the following steps:

[0311] a) providing a plurality of nucleic acids;

[0312] b) exposing the plurality of nucleic acids to a non-hairpin adaptor under conditions favorable for ligation;

[0313] c) fragmenting the plurality of nucleic acids; and

[0314] d) exposing the plurality of nucleic acids to a hairpin adaptor under conditions favorable for ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at the end of a nucleic acid molecule;

[0315] Wherein steps b) and d) are performed separately.

[0316] As disclosed herein, the inventors surprisingly found that amplification of the nucleic acids in the sample prior to binding to the matrix is ​​not a requirement of the methods of the present invention.

[0317] Therefore, in a fourth aspect, a method for preparing a library for nucleic acid sequencing is provided, the method comprising:

[0318] i) providing a plurality of nucleic acids;

[0319] ii) exposing the plurality of nucleic acids to non-hairpin adapters under conditions favorable for ligation; and

[0320] iii) exposing the plurality of nucleic acids to a hairpin adaptor under conditions that favor ligation, or exposing the plurality of nucleic acids to conditions that enable the formation of a hairpin at the end of a nucleic acid molecule;

[0321] wherein the nucleic acid is not amplified during the library preparation process.

[0322] Features disclosed in connection with step a) of the first aspect of the present disclosure also apply to step i) of the fourth aspect.

[0323] The non-hairpin adapter of the fourth aspect may be any one disclosed in the first aspect of the present disclosure. The non-hairpin adapter may include the protection features and / or binding features disclosed in the first aspect. The hairpin adapter of the fourth aspect may be any one disclosed in the first aspect of the present disclosure. The conditions capable of forming a hairpin at the end of a nucleic acid molecule may be any one disclosed in the first aspect of the present disclosure.

[0324] According to a fourth aspect, the nucleic acid is not amplified during the library preparation process. For example, no PCR step is performed.

[0325] In a specific embodiment, the steps of the fourth aspect are performed in the order of i), ii) and then iii). In another embodiment, the steps of the fourth aspect are performed in the order of i), iii) and then ii). In a specific embodiment, steps ii) and iii) are performed separately and a fragmentation step is included between the steps. In another embodiment, the second connection step may comprise fragmentation, for example, it may be a labeling step. The features disclosed in association with step c) of the first aspect of the present disclosure also apply to the fragmentation step of the fourth aspect.

[0326] The nucleic acid library produced by steps i), ii) and iii) can be referred to as the second library. Sequence information can be obtained from the second library. In one embodiment, the non-hairpin adapter comprises a sequence that is at least partially complementary to the first primer fixed to the substrate, and the method comprises step iv), under conditions suitable for hybridization of the first immobilized primer with the complementary nucleic acid, the second library is contacted with the substrate comprising the first immobilized primer. The features disclosed in association with step e) of the first aspect of the present disclosure are also applicable to step iv) of the fourth aspect. The features disclosed in association with obtaining the sequence information of the first aspect are also applicable to the fourth aspect. In these embodiments, the nucleic acid amplification step is not performed before step iv).

[0327] In a fifth aspect, there is provided a nucleic acid library obtained or obtainable by any method of the fourth aspect of the disclosure. The library of the fifth aspect is referred to as the second library relative to the first aspect of the disclosure.

[0328] The library of the fifth aspect does not comprise target nucleic acids that have been amplified, for example, target nucleic acids that have not been subjected to a PCR reaction. The remaining features of the library of the fifth aspect may be as disclosed in relation to the second aspect of the disclosure.

[0329] In a sixth aspect, a sequencing method is disclosed, wherein the method comprises obtaining sequence information of nucleic acids within the library of the fifth aspect of the present disclosure.

[0330] In one embodiment, a method for obtaining sequencing information is disclosed, wherein the method comprises:

[0331] 1) contacting the library of the fifth aspect of the invention with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; and

[0332] 2) Obtaining sequence information of any nucleic acid hybridized to the substrate in step 1).

[0333] Step 1) of the sixth aspect has the same features as step e) of the first aspect of the present disclosure. Step 2) of the sixth aspect has the same features as step f) of the first aspect of the present disclosure.

[0334] In a seventh aspect, a non-hairpin linker is provided, comprising: a first strand comprising a sequence at least partially complementary to a first immobilized primer in the 5' to 3' direction and a 3' protection feature; and a second strand comprising a 5' protection feature and a sequence identical to at least one region of a second primer in the 5' to 3' direction.

[0335] The non-hairpin adapter of the seventh aspect may include any sequence that is at least partially complementary to the first immobilized primer as disclosed in the first aspect of the present disclosure. The non-hairpin adapter of the seventh aspect may include any sequence that is identical to at least one region of the second primer as disclosed in the first aspect of the present disclosure. The sequence that is at least partially complementary to the first immobilized primer may be SEQ ID NO:1 or SEQ ID NO:3. The sequence that is identical to at least one region of the second immobilized primer may be SEQ ID NO:2 or SEQ ID NO:4. In one embodiment, the non-hairpin adapter includes at least 5, 10, 15, 16, 17, 18, 19, 20 or all 21 bases of SEQ ID NO:1 and / or includes at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO:2. In one embodiment, the non-hairpin adapter comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 3 and / or comprises at least 5, 10, 15, 16, 17, 18, 19, or all 20 bases of SEQ ID NO: 4. The non-hairpin adapter may comprise sufficient bases of any one of SEQ ID NOs: 1 to 4 to allow hybridization with a complementary primer.

[0336] In a specific embodiment, the non-hairpin adaptor is a Y-adapter comprising:

[0337] a first strand comprising, in the 5' to 3' direction, SEQ ID NO: 5, an optional index, SEQ ID NO: 1, and 3SpC3; and

[0338] A second strand, which in the 5' to 3' direction comprises a 5' block, SEQ ID NO: 2, an optional index and SEQ ID NO: 6. SEQ ID NOs: 1, 2, 5 and 6 may each comprise 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2 or 1 modification such as a substitution, deletion or insertion. In one embodiment, the modification is a substitution.

[0339] In a specific embodiment, the non-hairpin adaptor is a Y-adapter comprising:

[0340] a first strand comprising in the 5' to 3' direction SEQ ID NO:7, an optional index, SEQ ID NO:3, and 3SpC3; and

[0341] A second strand, which in the 5' to 3' direction comprises a 5' block, SEQ ID NO: 4, an optional index and SEQ ID NO: 8. SEQ ID NOs: 3, 4, 7 and 8 may each comprise 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2 or 1 modification such as a substitution, deletion or insertion. In one embodiment, the modification is a substitution.

[0342] The 5' and 3' protection features may be any as disclosed in relation to the first aspect of the disclosure.

[0343] In some embodiments, the non-hairpin adapter is or comprises a nucleic acid. In some embodiments, the non-hairpin adapter is or comprises a DNA, RNA and / or XNA. The non-hairpin adapter may comprise modified and / or unmodified nucleotides. In some embodiments, the non-hairpin adapter is double-stranded. In a specific embodiment, the non-hairpin adapter comprises double-stranded DNA. The non-hairpin adapter may be a Y-adapter.

[0344] The non-hairpin adapter may comprise any 5' and / or any 3' binding feature as disclosed in relation to the first aspect of the disclosure.The non-hairpin adapter may or may not comprise any index as disclosed in relation to the first aspect of the disclosure.

[0345] In a specific embodiment, the non-hairpin adapter is a Y-adapter comprising: a first strand comprising, in the 5' to 3' direction, a first hybridization site to which a first sequencing primer can bind, a sequence at least partially complementary to a first immobilized primer, and a 3' protection feature; and a second strand comprising, in the 5' to 3' direction, a 5' protection feature, a sequence identical to at least one region of a second immobilized primer, and a second hybridization site to which a second sequencing primer can bind. Optionally, the first and second hybridization sites are at least partially complementary.

[0346] In the eighth aspect of the present invention, a kit is provided, comprising the non-hairpin adapter and the hairpin adapter of the seventh aspect of the present disclosure. The hairpin adapter may be any one disclosed in relation to the first aspect of the present disclosure.

[0347] Table 1

[0348]

[0349]

[0350]

[0351]

[0352]

[0353] *Phosphorothioate bonds resist exonuclease activity

[0354] / 3SpC3 / C3 spacer phosphoramidite (covalently blocked) resists exonuclease, ligase and 5'>3' polymerase activity

[0355] -P 5' phosphate group promotes 5' attachment

[0356] Indexing Illumina sequencing index sequences to enable demultiplexing of mixed sequencing libraries

[0357] *T 3' deoxythymidine triphosphate "T-tail" with phosphorothioate linkage provides substrate for ligation to "A-tailed" DNA fragments

[0358] The sequence on pages 36 to 40 is:

[0359] Y-linker version 1 (in order): SEQ ID NO: 4, 8, 9, 7 and 3.

[0360] Y-linker version 2 (in order): SEQ ID NO: 2, 6, 9, 5 and 1.

[0361] Hairpin: SEQ ID NO: 9

[0362] Example

[0363] Example 1 - DEDUCE-Seq

[0364] DuplEx assay and sequencing by unbiased flow cell enrichment (DEDUCE-seq) uses a full-length Y-adapter to construct all the necessary DNA elements required for Illumina sequencing, while a second hairpin adaptor locks the oligo and connects the two strands, preserving the duplex information of the linear molecule ( Figure 1 ). Like the Duplex-seq method [Kennedy, SR, et al., Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc, 2014. 9(11): p. 2586-606], which uses a tag-based system to retain duplex information, DEDUCE-seq uses the complementary properties of DNA to distinguish true mutations from sequencing errors. However, DEDUCE-seq achieves this by physically connecting the two strands of the DNA duplex into a single sequenceable DNA molecule. In addition, the overall base calling accuracy of current sequencers has improved by at least an order of magnitude (to 1 / 10) over the past decade. 3), thereby improving the theoretical limit for variant calling. By using redundant information from both DNA strands, only true mutations or variants are called on both strands of the duplex, while technical errors can be eliminated because they are present in only one of the two reads ( Figure 1 This strategy has been shown to significantly increase the number of ultra-rare mutations (as low as 1x10 -6 ) [Salk, JJ and SR Kennedy, Next-Generation Genotoxicology: Using Modern Sequencing Technologies to Assess Somatic Mutagenesis and Cancer Risk. Environ Mol Mutagen, 2020. 61 (1): pp. 135-151]. However, Duplex-seq relies on unique molecular identifiers (UMIs) and PCR amplification to achieve this [Kennedy, SR, et al., Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc, 2014. 9 (11): pp. 2586-606]. Therefore, the method is not PCR-free, which greatly increases the cost of sequencing and limits its application in targeted sequencing. However, DEDUCE-seq does not use PCR by design, but uses Illumina flow cells for DNA enrichment, and is designed to cost-effectively detect rare mutations across the genome.

[0365] First, the inventors will use DEDUCE-seq to detect mutations in previously conducted homologous yeast experiments. In this project, multiple yeast strains were investigated for mutations by treating them with UV light, after which the cells were propagated for approximately 1,200 generations to accumulate mutations. Mutations obtained in these experiments were measured using traditional WGS and variant calling. Therefore, this legacy data of the small size of the yeast genome allows DEDUCE-seq to serve as a benchmark for in vivo mutation detection.

[0366] Next, DEDUCE-seq was applied to detect mutations at new off-target sites discovered by INDUCE-seq (WO2022 / 038291A1). CRISPR genome editing projects can be used to detect mutations in human cells. Using INDUCE-seq, the inventors have discovered novel off-targets for very stringent guide RNAs and poorly targeted RNAs, which allows DEDUCE-seq to measure both ends of the range to evaluate mutation induction at high- and low-frequency off-target break sites in human cells.

[0367] Methods - Preliminary Design

[0368] The inventors will use genomic DNA obtained from mutation surveys in yeast (see above). To set up the library preparation, the genomic DNA was fragmented into a size of approximately 600-800 bp. The first ligation used a full-length Y-linker to construct all the linker components required for sequencing ( Figure 1 ). Next, the DNA is purified to remove excess adapter DNA and subjected to a second round of fragmentation to approximately 200-300 bp. DNA size selection, successful ligation, and removal of adapter DNA are assessed using capillary DNA electrophoresis.

[0369] For the second ligation, the inventors will use hairpin adapters to physically connect the complementary strands of DNA and lock the duplex information into a single sequenceable molecule (see Figure 1 ). Size selection and purification of the library DNA will also remove excess hairpin adapter DNA. To verify successful ligation, qPCR will be used to quantify the sequenceable DNA fraction of the sample. This will reveal Figure 1 The design of the linkers shown in produces functional, sequenceable molecules. These pilot experiments will first perform small-scale double-end sequencing. This will confirm successful connection strategies and reveal the overall quality of the library. To this end, the inventors will first sequence DNA from untreated cells (low mutation rate) and highly mutagenic cells (high mutation rate). The preliminary data from these experiments will be used to begin developing data analysis processes that exploit duplex information. Next, the pilot DEDUCE-seq experiments will be expanded to more samples and higher coverage (about 100 times), using high-capacity sequencing platforms (MiSeq v3 or NextSeq 550) to detect mutations in early and late yeast from (i) untreated wild-type cells, (ii) UV-irradiated wild-type cells, and (iii) cells with known mutant phenotypes. Finally, after these pilot experiments, the inventors will apply DEDUCE-seq to detect mutations in a large number of yeast samples from the mutagenesis projects previously conducted above. The resulting data can now be used to evaluate the performance of DEDUCE-seq compared to the original WGS performed at about 10-25 times coverage. Once established, the method will be used to detect genome-wide mutations from CRISPR-Cas9-edited genomic DNA and measure low- and high-frequency off-targets by INDUCE-seq.

[0370] Methods - for Pilot 1 and Pilot 2

[0371] Genomic DNA input

[0372] To generate DEDUCE-seq libraries, fragmented genomic yeast DNA was used as input. Genomic DNA samples were thawed and run on an automated electrophoresis system (Agilent TapeStation 2100, High Sensitivity D1000 screentape) to assess size distribution and quality. Next, a high sensitivity kit (Qubit TM DNA was quantified using Qubit-2 (ThermoFisher) using the dsDNA HS Assay Kit and normalized to 200-250 ng / 50 μL in nuclease-free water (NFW).

[0373] DEDUCE-seq library preparation

[0374] Genomic DNA was prepared using a single-sided size selection method. First, fragments larger than 300 bp were removed using 0.6× (v / v) SPRI beads (CleanNGS, GCBiotech), thereby keeping the target DNA in the solution at 100 to 500 bp. In the second purification step, SPRI beads were added to a final concentration of 1.8× (v / v) and the DNA was eluted to a final volume of 25 μL NFW. Next, the DNA was purified using Ultra TM The DNA was blunt-ended and A-tailed using the II End Repair / dA-Tailoring Module (E7546L, New England Biolabs) to a final volume of 30 μL, ready for use Ultra TM II ligation module (E7595L, New England Biolabs) was used for ligation. For the first ligation, pilot-1 used 1.25 μL of 7.5 μM full-length Y-linker (P5-P7), while pilot-2 used 1.25 μL of 7.5 μM hairpin linker. Total DNA was purified and the remaining linker was removed using 1.8× (v / v) SPRI beads, after which the DNA was eluted in 100 μL NFW in preparation for sonication. The ligated DNA was re-sonicated using a Bioruptor (Diagenode) for 60 cycles (30 s on / off, high output). In preparation for the second round of end preparation and ligation, the DNA was purified using 1.8× (v / v) SPRI beads and eluted in 25 μL NFW to reduce the volume to fit on the NEBNext Ultra II module. Ultra TM The re-sonicated DNA was blunt-ended and A-tailed using the End Repair / dA-tailing Module (E7546L, New England Biolabs) and then used Ultra TM The DNA of the 100 μ L DNA was purified by PCR. The DNA was purified by 1.8 × (v / v) SPRI beads and eluted in 28 μ L NFW. The final library was quantified using qPCR and tested on an automatic electrophoresis system (Agilent TapeStation 2100, high sensitivity D1000 screentape) to assess size distribution and quality. Throughout the protocol, the size and quality of the library DNA were measured using electrophoresis to assess the removal of the adapter, re-ultrasound treatment and the final library.

[0375] DEDUCE-seq library quantification

[0376] The final DEDUCE-seq library DNA was diluted 50-fold in dilution buffer (10 mM Tris-HCl, pH 8.0, 0.05% Tween-20), and 4 μL of the diluted library DNA was subjected to triplicate qPCR (KAPA Library Quantification Kit) using a final PCR reaction volume of 20 μL. Platform). Library DNA was amplified using the cycling protocol as recommended by the supplier's guidelines and quantified using the provided tool to give undiluted library concentration (μM).

[0377] Sequencing of DEDUCE-seq libraries

[0378] The final DNA library was pooled to the relevant location and the final volume was reduced to 40 μL using SpeedVac. Before loading onto the sequencing flow cell, the DEDUCE-seq library was prepared according to the following modified denaturation protocol: the final library (40 μL) was mixed with 40 μL of freshly diluted 0.2N NaOH at room temperature for 5 minutes to denature the DNA. Next, the solution was neutralized with 40 μL of 200mM Tris-HCl (pH 7). The resulting denatured library (120 μL) was complemented with 1179 μL of pre-cooled HT1 and 1 μL of denatured and diluted PhiX control (20 pM). 1.3 mL of this mixture was loaded onto the NextSeq cartridge for complete sequencing.

[0379] Sequencing data processing

[0380] Sequencing runs were evaluated using Illumina's online basespace utility or the offline sequence analysis viewer (SAV, Illumina). Reads passed filters, base call quality (Q30), and cluster density were used as first-pass quality control. Demultiplexed data were then retrieved in preparation for downstream analysis as described below.

[0381] Secondary data analysis

[0382] Demultiplexed sequencing data were downloaded from the base space as FASTQ files. Reads were quality trimmed using trim_galore (v0.6.7) and adapters were trimmed using standard parameters. Trimmed and untrimmed data were quality checked using FASTQC. To retrieve HP containing reads, standard command line tools GNU grep (3.7) and AWK (1.3.4) were used to query the data.

[0383] The FASTQ files were first converted to FASTA format using Seqkit fq2fa, and then mapping was applied to calculate the exact position of the hairpin sequences in reads 1 and 2 using the following command:

[0384] seqkit fq2fa-j$threads$Read1-o$Read1.fa.gz

[0385] seqkit locate-j$threads-idPp AGGGCCTANNNNNNNNTAGGCCC$Read1.fa.gz>$Reads1_HP-locate.tsv

[0386] Alignment of the DEDUCE-seq data was performed using bowtie2 (2.5.1), where default parameters were used for exploratory analysis, aligning concordant read pairs and discordant DEDUCE-seq reads as follows:

[0387] #Default consistent comparison

[0388] bowtie2-p$threads-x$refseq-1$mate1 -2$mate2

[0389] #DEDUCE-seq inconsistent alignment

[0390] bowtie2-p$threads--ff--no-mix--dovetail-x$refseq-1$mate1 -2$mate2

[0391] Use samtools (1.6) to remove relevant unmapped reads and secondary alignments:

[0392] samtools view-Shu-f 3-F 256-@$threads$input

[0393] The aligned data were converted to BAM files using samtools (1.6) and visualized using Intergrated Genomics Viewer (2.14.1) (Robinson et al. 2011).

[0394] Example 2 - DEDUCE-Seq Pilot 1 and Pilot 2

[0395] The pilot studies described here were designed to establish the core elements of the DEDUCE-seq libraries and to determine the most efficient ligation strategy. Therefore, we generated DEDUCE-seq libraries in which the hairpin was ligated first and the Y-linker was ligated subsequently (Pilot-1) and vice versa (Pilot-2). In these studies, genomic yeast DNA was used to generate the DEDUCE-seq libraries. This DNA had previously been used to measure mutations in a study aimed at detecting mutations induced by UV irradiation in a homologous yeast strain (Nandi et al. 2018) and provided a suitable source of genomic DNA of known origin and known mutation burden. These samples were stored as fragmented DNA of approximately 200-300 bp and normalized to 4-5 ng / μL. First, for Pilot-1, 2 samples were processed in parallel and right-side size selection was performed to remove larger DNA fragments >300 bp (data for one representative sample are shown). The starting DNA ranged from 100 to 500 bp ( Figure 5 , left picture).

[0396] Pilot 1 - Ligation of DEDUCE-seq hairpin first and Y-adapter later - Library construction

[0397] Next, the DNA was blunted, A-tailed, and hairpin adapters were ligated using the NEBNext Ultra II kit. The ligated DNA was purified and checked on the TapeStation to confirm the removal of the hairpin adapter DNA ( Figure 5 , middle panel, black trace). Re-sonication of the DNA resulted in a shift in the size distribution, centered around 200 bp, ranging from 75 to 500 bp ( Figure 5 , middle panel, gray trace). Repeat the end preparation and ligation process for the second Y-linker to obtain Figure 5 The final purified library is shown (right, grey trace). The final ligation does not result in a significant shift in the size distribution. The residual Y-linker is detected at 50 bp, and high molecular weight fragments are detected around 900 bp after Y-linker ligation ( Figure 5, right). Importantly, this is a known Y-linker ligation artifact, demonstrated previously using thick Y-linkers as part of a Duplex-seq methodology manuscript (Kennedy et al. 2014). This large fraction can be safely ignored.

[0398] The final library contains a mixture of molecules, a portion of which consists of fragments ligated by functional DEDUCE-seq HP-Y-linkers. Due to the presence of the full-length P5-P7 hybrid Y-linker, DEDUCE-seq library molecules contain the component primer binding sites required for quantification. Therefore, we applied qPCR to quantify the sequenceable molecules in the final library preparation and measured 1.1 and 2.0 nM library concentrations for samples 1 and 2, respectively. Importantly, Figure 5 (right) The high molecular weight artifacts shown in the figure did not contribute to the qPCR readings. No molecules with excessively high melting temperatures were detected in these samples (data not shown). At these concentrations, the final libraries of samples 1 and 2 were expected to contain 190 million to 355 million sequenceable molecules per 1 μL of undiluted library, respectively. Therefore, 1 μL of the library of sample 2 was sequenced on a NextSeq500 high output 2x150bp flow cell, resulting in 240 million reads, 96% of which passed the filter and had a Q30 score of 93%. Successful sequencing indicates that the HP-Y-linker ligation strategy of pilot-1 produces functional, sequenceable molecules that can be quantified by qPCR and loaded onto the sequencer to produce clusters and reads proportional to the qPCR reads.

[0399] Pilot 1 - Ligating DEDUCE-seq hairpins first and then Y-linkers - Data analysis

[0400] The design of the DEDUCE-seq library is non-standard and is expected to result in inconsistent read pairs in the forward-forward (F1F2) or reverse-reverse (R2R1) directions, which are not accepted as legitimate outputs by all aligners. Similarly, depending on the insert length and trimming, dovetail reads can be generated from this library and are not accepted by all aligners. In addition, we found from preliminary alignment experiments that most reads were aligned as consistent pairs (F1R2 or R1F2) and speculated that these came from double Y-linker ligation products, which are predicted to be a minority of DEDUCE-seq outputs (data not shown). Therefore, we first evaluated the composition of DEDUCE-seq sequencing reads by searching for reads containing hairpins in an unbiased manner. Reads containing hairpins were programmatically retrieved from read 1 and read 2, returning 33 and 44M reads (14-18.4%) from a total of 237M reads, respectively (Table 2). If the genomic DNA insert size is greater than 150 bp, it is expected that not every duplex molecule will contain the HP sequence in the read. Interestingly, the basic position information obtained from this search showed that the majority of reads contained the HP sequence at the beginning of the read, while about 7.5M reads contained the HP sequence somewhere in the middle of the read. However, we rarely found the HP sequence at the very end of the read (Table 2).

[0401] Table 2

[0402]

[0403] Using this information, we extracted all read pairs containing the HP sequence in R1 and R2 to elucidate the conformation of these molecules. Using this list of 9.5M read pairs, we calculated the precise position of the hairpin sequence in each read and plotted the distribution of hairpin positions as a function of read length (<151 bp).

[0404] We found that for this type of reads, approximately half contained hairpin DNA at the beginning of the read, as shown in Table 2. In the remaining reads, HP sequences were evenly distributed over the read length. Next, we collected 9.5M read pairs (4%) containing HP sequences and aligned them to the reference genome using bowtie2. Bowtie2 can accommodate inconsistent read pairs, allowing us to align approximately 200-800 reads and inspect them in a genome browser ( Figure 7 ). This revealed the correct biparallel orientation for all of these reads (F1F2 and R1R2), as expected from the DEDUCE-seq library design. This confirmed that the reads containing the HP could be aligned using bowtie2 and were in the correct orientation, further revealing the associated SAM markers that defined these read pairs (F1F2, SAM markers 67-133 and R2R1, SAM markers 115-179).

[0405] Using this information, we aligned the entire dataset of 230M reads using the specific configuration of bowtie2 described above and filtered out correctly aligned DEDUCE-seq reads using the corresponding SAM flags. This yielded approximately 120K reads with the expected DEDUCE-seq-specific orientation ( Figure 7 and Table 3), indicating that the combination of hairpin and Y-linker ligation produces a functional library. Table 4 summarizes the results of this comparison.

[0406] Table 3: Discordant read pairs of DEDUCE-seq libraries

[0407]

[0408] Table 4

[0409]

[0410]

[0411] Forced alignment of the DEDUCE-seq data in this manner via bowtie2 resulted in >190M read pairs being unmapped, which would normally (based on the SAM flag) result in concordant pairs (data not shown). In contrast, appropriately paired and mapped reads fell into the correct categories of discordant parallel reads (F1F2 and R2R1), totaling 180K (Table 2).

[0412] Pilot-2DEDUCE-seq first connects Y-linker and then connects hairpin: library construction

[0413] Similar to pilot-1, the DEDUCE-seq library of pilot-2 is derived from the same genomic DNA. In this example, a total of 250ng DNA from 4 independent samples was size-selected to remove large fragments of DNA (>500bp) and prepared for connection. In the first round, the full-length Y-linker was connected to the DNA. After purification and removal of unconnected Y-linkers, the DNA was re-ultrasonicated for 60 cycles and purified. DNA was processed to connect hairpin linkers by another round of end preparation and connection, and qPCR purification and quantitative DNA were used thereafter. The final library concentration of these samples is within the range of 2.8 to 8.3pM.

[0414] Thus, preparing DEDUCE-seq libraries by ligating the Y-adapter first and then the hairpin adaptor resulted in a yield of sequenceable molecules that was approximately 3 orders of magnitude lower than the reverse sequence performed in pilot-1. This suggests that the ligation efficiency between the Y- or hairpin adaptors is different and that the ligation order affects the yield of the DEDUCE-seq library. The estimated sequencing reads for the samples prepared in pilot-2 ranged from 11 to 35M. Therefore, we pooled the 4 samples together, resulting in a total of 73M predicted reads, and sequenced the pool on a NextSeq 500 High Output 2x150bp flow cell. This sequencing run generated 38 million reads, of which 91% passed the filter with a Q30 score of 91%. Importantly, the sequencing output of the DEDUCE-seq library generated here was lower than expected from qPCR quantification. The original design of the DEDUCE-seq library constructed in this way favors the enrichment of the correctly ligated Y-DNA-hairpin products by the flow cell, while locking the unligated fragments in the double hairpin ligation loop, rendering these molecules inert. In theory, this would improve the selective enrichment of sequenceable molecules on the flow cell.

[0415] Pilot-2DEDUCE-seq ligates Y-linkers first, then hairpins: Data analysis

[0416] Based on the results from pilot-1, we used the same protocol described above and collated the reads containing hairpins to calculate the position of the hairpin sequence in each read.

[0417] Table 5

[0418]

[0419] Overall, this returned 420-470K reads of R1 and R2 containing hairpin sequences from a total of 38M read pairs (1.1-1.2%). Combining pairs where both reads contained HP sequences left 200K read pairs (about 0.5%), of which 23K aligned to the reference genome (about 0.05%). The distribution of hairpin positions is shown in Fig. 9 Secondary ligation of the hairpin adapter resulted in the majority of HP sequences being localized to the 3' or end of either read 1 or read 2 as expected.

[0420] Importantly, this alignment was performed in the presence of a noncoding hairpin sequence in reads 1 and 2, which is not present in the yeast reference genome and therefore does not interfere with the aligner. Trimming the hairpin DNA from these reads improved the alignment (data not shown).

[0421] in conclusion

[0422] Taking all factors into consideration, the two directions of Y- and HP-linker ligation of DEDUCE-seq produce parallel duplex molecules that conform to the DEDUCE-seq design.

[0423] As in pilot-2, first ligating the Y-linker and then the hairpin may be a preferred option to fully utilize the flow cell to enrich the correctly formed Y-HP molecules from the inert double hairpin molecules. However, compared with the strategy applied in pilot-1, this library strategy is less efficient. In pilot-1, the total yield of the library (nM) was higher than that of pilot-2 (pM).

Claims

1. A method for preparing a library for nucleic acid sequencing, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adaptor under conditions favorable for ligation; c) fragmenting the plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a hairpin adaptor under conditions favorable for ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at the end of a nucleic acid molecule; Wherein steps b) and d) are performed separately. 2 . The method of claim 1 , wherein the plurality of nucleic acids are fragmented after the first adaptor ligation step and before or as part of the second adaptor ligation step.

3. The method of claim 1, wherein: The steps are performed sequentially in the order of a), b), c), and d); or The steps are performed sequentially in the order of a), d), c), and b); or The steps are performed in the order of step a), step b) and combined steps c) and d); or The steps are carried out in the order of step a), step d) and combined steps c) and b).

4. The method of any one of claims 1 to 3, wherein the non-hairpin adaptor comprises a sequence that is at least partially complementary to a first primer fixed to a substrate.

5. The method of claim 4, wherein the sequence at least partially complementary to the first primer fixed to the substrate comprises at least 5, 10, 15, 16, 17, 18, 19, 20 or all 21 bases of SEQ ID NO: 1 or at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO:

3.

6. The method of any one of claims 1 to 5, wherein the non-hairpin linker is a Y-linker.

7. The method of claim 6, wherein the Y-linker comprises: a first strand comprising a sequence at least partially complementary to a first primer immobilized to a substrate; and A second strand comprises a sequence identical to at least a region of the second primer.

8. The method of claim 7, wherein the sequence identical to at least one region of the second primer comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23 or all 24 bases of SEQ ID NO:2 or at least 5, 10, 15, 16, 17, 18, 19 or all 20 bases of SEQ ID NO:

4.

9. The method of any preceding claim, wherein the non-hairpin adapter is a Y-adapter comprising: a first strand comprising, in the 5' to 3' direction, a first hybridization site to which a first sequencing primer can bind, and a sequence at least partially complementary to the first immobilized primer; and The second strand comprises a sequence identical to a region of the second immobilized primer in the 5' to 3' direction and a second hybridization site to which a second sequencing primer can bind.

10. The method of any preceding claim, wherein the non-hairpin adaptor comprises a 5' and / or 3' protection feature.

11. The method of claim 10, wherein the non-hairpin linker comprises: a first strand comprising a 3' protection feature; and a second strand comprising a 5' protection feature.

12. The method of any preceding claim, wherein the non-hairpin adapter is a Y-adapter comprising: a first strand comprising, in the 5' to 3' direction, a first hybridization site to which a first sequencing primer can bind, a sequence at least partially complementary to the first immobilized primer, and a 3' protection feature; and The second strand comprises, in the 5' to 3' direction, a 5' protection feature, a sequence identical to at least a region of the second primer, and a second hybridization site to which a second sequencing primer can bind.

13. The method of any preceding claim, wherein the plurality of nucleic acids is DNA.

14. The method of claim 13, wherein the plurality of nucleic acids is genomic DNA (gDNA).

15. The method of any preceding claim, wherein the method comprises: e) contacting the plurality of nucleic acids with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; Wherein the non-hairpin adaptor comprises a sequence that is at least partially complementary to the first immobilized primer.

16. The method of claim 15, wherein: No nucleic acid amplification step is performed prior to step e).

17. The method of claim 15 or claim 16, wherein the non-hairpin adaptor comprises a sequence identical to at least a region of a second primer and the second primer is immobilized to the substrate.

18. The method of claim 17, wherein the first and second immobilized primers are capable of acting as forward and reverse primers for bridge amplification, and wherein the method comprises bridge amplification.

19. The method of any one of claims 15 to 18, wherein the substrate is a flow cell or a bead.

20. The method of any one of claims 15 to 19, wherein the method comprises: f) obtaining sequence information of any nucleic acid that hybridized to the substrate in step e).

21. The method of any one of claims 1 to 14, wherein: After steps a), b), c) and d) have been performed, the method further comprises obtaining sequence information from the prepared library.

22. A nucleic acid library obtained or obtainable by the method of any one of claims 1 to 14.

23. A sequencing method, wherein the method comprises obtaining sequence information of the nucleic acids in the library of claim 22.

24. A method for obtaining sequencing information, wherein the method comprises: 1) contacting the library of claim 22 with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; and 2) Obtaining sequence information of any nucleic acid hybridized to the substrate in step 1).

25. Use of the nucleic acid library according to claim 22 or a nucleic acid library obtained or obtainable by the method according to any one of claims 1 to 14 in a nucleic acid sequencing method.

26. A method for preparing a library for nucleic acid sequencing, the method comprising: i) providing a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to non-hairpin adapters under conditions favorable for ligation; and iii) exposing the plurality of nucleic acids to a hairpin adaptor under conditions that favor ligation, or exposing the plurality of nucleic acids to conditions that enable the formation of a hairpin at the end of a nucleic acid molecule; wherein the nucleic acid is not amplified during the library preparation process.

27. The method of claim 26, wherein the method comprises: iv) contacting the plurality of nucleic acids with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; wherein the non-hairpin adaptor comprises a sequence that is at least partially complementary to a first primer immobilized to the substrate; and wherein the nucleic acid is not amplified prior to step iv).

28. The method of claim 27, wherein the non-hairpin adaptor comprises a sequence identical to at least a region of a second primer and the second primer is immobilized to the substrate.

29. The method of claim 28, wherein the first and second immobilized primers are capable of acting as forward and reverse primers for bridge amplification, and wherein the method comprises bridge amplification.

30. The method of any one of claims 27 to 29, wherein the method comprises obtaining sequence information for any nucleic acid that hybridizes to the substrate in step iv).

31. The method of any one of claims 26 to 30, wherein steps ii) and iii) are performed separately, and wherein a fragmentation step is performed after step ii) and before step iii) or after step iii) and before step ii).

32. A nucleic acid library obtained or obtainable by the method of claim 26.

33. A sequencing method, wherein the method comprises obtaining sequence information of the nucleic acids within the library of claim 32.

34. A method for obtaining sequencing information, wherein the method comprises: 1) contacting the library of claim 32 with a substrate comprising a first immobilized primer under conditions suitable for hybridization of the first immobilized primer to a complementary nucleic acid; and 2) Obtaining sequence information of any nucleic acid hybridized to the substrate in step 1).

35. Use of the nucleic acid library according to claim 32 or the nucleic acid library obtained or obtainable by the method according to claim 26 in a nucleic acid sequencing method.

Images