Application of 4-methylcatechol in preparation of medicine for treating arthritis

Abstract

The invention provides application of 4-methylcatechol in preparation of a medicine for treating arthritis, and belongs to the field of medicine. It is found that 4-methylcatechol can regulate polarization of macrophages and inhibit pyroptosis of the macrophages through an NF-kB / NLRP3 signal channel, collagen-induced arthritis is improved, and the 4-methylcatechol has a wide application prospect in preparation of the medicine for treating arthritis.

Description

Technical Field

[0001] The invention belongs to the field of medicine, and in particular relates to the use of 4-methylcatechol in preparing a medicine for treating arthritis. Background Art

[0002] Rheumatoid arthritis (RA) is a chronic autoimmune disease that primarily affects bilaterally symmetrical small joints. It is characterized by the production of autoantibodies and involves various immune cells and cytokines, resulting in persistent systemic inflammation, synovitis, and pain. The pathogenesis of RA involves progressive destruction of joint structures, leading to deformity and potential disability. In clinical management, early RA is usually treated with pharmacological interventions, including nonsteroidal anti-inflammatory drugs (NSAIDs) and disease-modifying antirheumatic drugs (DMARDs). However, long-term use of these drugs is associated with significant adverse reactions, such as gastrointestinal discomfort and bone marrow suppression. In addition, the high cost of certain therapeutic drugs limits their accessibility. For patients with advanced RA, surgical intervention becomes the main treatment option, despite the recognition of the associated trauma and risks. Therefore, it is necessary to develop more effective and safer RA treatment strategies to increase patients' prognosis and improve their quality of life.

[0003] 4-Methylcatechol (4MC) is a metabolite of quercetin, has significant antiplatelet effects, is an agonist of multiple neurotrophic factors (such as nuclear factor-erythroid 2-related factor 2 (Nrf2)), can promote sciatic nerve regeneration, and can also be used to produce chemicals such as antibacterial agents, antioxidants, and high-efficiency inhibitors. There are no reports on the use of 4-methylcatechol to treat rheumatoid arthritis. Summary of the invention

[0004] The purpose of the present invention is to provide the use of 4-methylcatechol in preparing medicine for treating arthritis.

[0005] The invention provides use of 4-methylcatechol in preparing a medicine for treating arthritis.

[0006] Furthermore, the arthritis is collagen-induced arthritis.

[0007] Furthermore, the drug is a pharmaceutical preparation prepared with 4-methylcatechol as an active ingredient and pharmaceutically acceptable excipients.

[0008] Furthermore, the pharmaceutical preparation is an oral preparation or an injectable preparation.

[0009] Furthermore, the oral preparation is a tablet, a granule, or a capsule.

[0010] Furthermore, the injection preparation is a powder injection.

[0011] Further, the drug is able to protect against bone destruction.

[0012] Furthermore, the drug is capable of inhibiting the expression of pro-inflammatory cytokines.

[0013] Furthermore, the drug can upregulate anti-inflammatory cytokines in joint synovial tissue.

[0014] Furthermore, the drug can induce the transformation of macrophages from the M1 subtype to the M2 subtype.

[0015] The experimental results show that 4-methylcatechol can regulate macrophage polarization and inhibit macrophage pyroptosis through the NF-κB / NLRP3 signaling pathway, improve collagen-induced arthritis, and has broad application prospects in the preparation of drugs for the treatment of arthritis.

[0016] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0017] The above contents of the present invention are further described in detail below through specific implementation methods in the form of examples. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Effects of 4-MC on arthritis in CIA mice: (A): Schematic diagram of 4-MC treatment of arthritis in CIA mice; (B): Evaluation results of the hind feet of each group of mice; (C): Analysis results of the average paw thickness of each group of mice; (D): Arthritis score results of each group of mice; (E): Images and (F) results of evaluating the degree of bone destruction using micro-CT and three-dimensional reconstruction technology.

[0019] Figure 2 (A): H&E stained knee joint section histological image and (B) results; (C): Safranin O-Fast Green stained knee joint section histological image; (D): OARSI score results; (E): cartilage thickness results.

[0020] Figure 3 Effects of 4-MC on proinflammatory cytokines in synovial tissue and serum: (A) Immunohistochemistry images and (B) results of each group of mice; (C) Expression of IL-1β, IL-6 and TNF-α in each group of mice detected by ELISA.

[0021] Figure 4Figure 4-MC induced transformation of macrophages: (A): Cell viability test results under CCK8 experiment; (B): Immunofluorescence detection of M1 macrophage marker (iNOS) and M2 macrophage marker (ARG-1) expression; (C): Relative expression analysis results of iNOS and ARG-1; (D): Western blot (WB) analysis image; (E), (F): Expression levels of pro-inflammatory cytokines in each group in ELISA results; (G): Western blot result image; (H): Effect of 4-MC drug on Nrf2 and HO-1 protein expression in BMDMs.

[0022] Figure 5 Effects of 4-MC on NLRP3 inflammasome and downstream pyroptosis-related proinflammatory cytokines: (A): Detection of IL-1β content in the culture supernatant of BMDMs in each group treated with 4-MC drug by ELISA; (B): Number of FITC-positive cells in each treatment group; (C): Effect of 4-MC drug on LDH release in BMDMs; (D): Expression levels of NLRP3, GSDMD, Caspase-1 and IL-1β by real-time fluorescence quantitative PCR (qPCR); (E): Western blot analysis images and (F) protein expression of NLRP3 and its downstream factors.

[0023] Figure 6 4-MC inhibits the over-activation of NF-κB signaling pathway: (A) Western blot analysis images; (B) Effects of P-P65 / P65 and P-IκBα / IκBα ratios in each treatment group; (C) Immunofluorescence detection of the effect of 4-MC on the entry of P65 in the cytoplasm into the nucleus; (D) Western blot analysis of the images and results of the expression of P65 protein in the cytoplasm and nucleus after 4-MC drug treatment.

[0024] Figure 7 4-MC inhibits IKK phosphorylation and weakens NF-κB pathway activation: (A) Western blot analysis image; (B) Effects of 4-MC on TRAF6, P-TAK1 / TAK1 and P-IKKαβ / IKKα in BMDMs; (C) Western blot analysis image under time-dependent gradient experiment; (D) Effects of 4-MC on P-IKKαβ / IKKα in BMDMs under time-dependent gradient experiment. DETAILED DESCRIPTION

[0025] The raw materials and equipment used in the present invention are all known products, which are obtained by purchasing commercially available products.

[0026] The “room temperature” referred to in the present invention means 25±10° C., and the “overnight” referred to in the present invention means 12±5 hours.

[0027] Example 1. Effect of 4-methylcatechol in treating rheumatoid arthritis

[0028] 1. Experimental methods

[0029] 1.1 Establishment of CIA mouse model

[0030] The animals used in the present invention were approved by the Ethics Committee of the First Affiliated Hospital of Shandong First Medical University. Male DBA / 1 mice, 10 weeks old, were obtained from Jinan Pengyue Experimental Animal Breeding Co., Ltd. In order to establish a collagen-induced arthritis (CIA) mouse model, an emulsion containing complete Freund's adjuvant (Chondrex, USA) and immune-grade bovine type II collagen (Chondrex, USA) at a concentration of 1.0 mg / ml was subcutaneously injected at the base of the mouse tail on day 1. Incomplete Freund's adjuvant was used for booster immunization on day 22 under the same conditions. On day 22, the mice were divided into 4 groups: a control group (PBS treatment, n=5), a CIA group (CIA mice were treated with PBS, n=5), a low-dose 4-MC group (CIA mice were treated with a daily dose of 10 mg / kg 4-MC, n=5), and a high-dose 4-MC group (CIA mice were treated with a daily dose of 20 mg / kg 4-MC, n=5). 4-MC (MCE, USA) was dissolved in a sterile saline solution. Starting from the 22nd day, mice in the low-dose group and high-dose group were intraperitoneally injected with 10mg / kg 4-MC and 20mg / kg 4-MC, respectively, and mice in the control group and CIA group were injected with the same amount of sterile saline every day. The thickness of the paws and the severity of arthritis of the mice were measured every 3 days, and the mice were killed on the 49th day.

[0031] 1.2 Arthritis score

[0032] The severity of arthritis was assessed every 3 days by 3 independent investigators who were unaware of the group assignments. The paws of each mouse were evaluated and graded based on swelling and mobility (0-4 points) (0 points: no redness and swelling; 1 point: mild erythema and limited swelling in the tarsal bones, ankle joints, or a single joint of one foot; 2 points: redness and swelling extending from the ankle joint to the tarsal plate or involving 2 or more toes, mild swelling; 3 points: moderate erythema, swelling extending from the ankle joint to the metatarsal joint or involving the entire paw; 4 points: severe redness and widespread swelling around the ankle joint, foot, and fingers, which may lead to limb stiffness and dysfunction). The cumulative score of all four paws was calculated as the arthritis index score for each CIA mouse, ranging from 0 to 16 points.

[0033] 1.3ct machine analysis

[0034] For microCT analysis, the left hind limb of the mouse was fixed with 4% paraformaldehyde and scanned with a high-resolution microCT scanner (Quantum GX2) at an isometric resolution of 2.3 μm. The claw bones were reconstructed in three dimensions using the Quantum software. Caliper Analyze software was used to analyze various parameters of the trabecular bone area, including bone mineral density (BMD, mg cm -3 ), bone volume (BV), bone volume to tissue volume ratio (BV / TV, %), trabecular separation (also known as trabecular spacing, Tb.Sp, mm), trabecular number (Tb.N, mm –1 ), trabecular thickness (Tb.Th, μm).

[0035] 1.4 Histological analysis and immunohistochemical staining

[0036] After the animals were sacrificed, the specimens were fixed in 4% paraformaldehyde for 48 hours. After decalcification with 10% ethylenediaminetetraacetic acid (EDTA) for 28 days, they were embedded in paraffin. The sections were stained with hematoxylin-eosin (H&E), safranin O-fast green, and TRAP to determine the pathology of the ankle joint. According to the OARSI criteria (0 points: normal 1 point: small wear of the articular cartilage surface and fibrosis under the cartilage surface, no loss of chondrocytes or cartilage matrix, and the area of ​​lesion is less than 5% of the total area. 2 points: The lesion is vertical and below the surface of the cartilage, but rarely extends to the deeper cartilage layer. There is partial loss of the matrix on the cartilage surface, or local areas of loss of chondrocytes / proteoglycan can be seen, but there is still good collagen preservation, and the area of ​​cartilage damage accounts for about 5% to 10% of the total cartilage surface. 3 points: The lesion vertically involves the calcified cartilage layer, and local areas of chondrocytes / proteoglycan are lost. About 10% to 24% of the articular cartilage is involved. 4 points: Vertical cracks / lesions extend 5 points: vertical cracks / destruction extending to below the calcified cartilage, more than 25% to 50% of the cartilage on the joint surface, or localized areas of chondrocytes / proteoglycan loss, involving 25% to 50% of the thickness of the articular cartilage. 6 points: vertical cracks / destruction of the cartilage extending to below the calcified cartilage, more than 75% of the articular surface damaged, or localized areas of chondrocytes / proteoglycan loss, about 50% to 75% of the cartilage thickness damaged. 3 points: vertical cracks / destruction of the cartilage extending to below the calcified cartilage, more than 75% of the articular surface damaged, and only a small amount of acellular collagen may remain. ) Cartilage destruction was evaluated and scored by immunostaining analysis of animal specimens by 3 independent researchers who were unaware of the experimental conditions. After antigen retrieval, tissue sections were blocked and incubated with primary antibodies against TNF-α, IL-10, NLRP3, and Caspase-1. Subsequently, diaminobenzidine (DAB) staining was performed using species-specific secondary antibodies. Immunohistochemical analysis was performed using ImageJ software.

[0037] 1.5 Cell culture and treatment

[0038] Bone marrow macrophages (BMDMs) were isolated from the bone marrow of the lower limbs of C57BL / 6 mice and cultured in α-minimum essential medium (α-MEM) supplemented with 10% fetal bovine serum (FBS), 10 ng / mL macrophage colony stimulating factor (M-CSF), and 100 U / mL penicillin / streptomycin (P / S). After 7 days of culture, the cells were divided into 4 groups: control group, LPS group, low-dose 4-MC group (LPS+20 μmol / L 4-MC), and high-dose 4-MC group (LPS+40 μmol / L 4-MC). The cells were stimulated with LPS at a concentration of 100 ng / mL, and each group was incubated for 8 hours. To induce cell pyroptosis, cells were first treated with LPS at a concentration of 100 ng / mL for 7 hours, and then treated with ATP at a concentration of 2.5 mmol / L for 1 hour.

[0039] (1) Evaluation of cell viability

[0040] BMDMs were seeded in 96-well plates and incubated for 24 hours. Cell viability after treatment with different concentrations of 4-MC was assessed using the Cell Counting Kit-8 (CCK-8). Cell viability was determined by the absorbance at 450 nm.

[0041] (2) Immunofluorescence staining

[0042] BMDMs were seeded in 24-well plates and cultured in α-MEM for 7 days. The cells were divided into the designated groups according to the above method. After LPS and ATP treatment, the primary antibodies (iNOS, Arg-1, F4 / 80) were used to stain BMDMs overnight at 4°C after fixation and blocking, referring to the immunofluorescence staining in 1.4. Subsequently, the secondary antibodies specific to each primary antibody were used for staining, and 4',6-diamidino-2-phenylindole (DAPI) was used for counterstaining for 2 minutes at room temperature. The stained cells were observed under a fluorescence microscope and image analysis was performed.

[0043] 1.8 Flow cytometry

[0044] BMDMs were seeded in 12-well culture dishes and cultured in α-MEM for 24 h. The cells were then divided into the designated groups as described above. After LPS and ATP treatment, single cell suspensions were collected and then centrifuged at 300 × g for 5 min at 4 °C. Subsequently, cells were incubated on ice with Annexin V-FITC working solution and propidium iodide-a. Finally, the cells were resuspended and analyzed using a FACS caliber flow cytometer (BD FACSARIA II). The obtained data were analyzed using Cell Quest data analysis software.

[0045] 1.9ELISA

[0046] First, the samples were centrifuged to obtain serum or cell supernatant. Subsequently, a standard curve was constructed according to the instructions provided by the ELISA kit. The absorbance value of each sample was measured, and the concentration of IL-1β, TNF-α, and IL-6 in each sample was calculated based on the standard curve.

[0047] 1.10LDH release test

[0048] The release of lactate dehydrogenase (LDH) was quantified using a commercial kit (Beyotime) according to the manufacturer's instructions.

[0049] 1.11 Western Blot Analysis

[0050] Western Blot analysis was performed according to the method in 1.4. After quantitative analysis of proteins using the BCA method, 15 μg of protein per well in BMDMs was separated by 10% or 12% SDS-PAGE and then transferred to a PVDF membrane. After blocking, the membrane was incubated with primary antibodies targeting NLRP3, Caspase-1, IL-1β, ASC, GSDMD, iNOS, ARG-1, and β-actin at 4°C overnight. Subsequently, the PVDF membrane was incubated with an enzyme-labeled secondary antibody for 1.5 hours, and then visualized and quantified using an ECL reagent.

[0051] 1.12 Real-time PCR

[0052] Real-time quantitative PCR: Total RNA was extracted using the VeZol-Pure Total RNA Isolation Kit (vazyme) according to the manufacturer's instructions. The isolated mRNA was used for reverse transcription polymerase chain reaction (PCR) to generate complementary DNA (cDNA), and qPCR (+gDNA wiper) (vazyme) was performed using HiScriptIII RT SuperMix. Subsequently, RT-qPCR analysis was performed using cDNA and ChamQ UniversalSYBR qPCR Master Mix (vazyme). Gene expression levels were normalized to GAPDH and quantified using the 2-ΔΔCT method. The primer sequences used in the present invention are shown in Table 1.

[0053] Table 1 Primer sequences used

[0054] mRNA Forward primer (5′–3′) Reverse primer (5′–3′) iNos GCCAACATGCTACTGGAGGT TGGAGCACAGCCACATTGAT ARG-1 ACATTGGCTTGCGAGACGTA ATCACCTTGCCAATCCCCAG IL10 GCTCTTGCACTACCAAAGCC CTGCTGATCCTCATGCCAGT TNF-α CGGGCAGGTCTACTTTGGAG ACCCTGAGCCATAATCCCCT IL-6 AGACAAAGCCAGAGTCCTTCAG TGTGACTCCAGCTTATCTCTTGG Il1β GTGTCTTTCCCGTGGACCTT AATGGGAACGTCACACACCA Caspase-1 CGTACACGTCTTGCCCTCAT AACTTGAGCTCCAACCCTCG NLRP3 TCTGCACCCGGACTGTAAAC CATTGTTGCCCAGGTTCAGC GSDMD CGATCTCATTCCGGTGGACAG GGTTTCCAGAACCTTGAGCTTG

[0055] 1.13 Statistical analysis

[0056] Data are expressed as mean ± standard deviation (SD). Kruskal-Wallis test was used to evaluate the significance of differences in histopathological scores. Other quantitative data were analyzed using t-test or one-way analysis of variance. GraphPad Prism 8 was used for statistical analysis, and P < 0.05 was considered statistically significant.

[0057] 2. Experimental results

[0058] 2.1 4-MC reduces the severity of arthritis in CIA mice

[0059] In order to study the role of 4-MC in rheumatoid arthritis (RA), the present invention established a collagen-induced arthritis (CIA) model to simulate RA. After the second immune enhancement, the treatment group was intraperitoneally injected with 4-MC ( Figure 1 A). From day 21 to day 48, the hind feet of each group of mice were evaluated every 3 days. On day 30, the soles of the feet of CIA-positive mice were significantly swollen ( Figure 1 B), by day 48, the average paw thickness increased by 3.4 ± 0.6 mm. However, compared with the CIA-positive group, the average paw thickness decreased significantly with increasing 4-MC concentrations ( Figure 1 C). In addition, one week after the second immune boost, the arthritis scores of CIA-positive mice increased significantly; however, as the concentration of 4-MC drug increased, the scores of the treatment groups decreased ( Figure 1 D).

[0060] 2.2 4-MC has a protective effect on bone destruction in CIA mice

[0061] Cartilage erosion and bone destruction are prominent pathological features of rheumatoid arthritis (RA). Micro-CT and three-dimensional reconstruction techniques were used to evaluate the degree of bone destruction. The results showed that the bone structure of CIA-positive mice was severely damaged, as manifested by decreased bone mineral density (BMD), decreased bone volume (BV), decreased bone volume / total volume ratio (BV / TV), decreased trabecular number (Tb.N) and trabecular thickness (Tb.Th), and increased trabecular spacing (Tb.Sp). However, these parameters showed significant improvement in the group treated with 4-MC, and more obvious enhancement was observed in the treatment with higher concentrations of 4-MC ( Figure 1 EF).

[0062] Histological analysis of knee joint sections stained with H&E showed synovial hyperplasia, joint surface damage, and extensive inflammatory cell infiltration in the CIA-positive group. In contrast, these pathological changes were rarely observed in the 4-MC-treated group, and the effect was more obvious in the high-concentration group ( Figure 2 AB). Safranin O-fast green staining showed an OARSI score of 5.5±0.5, and the CIA-positive group showed complete erosion of the surface cartilage; however, treatment with 4-MC significantly protected the cartilage tissue on the surface of the knee joint, especially at high concentrations ( Figure 2 CE). These results indicate that 4-MC has a significant protective effect on bone destruction and loss in RA mouse models by alleviating arthritis symptoms, protecting bone tissue structure, inhibiting synovial hyperplasia and inflammatory cell infiltration, and significantly improving joint pathology.

[0063] 2.3 4-MC reduces the levels of pro-inflammatory cytokines in synovial tissue and serum

[0064] Proinflammatory cytokines play a key role as inflammatory regulators in rheumatoid arthritis RA, driving synovial inflammation and joint destruction. In order to confirm the effect of 4-MC on the production of proinflammatory cytokines in vivo, the present invention uses immunohistochemistry and ELISA methods to evaluate the expression levels of proinflammatory and anti-inflammatory cytokines. The results of immunohistochemistry showed that compared with the control group, the number of anti-inflammatory IL-10 positive cells in the synovial tissue of the joints of CIA mice was significantly reduced, while the number of proinflammatory TNF-α positive cells was significantly increased. However, increasing the dose of 4-MC treatment led to a large increase in IL-10 positive cells in the synovial tissue of the joints, and a gradual decrease in TNF-α positive cells ( Figure 3 AB). In addition, ELISA assays showed that the levels of IL-1β, IL-6, and TNF-α were elevated in the serum of CIA mice; however, 4-MC significantly reduced these proinflammatory cytokines ( Figure 3 C). These findings suggest that 4-MC can effectively inhibit the expression of pro-inflammatory cytokines while promoting the upregulation of anti-inflammatory cytokines in the synovial tissue of CIA mice, thereby alleviating synovial inflammation and reducing joint destruction.

[0065] 2.4 4-MC induces macrophages to switch from M1 to M2 subtype

[0066] M1 macrophages play a leading role in regulating the pro-inflammatory microenvironment to promote bone resorption. In order to study the effect of 4-MC on macrophage polarization, the present invention conducted a CCK8 experiment and observed that after stimulating BMDMs with >50 μmol 4-MC for 48 hours, cell viability was significantly reduced ( Figure 4 A). Therefore, a maximum of 40 μmol of 4-MC was used in subsequent experiments. Immunofluorescence staining showed that iNOS expression levels were significantly increased and ARG-1 expression levels were decreased after LPS stimulation. 4-MC showed a concentration-dependent inhibition of iNOS expression, accompanied by an increase in ARG-1 expression ( Figure 4 In addition, the findings from immunofluorescence staining were further verified by Western blot (WB) analysis ( Figure 4 D). ELISA results further showed that 4-MC could effectively reduce the levels of pro-inflammatory cytokines IL-6, iNOS, and TNF-α induced by LPS, while enhancing the levels of anti-inflammatory cytokines AGR1 and IL-10 in a dose-dependent manner ( Figure 4 E, F).

[0067] Enhancement of the Nrf2 / HO-1 signaling pathway has been shown to have anti-inflammatory effects and attenuate M1 polarization of macrophages. In order to elucidate the potential mechanism of 4-MC in regulating macrophage polarization, the present invention further investigated the protein expression levels of the Nrf2 / HO-1 signaling pathway. Western blot results showed that after LPS treatment, the expression of Nrf2 and HO-1 in BMDMs was significantly inhibited, while 4-MC showed a dose-dependent increase in Nrf2 and HO-1 protein levels ( Figure 4 GH). In conclusion, under LPS stimulation, 4-MC treatment promotes the transition of macrophages from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype, thereby inhibiting the release of pro-inflammatory cytokines. In summary, this is consistent with the results of in vivo experiments.

[0068] 2.5 4-MC has an inhibitory effect on NLRP3 inflammasome and downstream pro-inflammatory cytokines

[0069] Numerous studies have consistently shown that activation of the NLRP3 inflammasome promotes inflammation by releasing proinflammatory cytokines (such as IL-1β), playing a key role in the pathogenesis of rheumatoid arthritis (RA). First, the present invention used ELISA to evaluate the serum IL-1β levels of different groups of mice ( Figure 5A). The results showed that the serum IL-1β level of mice in the CIA-positive group was significantly increased compared with that in the control group. In contrast, a dose-dependent decrease in IL-1β level was observed in the 4-MC-treated group. The effects of 4-MC on LPS- and ATP-induced cell pyroptosis were further evaluated by Annexin V-FITC staining, flow cytometric analysis, and quantitative analysis of lactate dehydrogenase (LDH) release. Figure 5 As shown in B, LPS and ATP treatment led to a significant increase in the number of FITC-positive cells, while 4-MC treatment showed a dose-dependent decrease in the number of FITC-positive cells. Figure 5 As shown in C, LPS and ATP stimulation significantly enhanced LDH release, while 4-MC showed a significant dose-dependent decrease in LDH release.

[0070] The present invention further uses real-time fluorescence quantitative PCR (qPCR) to analyze the effect of 4-MC on NLRP3 and its downstream proinflammatory cytokines. The results show that both LPS and ATP can significantly increase the expression levels of NLRP3, GSDMD, Caspase-1 and IL-1β, thereby inducing cell pyroptosis. However, 4-MC intervention leads to a significant dose-dependent decrease in their mRNA expression levels ( Figure 5 D). Western blot analysis further showed that the expression levels of NLRP3 inflammasome-related proteins were significantly upregulated under LPS and ATP stimulation ( Figure 5 E, F); however, after treatment with 4-MC, the levels of these proteins decreased in a dose-dependent manner. Taken together, our results highlight the substantial inhibitory effect of 4-MC on pyroptosis.

[0071] 2.6 4-MC can effectively inhibit the excessive activation of NF-κB signaling pathway.

[0072] In order to further clarify the potential mechanism of 4-MC's anti-inflammatory effect, the present invention studied its effect on the NF-κB signaling pathway. The key role of the NF-κB signaling pathway in a variety of physiological and pathological processes has been confirmed, and there is evidence that inhibition of phosphorylated IκBα, NF-κB p65 and nuclear translocation can effectively inhibit this pathway. Western blot analysis showed that the phosphorylation levels of P65 and IκBα were significantly increased under LPS stimulation. However, 4-MC treatment significantly reduced the phosphorylation levels of P65 and IκBα, resulting in a decrease in the P-P65 / P65 and P-IκBα / IκBα ratios ( Figure 6 A, B). Immunofluorescence analysis showed that in the absence of LPS stimulation, the cytoplasm-to-nuclear translocation of P65 was minimal; however, after exposure to LPS, nuclear localization was significantly increased. 4-MC treatment showed a significant dose-dependent inhibition of LPS-induced P65 nuclear translocation ( Figure 6C). To further verify the findings in the immunofluorescence analysis, the present invention then performed separate analyses of nuclear and cytoplasmic proteins. Consistent results were obtained by Western blot analysis of nuclear and cytoplasmic protein components ( Figure 6 D). In summary, 4-MC has a significant inhibitory effect on the activation of NF-κB signaling pathway by effectively inhibiting P65 phosphorylation and hindering nuclear translocation.

[0073] 2.7 4-MC attenuates NF-κB pathway activation by inhibiting IKK phosphorylation

[0074] Generally, the activation of NF-kB involves two different pathways, namely the canonical pathway and the alternative pathway. To achieve NF-kB activation, the phosphorylation and subsequent degradation of inhibitory kappaB (IkB) proteins require the participation of IkB kinases (IKK), specifically IKKα and IKKβ. In addition, TNF-α receptor-activated factor 6 (TRAF6) acts as a signal transducer to activate IKK in response to proinflammatory mediators, while the transforming growth factor β-activated kinase 1 (TAK1) kinase complex has also been shown to phosphorylate and activate IKK. In order to determine the specific regulatory targets of 4-MC after LPS stimulation, the present invention isolated proteins from BMDM after 30 minutes of LPS treatment and evaluated the expression of upstream regulatory proteins involved in NF-κB signaling. The results showed that 4-MC did not significantly affect the expression of TRAF6 or phosphorylated TAK1, and 4-MC could effectively inhibit the phosphorylation of IKKα / β. In addition, time course experiments consistently confirmed that 4-MC consistently inhibited IKKα / β phosphorylation at different time points ( Figure 7 CD). These results suggest that the anti-inflammatory effect of 4-MC is mediated by directly inhibiting IKKα / β phosphorylation, thereby regulating NF-κB activity.

[0075] The above results indicate that 4-methylcatechol can alleviate arthritis in CIA mice, has a protective effect on bone destruction in CIA mice, inhibits the expression of proinflammatory cytokines, and promotes the upregulation of anti-inflammatory cytokines in the synovial tissue of the joints of CIA mice, induces the transformation of macrophages from the M1 subtype to the M2 subtype, and effectively inhibits the overactivation of the NF-κB signaling pathway.

[0076] In summary, the present invention provides the use of 4-methylcatechol in preparing drugs for treating arthritis. The present invention finds that 4-methylcatechol can regulate macrophage polarization and inhibit macrophage pyroptosis through the NF-κB / NLRP3 signaling pathway, improve collagen-induced arthritis, and has broad application prospects in preparing drugs for treating arthritis.

Claims

Use of 1.4-methylcatechol in preparing medicine for treating arthritis.

2. The use according to claim 1, characterized in that The arthritis is collagen-induced arthritis.

3. The use according to claim 1, characterized in that The medicine is a medicine preparation prepared by taking 4-methylcatechol as an active ingredient and adding pharmaceutically acceptable auxiliary materials.

4. The use according to claim 3, characterized in that The pharmaceutical preparation is an oral preparation or an injection preparation.

5. The use according to claim 4, characterized in that The oral preparations are tablets, granules and capsules.

6. The use according to claim 4, characterized in that The injection preparation is a powder injection.

7. The use according to claim 1, characterized in that The drug is able to protect against bone destruction.

8. The use according to claim 1, characterized in that The drug is capable of inhibiting the expression of pro-inflammatory cytokines.

9. The use according to claim 1, characterized in that The drug can upregulate anti-inflammatory cytokines in joint synovial tissue.

10. The use according to claim 1, characterized in that The drug can induce the transformation of macrophages from the M1 subtype to the M2 subtype.

Images