Application of lettuce LsOFP6 gene in controlling leaf included angle character of lettuce

Abstract

The invention belongs to the technical field of plant engineering, and discloses an application of a lettuce LsOFP6 gene in controlling the leaf included angle character of lettuce, and the full length of the gene is shown as SEQ ID NO.1. The result of knocking out the LsOFP6 gene from the lettuce with the lobular included angle through a CRISPR-Cas9 technology shows that the lettuce with the lobular included angle can be changed into the lettuce with the large included angle through the LsOFP6 gene with the lost function. The LsOFP6 gene is transformed into the lettuce with the large-leaf included angle through agrobacterium tumefaciens mediation, and the result shows that the LsOFP6 can convert the lettuce with the large-leaf included angle into the lettuce with the small-leaf included angle. The cloning of the LsOFP6 gene opens up a new direction for the development and plant type research of the leaf included angle of the plant, and also provides gene resources and theoretical guidance for the variety breeding of the lettuce with the leaf included angle.

Description

Technical Field

[0001] The invention belongs to the technical field of plant engineering, and particularly relates to application of a lettuce LsOFP6 gene in controlling a lettuce leaf angle trait. Background Art

[0002] Lettuce (Lactuca sativa L.) is a plant of the genus Lactuca in the Asteraceae family, which originated and was domesticated in the Mediterranean region. According to its different plant types and edible parts, lettuce can be further divided into leaf lettuce (Lactuca sativa Linn. var. ramosa Hort.) and stem lettuce (Lactuca sativa Linn. var. angustata Irish ex Bremer). The angle of lettuce leaves is a very important factor determining plant type, which is specifically manifested as the angle between the lettuce leaf and the stem. Compared with large-leaf lettuce, small-leaf angle lettuce has a more compact plant type, a higher planting density per unit area, a higher yield, and is convenient for harvesting and transportation. It can better meet the needs of facility agriculture and plant factories, and is therefore favored by growers and consumers. Worldwide, lettuce is an important vegetable cash crop. my country is the country with the largest lettuce production in the world, so lettuce has very important economic value. In 2017, the lettuce genome was sequenced, which facilitated the cloning of genes for different agronomic traits of lettuce and their functional studies.

[0003] The leaf angle trait of lettuce is a quantitative trait controlled by multiple genes and easily affected by environmental factors. There are few reports on the inheritance of the leaf angle trait of lettuce and the genes that control the leaf angle trait. The applicant previously cloned a gene LsNRL4 that controls the leaf angle trait of lettuce through genetic positioning. LsNRL4 became the first gene that controls the leaf angle trait identified in lettuce, but the regulatory network of lettuce leaf angle is still unclear. Therefore, cloning other genes that control the leaf angle trait of lettuce and analyzing their mechanism of action have important theoretical and application value. Summary of the invention

[0004] The object of the present invention is to provide an application of the lettuce LsOFP6 gene in controlling the leaf angle trait of lettuce. The protein encoded by the gene is shown in SEQ ID NO.3, and the corresponding CDS sequence is shown in SEQ ID NO.2.

[0005] In order to achieve the above object, the present invention adopts the following technical measures:

[0006] Obtaining the gene LsOFP6 related to the leaf angle trait of lettuce:

[0007] The present invention obtains F1 hybrids by hybridizing small-leaf angle lettuce with large-leaf angle lettuce, and then obtains F2 populations by selfing. The F2 population is used to locate the gene that controls the leaf angle trait of lettuce by combining BSR-seq and positional cloning methods. Gene annotation and candidate gene analysis are performed on the positioning interval to determine the candidate gene, and the key gene LsOFP6 that controls the leaf angle trait of lettuce is successfully cloned. The gene encodes a transcriptional auxiliary factor of the Ovate family proteins (OFP) family. OFP family genes play a key regulatory role in the maintenance of plant apical meristems, leaf development, flowering period regulation, etc. Sequence analysis found that in large-leaf angle lettuce, the 352nd base "G" of the gene coding sequence mutated to the base "T", resulting in premature termination of translation and loss of gene function, thereby causing the leaf angle to increase. The difference between the Lsofp6 gene and its allele is whether the 352nd base "G" of its coding sequence mutates to the base "T".

[0008] The LsOFP6 gene has no introns. The protein encoded by the LsOFP6 gene is shown in SEQ ID NO.3, its CDS is shown in SEQ ID NO.2, and the full length of the LsOFP6 gene is shown in SEQ ID NO.1.

[0009] The protection scope of the present invention includes:

[0010] The invention discloses an application of the lettuce LsOFP6 gene in controlling or detecting the leaf angle trait of lettuce. The protein encoded by the lettuce LsOFP6 gene is shown in SEQ ID NO.3.

[0011] The above-mentioned applications are as follows:

[0012] Application of increasing the expression level of LsOFP6 gene in lettuce to reduce the angle of lettuce leaves;

[0013] The above application process is to introduce a substance that increases the expression of the lettuce LsOFP6 gene into lettuce, wherein the substance is an expression cassette containing the LsOFP6 gene, a recombinant vector, a recombinant microorganism or an in vitro recombinant cell;

[0014] Application of knocking out or inhibiting the expression of lettuce LsOFP6 gene in increasing the angle of lettuce leaves;

[0015] In the above-mentioned applications, the knockout is achieved by homologous recombination or CRISPR-Cas9 method, and the protein translated from the gene after the knockout has no original function or cannot be translated into protein.

[0016] In the above-mentioned application, the inhibition is antisense RNA technology or interfering RNA technology.

[0017] In the above-mentioned application, the knockout adopts the CRISPR-Cas9 method, and the gRNA sequence is: TGACTCCAATGTCGTGCAA.

[0018] In the above application, the lettuce plant with increased leaf angle obtained after knockout contains the sequence shown in SEQ ID NO.4 or SEQ ID NO.5.

[0019] The application of detecting the gene encoding the protein shown in SEQ ID NO.3 in the screening or breeding of lettuce leaf angle traits.

[0020] The determination method in the above application is: the lettuce with small leaf angle is detected by the gene. The application of the gene encoding the protein shown in SEQ ID NO.3 in creating transgenic lettuce with large leaf angle or small leaf angle.

[0021] In the above application, preferably, the lettuce LsOFP6 gene is shown in SEQ ID NO.1 or SEQ ID NO.2. Compared with the prior art, the present invention has the following advantages:

[0022] The invention proposes a method for rapidly isolating a control gene for controlling the angle of lettuce leaves, which has important theoretical significance for the research and breeding of the angle of lettuce leaves and even the angle of leaves of other vegetables. The research on the molecular mechanism of the angle of lettuce leaves and the regulation pathway of leaf development and plant type has important theoretical significance. In addition, up to now, the LsOFP6 gene has never been reported to be involved in the leaf angle phenotype of any plant. The gene can provide a new gene resource for lettuce breeding, which is conducive to the cultivation of new lettuce varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the phenotypes of small-leaf angled lettuce (left) and large-leaf angled lettuce (right), with a scale of 10 cm.

[0024] Figure 2 Schematic diagram showing that there is a genetic locus controlling the leaf angle trait of lettuce at approximately 120Mb on chromosome 2 of lettuce.

[0025] Figure 3 The effects of overexpression and knockout of LsOFP6 gene on leaf angle of lettuce;

[0026] Wherein: (a) the LsOFP6 gene was overexpressed in lettuce with large leaf angle, and the positive overexpression transgenic plant LsOFP6-OX#1 was obtained, and the phenotype of LsOFP6-OX#1 changed from large leaf angle to small leaf angle (first from left, second from left); the LsOFP6 gene was knocked out in lettuce with small leaf angle, and the homozygous knockout plant LsOFP6 gene Lsofp6-KO#1 was obtained, and the phenotype of Lsofp6-KO#1 changed from small leaf angle to large leaf angle (second from right, first from right); the scale is 10 cm;

[0027] (b) Genotypic and phenotypic analysis of individual plants of the T1 generation of the transgenic plant LsOFP6-OX#1; the wells with amplified bands represent plants containing LsOFP6 transgenic insertions; the wells without amplified bands represent plants without LsOFP6 transgenic insertions.

[0028] (c) Comparison of the nucleotide sequences of LsOFP6 gene in homozygous knockout plants Lsofp6-KO#1, Lsofp6-KO#2 and LsOFP6 gene. DETAILED DESCRIPTION

[0029] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels.

[0030] Embodiment 1:

[0031] Acquisition of lettuce leaf angle gene LsOFP6:

[0032] 1. Genetic analysis of leaf angle traits in lettuce

[0033] In order to analyze the genetic law of lettuce leaf angle traits, the present invention uses small leaf angle lettuce (S12) and large leaf angle lettuce (S14) to cross to obtain F1 hybrids (Zhang et al. 2017), and the F1 hybrids are self-pollinated to obtain F2 populations. The leaf angle phenotype of each individual in the F2 population was statistically analyzed. The results showed that there were only plants with large leaf angle phenotype and small leaf angle phenotype in the F2 population, and no other phenotypes, and the number of plants with small leaf angle was 3:1 (χ 2 < 2 (0.05,1)=3.84, P>0.05), which proved that in this population, the lettuce leaf angle trait was controlled by a single gene and the large leaf angle phenotype was a recessive trait.

[0034] The leaf angle of the F2 population was genetically analyzed by BSA combined with RNA-seq. In the F2 segregating population, 20 individuals with small leaf angles were selected to construct a "small leaf angle pool", and 20 individuals with large leaf angles were selected to construct a "large leaf angle pool". RNA extraction and next-generation sequencing analysis were performed on the two mixed pools. The sequencing data were aligned to the lettuce reference genome (Lactucasativa vs Salinas V8), and the Δ (SNP-index) value of each SNP was calculated. The results showed that there was an obvious QTL locus on chromosome 2 that controlled the leaf angle trait.

[0035] 2. Map-based cloning of LsOFP6 gene

[0036] In order to clone the key gene controlling the leaf angle trait of lettuce in the above F2 population, this study used the map-based cloning method and molecular markers to finally locate the candidate gene between OFP6-M11 (119.321Mb) and OFP6-M18 (120.284Mb), within a range of about 0.963Mb. The sequence of this interval was annotated and analyzed, and a total of 10 genes were encoded in this interval, among which the gene LG2191590 had obvious sequence differences in the two mixed pools. Therefore, we used this gene as a candidate gene. LG2191590 encodes a direct homologous gene of the Arabidopsis OFP6 (AT3G52525) gene, which we named LsOFP6. Sanger sequencing analysis found that compared with the LsOFP6 gene of the small leaf angle parent (the full length of the LsOFP6 gene is shown in SEQ ID NO.1, the CDS sequence is SEQ ID NO.2, and the amino acid sequence is SEQ ID NO.3), the 352nd base "G" in the CDS sequence of the LsOFP6 allele Lsofp6 in the large leaf angle parent mutated to the base "T", resulting in premature termination of Lsofp6 gene translation and loss of gene function, which in turn caused the leaf angle to increase.

[0037] Embodiment 2:

[0038] Application of LsOFP6 gene in controlling leaf angle of lettuce:

[0039] (1) Using the cDNA of small-leaf angle lettuce (S12) as a template, primers: AGH738F: ATGCCTACTGTGAAGAGGAAACTC and AGH738R: TTAAACCGAAAGGCTGTTCCAGA, the target fragment amplified was the sequence shown in SEQ ID NO.2, which was inserted into the pRI101 plant expression vector (the vector was linearized by BamHI and XhoI) by homologous recombination, and transformed into large-leaf angle lettuce under Agrobacterium-mediated transformation. Transgenic detection primers: PH7L19F: ACTGACGTAAGGGATGACGC; GFPR: GGACACGCTGAACTTGTG were used to detect transgenic plants, and a total of 5 transgenic plants were obtained, all of which showed the phenotype of small-leaf angle ( Figure 3 The second left image in (a) shows the phenotype of one of the transgenic plants, LsOFP6-OX#1. Analysis of the leaf angle phenotype and genotype of the T1 generation of one of the transgenic lines revealed that the plants with transgenic insertion all showed a small leaf angle phenotype, while the plants without transgenic insertion showed a large leaf angle phenotype ( Figure 3 Middle (b) shows that the leaf angle phenotype of the transgenic plants is co-segregated with the transgenic insertion fragment, further verifying that LsOFP6 has the function of controlling the leaf angle of lettuce.

[0040] (2) The CRISPR-Cas9 technology was used to knock out the LsOFP6 gene in the small-leaved angular lettuce. The gRNA sequence was: TGACTCCAATGTCGTGCAA. The gRNA and U6 promoter sequence were inserted into the CRISPR-Cas9 knockout vector pKSE401 linearized by BsaI (Tang et al. 2018) by homologous recombination, and the small-leaved angular lettuce was transformed under Agrobacterium-mediated transformation. The transgenic detection primers: U26F: tgtcccaggattagaatgattaggc; U29R: agccctcttctttcgatccatcaac were used to detect transgenic plants, and a total of 2 gene knockout transgenic plants were obtained. The knockout events of each strain were analyzed by Sanger sequencing ( Figure 3 In (c), the mutant sequences obtained by sequencing are as follows: Lsofp6-KO#1: ACACAGCAACTCATGACTCCAATGTCGTGCAGGTTTGGGTGGCTCA Lsofp6-KO#2: ACACAGCAACTCATGACTCCAATGTCGTGCATTGGGTGGCTCA

[0041] The phenotype and genotype analysis of the T1 representatives of all two transgenic lines showed that the plants with homozygous knockout of the LsOFP6 gene all showed a large leaf angle phenotype, while the plants with no knockout or heterozygous knockout of the LsOFP6 gene showed a small leaf angle phenotype ( Figure 3 The leaf angle phenotype of one of the transgenic plants, Lsofp6-KO#1, is shown in the middle (a) on the right, indicating that the LsOFP6 gene knockout event co-segregates with the leaf angle phenotype, further verifying that LsOFP6 has the function of controlling the leaf angle of lettuce.

[0042] In summary, from the above experiments, we can see that overexpressing the LsOFP6 gene in large-leaf angle lettuce can change the phenotype of large-leaf angle lettuce to small-leaf angle, and knocking out the LsOFP6 gene in small-leaf angle lettuce to obtain a homozygous knockout strain can change the phenotype of small-leaf angle lettuce to large-leaf angle.

Claims

1. Lettuce LsOFP6 Application of gene in controlling leaf angle trait of lettuce, the lettuce LsOFP6 The protein encoded by the gene is shown in SEQ ID NO.

3.

2. The application according to claim 1, wherein the application process is: improving the LsOFP6 Application of gene expression in reducing the angle of lettuce leaves.

3. The application according to claim 2, wherein the application process is to increase the LsOFP6 The substance containing LsOFP6 Gene expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell.

4. The use according to claim 1, wherein the application process is: knocking out or inhibiting lettuce LsOFP6 Application of gene expression in increasing the angle of lettuce leaves.

5. The use according to claim 4, wherein the knockout is performed by homologous recombination or CRISPR-Cas9 method, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein.

6. The use according to claim 4, wherein the inhibition is by antisense RNA technology or interfering RNA technology.

7. The use according to claim 5, wherein the knockout is performed using the CRISPR-Cas9 method, and the gRNA sequence is: TGACTCCAATGTCGTGCAA.

8. Detection of the gene encoding the protein shown in SEQ ID NO.3 for use in screening or breeding of lettuce leaf angle traits.

9. Use of the gene encoding the protein shown in SEQ ID NO.3 in creating transgenic lettuce with large leaf angle or small leaf angle.

10. The use according to claim 1, 8 or 9, wherein the lettuce LsOFP6 The gene is shown as SEQ ID NO.1 or SEQ ID NO.2.

Images