Marek's low virulent strain and construction and application of rescue system of Marek's low virulent strain

Abstract

The invention discloses a Marek's low virulent strain, the whole genome sequence of the Marek's low virulent strain is characterized in that a nucleotide sequence as shown in SEQ ID NO.1 is deleted behind the 123439th basic group of a Marek's virus gene sequence DQ530348.1, and a long terminal repetitive sequence of avian reticuloendotheliosis virus as shown in SEQ ID NO.2 is inserted behind the 123439th basic group. The invention also discloses a construction method of the Marek's low virulent strain rescue system and application of the Marek's low virulent strain in preparation of vaccines for preventing or treating Marek's disease. The Marek's attenuated strain disclosed by the invention can quickly generate antibodies, has the detoxification capability obviously weaker than that of a vaccine virus CVI988 / Rispens strain, is a high-quality vaccine strain for developing Marek's disease vaccines, and has a very good application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of veterinary biological products, and in particular to a Marek's disease virus strain with weak toxin excretion and fast antibody production, and application thereof. Background Art

[0002] Marek's Disease (MD) is a viral tumor disease that seriously affects the poultry industry. It is caused by Marek's disease virus (MDV). Marek's disease has a high morbidity and mortality rate. According to different literature reports, its mortality rate can reach 10%-50%, causing huge economic losses to the poultry industry. Marek's disease can cause tumors in the internal organs and skin of infected chickens, and invade the central nervous system of infected chickens, causing paralysis or death in infected chickens. In addition, Marek's disease is an immunosuppressive disease. After infection, the immune system of chickens will be damaged, the immune response of chickens to multiple vaccines will be reduced, resulting in immune failure and increasing the risk of infection of other diseases.

[0003] Marek's disease virus (MDV) belongs to the family Herpesviridae, subfamily Alphaherpesvirinae, genus Marekvirus. MDV virus particles are in typical herpesvirus morphology. Virus particles exist in two forms: one is a complete virus particle with an envelope, with a diameter of about 273-400nm, which mainly exists in the epithelial cells of chicken feather follicles and has strong resistance; the other is a virus particle without an envelope, with a diameter of about 85-100nm, which is a strictly cell-bound virus with weak resistance. The main source of MDV infection is sick chickens and infected chickens. The presence of the virus in the epithelial cells of the feather follicles of infected chickens can be transmitted horizontally. Chicks are very susceptible to MDV infection, and there is a long incubation period from virus infection to onset. The clinical symptoms of MDV-infected chickens mainly include weight loss, intermittent limb paralysis, and mental depression. In recent years, the virulence of MDV has continued to increase, and some sick chickens have tumors at 3-4 weeks of age, and the tumors are already quite serious at 8-9 weeks of age.

[0004] In summary, the harm of Marek's disease to the poultry industry is multifaceted. It not only affects the growth and production performance of chickens, but may also cause immunosuppression, disease transmission, and even serious tumors, causing huge economic losses to farmers. Therefore, the prevention and control of Marek's disease is an important task for the poultry industry.

[0005] At present, the main means of preventing MD is the use of vaccines. The earliest Marek's disease vaccine was based on the herpesvirus of turkeys (HVT). This type of vaccine can provide a certain degree of protection, but the protective effect is relatively limited. With the advancement of vaccine research and development, researchers have developed many artificially attenuated type 1 MDV vaccines, such as the Dutch chicken Marek's disease live vaccine CVI988 / Rispens, which have played a key role in the prevention and control of Marek's disease. Due to the mutation and enhanced virulence of the chicken Marek's disease virus (MDV), the immune efficacy of the CVI988 / Rispens vaccine has decreased, resulting in the vaccine protection effect not meeting expectations. In addition, although the CVI988 / Rispens vaccine has been attenuated, it still has certain pathogenicity and excretion toxicity, and may induce disease under certain conditions. These defects have limited the clinical application of the CVI988 / Rispens vaccine, and there is a lack of better vaccine strain alternatives. Summary of the invention

[0006] The present invention aims to solve the technical problem of the lack of safe and efficient Marek's disease vaccine on the market, and provides a Marek's disease virus strain that can rapidly produce antibodies and has significantly weaker detoxification ability than the vaccine virus CVI988 / Rispens strain, and is a high-quality vaccine strain for the development of Marek's disease vaccine.

[0007] In order to solve the above technical problems, the present invention is achieved through the following technical solutions:

[0008] In one aspect of the present invention, an isolated attenuated strain of Marek's disease is provided, the whole genome sequence of which is a deletion of the nucleotide sequence shown in SEQ ID NO.1 after the 123439th base of the Marek's disease virus gene sequence DQ530348.1, and an insertion of the long terminal repeat sequence of the avian reticuloendotheliosis virus shown in SEQ ID NO.2 after the 123439th base.

[0009] The whole genome sequence of the Marek's virus strain also lacks a 792 bp nucleotide sequence at positions 129707-130498 of the DQ530348.1 gene sequence.

[0010] The whole genome sequence of the Marek's virus strain also lacks the 177 bp nucleotide sequence at positions 136606-136782 of the DQ530348.1 gene sequence, and lacks the 421 bp nucleotide sequence at positions 142067-142487 of the DQ530348.1 gene sequence.

[0011] The whole genome sequence of the Marek's virus strain also lacks the 842 bp nucleotide sequence of positions 142577-143418 of the DQ530348.1 gene sequence, and lacks the 842 bp nucleotide sequence of positions 177331-178172 of the DQ530348.1 gene sequence.

[0012] The whole genome sequence of the Marek's virus strain also lacks a 562 bp nucleotide sequence at positions 161868-162429 of the DQ530348.1 gene sequence, and lacks a 72 bp nucleotide sequence at positions 80479-80550 of the DQ530348.1 gene sequence.

[0013] The full genome sequence of the Marek's virus strain has an added nucleotide sequence shown in SEQ ID NO.3 at positions 158561-158862, which is not found in the DQ530348.1 gene sequence.

[0014] In another aspect of the present invention, a method for constructing a Marek's attenuated strain rescue system is provided, comprising the following steps:

[0015] The genome of the Marek's virus strain was extracted, and the large DNA fragments were recovered by enzyme digestion and purification, connected with the vector, and transformed into competent cells after phage packaging to obtain 6 cosmids covering the viral genome respectively;

[0016] The six cosmids were linearized and transfected into secondary CEF cells by calcium phosphate transfection method;

[0017] Add glycerol shock solution and incubate at room temperature, wash with PBS and then add DMEM complete culture medium containing 8-12% FBS;

[0018] The cell culture medium was replaced with DMEM culture medium containing 1-3% FBS, and the culture was continued. After 4-5 days of transfection, cytopathic effects were observed in 2-3 generations of blind passage, and the rescued Marek's weak strain was obtained.

[0019] In another aspect of the present invention, a Marek's attenuated strain rescued by the above construction method is also provided.

[0020] In another aspect of the present invention, a Marek's disease vaccine is provided, comprising the above-mentioned Marek's disease virus strain, or the above-mentioned rescued Marek's disease attenuated strain.

[0021] In another aspect of the present invention, there is also provided the use of the above-mentioned attenuated Marek's disease strain in the preparation of a vaccine for preventing or treating Marek's disease.

[0022] The Marek's disease virus strain of the present invention is non-pathogenic to chickens, can prompt chickens to produce antibodies against one of the main antigens of the Marek's disease virus (gB protein) more quickly, has a short detoxification time, and has a significantly weaker detoxification ability than the vaccine virus CVI988 / Rispens strain. It is suitable for developing a high-quality new vaccine for Marek's disease and has a good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0024] Figure 1 is a growth curve diagram of SH20 in Example 2 of the present invention on CEF cells;

[0025] Figure 2 is a diagram of a heart after dissection according to Embodiment 4 of the present invention;

[0026] Figure 3 is a diagram of a liver after dissection according to Embodiment 4 of the present invention;

[0027] Figure 4 is a diagram of a kidney after dissection according to Embodiment 4 of the present invention;

[0028] Figure 5 This is a graph showing the results of the third week feather medullary PCR test in Example 4 of the present invention;

[0029] Figure 6 This is a graph showing the results of the fifth week feather medullary PCR test in Example 4 of the present invention;

[0030] Figure 7 This is a graph showing the level of MDV gB antibodies in blood according to Example 4 of the present invention. DETAILED DESCRIPTION

[0031] The present invention isolates a Marek's disease virus strain (SH20) with a 240bp LTR inserted, which is non-pathogenic to chickens, can prompt chickens to produce antibodies against one of the main antigens of Marek's disease virus (gB protein) more quickly, and has a significantly weaker detoxification ability than the vaccine virus CVI988 strain.

[0032] The full genome sequence of the existing chicken Marek's disease live vaccine CVI988 strain is shown in DQ530348.1 on the NCBI website. The full genome sequence of the Marek's disease virus strain (SH20) isolated by the present invention, compared with the CVI988 strain, mainly lacks a 133 bp nucleotide sequence (SEQ ID NO.1) after 123439 of the existing Marek's disease virus strain DQ530348.1 full genome sequence, and adds a 240 bp REV LTR sequence (SEQ ID NO.2) after 123439, and the REV LTR sequence is the long terminal repeat sequence (LTR) of avian reticuloendotheliosis virus (REV).

[0033] In order to better apply the Marek's virus strain (SH20), the present invention further constructed a Marek's attenuated strain rescue system (Example 5) to obtain the rescued virus strain rSH20. The vaccine prepared by rSH20 can immunize chickens against the attack of Md5, and the protection rate of the challenge virus reaches 100%.

[0034] Example 1 Isolation of Marek's disease virus type 1 SH20 strain from chickens

[0035] Tumor tissues of sick chickens were collected from chickens suspected of being infected with Marek's virus. After grinding the tissue samples, an appropriate amount of physiological saline was added to make a suspension, and impurities were removed by centrifugation. The treated samples were inoculated into chicken embryo fibroblasts (CEF). An appropriate amount of antibiotics was added to the cell culture medium to prevent bacterial contamination. During the cell culture process, the cytopathic effect (CPE) was observed regularly. After blind propagation for 2 generations, the cell culture medium was collected when typical CPE appeared, and virus detection was performed. The virus was plaque purified 3 times on CEF cells, and the purified virus obtained was stored in liquid nitrogen and named SH20 virus strain. Tests for common exogenous viruses, mycoplasmas and bacteria were all negative, indicating that the SH20 virus strain was a pure virus.

[0036] Example 2 Growth curve of SH20 virus strain on CEF cells

[0037] When the CEF cells in the T25 cell bottle were cultured to about 80% confluence, the medium was discarded, the cells were washed once with PBS, and 200 PFU of SH20 virus strain and CVI988 / Rispens vaccine virus strain were added respectively. At 24h, 48h, 72h, 96h, 120h and 144h, samples from three replicate wells were taken respectively, and the virus content was determined as follows: the sample to be tested was diluted 10 times to 10 -3 Up to 10 -6, add to the cell culture wells of the 12-well plate and mix gently. At the same time, set up cells that are not infected with the virus as control wells. Repeat 3 wells for each dilution, continue to incubate in the incubator, observe for 5-6 days, and calculate the number of plaques. Calculate the virus content based on the number of plaques and draw a growth curve. The results showed that the SH20 virus strain and the CVI988 / Rispens vaccine virus strain have similar replication abilities on CEF cells (see Figure 1 ).

[0038] Example 3 SH20 virus strain genome sequencing and analysis

[0039] CEF infected with SH20 were lysed with LCM solution (130mM KCl, 30mM Tris [pH 7.4], 5mM MgCl2, 0.5mM EDTA, 0.5% Nonidet P-40 [NP-40], 0.043% 2-mercaptoethanol). The supernatant was mixed with Freon (1,1,2-trichloro-1,2,2-trifluoroethane) at a ratio of 1:1 and centrifuged at 12000rpm for 5min. The supernatant was taken and the virus precipitate was obtained by gradient ultracentrifugation with 5% glycerol and 45% glycerol. The virus was suspended with LCM and the genome was extracted with a genome extraction kit. The extracted genome was sent to Shanghai Paisono Biotechnology Co., Ltd. for sequencing. The sequencing results were analyzed using SnapGene software version 7.1.2 (https: / / www.snapgene.com / ). Compared with the CVI988 strain, the SH20 virus has two main characteristics: (1) a 133 bp nucleotide sequence is missing after 123439 (SEQ ID NO.1); (2) a 240 bp REV LTR sequence (SEQ ID NO.2) is present after 123439. The REV LTR sequence is the long terminal repeat sequence (LTR) of the avian reticuloendotheliosis virus (REV).

[0040] In addition, the whole genome sequence of the SH20 virus strain, compared with the CVI988 strain (DQ530348.1 gene sequence), has changes in the nucleotide sequences at the positions listed in Table 1 below:

[0041] Table 1 Differential analysis of SH20 and CVI988 viral genomes

[0042]

[0043]

[0044] In Table 1, * indicates the position of the CVI988 genome, # indicates the position of the SH20 genome, and & indicates that the sequences are identical.

[0045] Example 4 Compared with the CVI988 vaccine virus strain, the SH20 virus strain can induce SPF chickens to produce antibodies faster and excrete less toxins

[0046] In order to further clarify the pathogenicity of SH20 to SPF chickens, 3000 PFU of CVI988 / Rispens vaccine strain and SH20 virus strain were inoculated into 1-day-old SPF chickens by intraperitoneal inoculation. After the challenge, the morbidity and mortality of the experimental chickens were observed continuously until the 9th week, during which the following indicators were observed: 1) clinical symptoms and mortality; 2) feather medullary samples were collected at different time points for PCR detection; 3) blood was collected at the 3rd and 5th weeks after infection, and the MDV gB antibody level in the chickens was detected by ELISA. On the 82nd day after infection, all experimental chickens were killed, and the pathological conditions of various tissues and organs were observed and recorded.

[0047] The results showed that after infection with SH20 and CVI988 / Rispens, SPF chickens did not show any clinical symptoms or die. After autopsy, no nodular or tumor-like lesions were found in the skin and internal organs of the chickens, including the heart, liver and kidneys. Figure 2-Figure 4 ).

[0048] In order to clarify the excretion of SH20 virus, PCR was used to detect the virus content in the feather medullary of chickens infected with SH20 and CVI988 / Rispens at the third and fifth weeks after infection. The primer sequences of PCR were: MDV-meq-F, TTCCCTGACGGCCTATCTGA (SEQ ID NO.4); MDV-meq-R, TTCGGGATCCTCGGTAAGAC (SEQ ID NO.5). The results showed that the virus could be detected in the feather medullary of chickens infected with SH20 and CVI988 / Rispens at the third week after infection ( Figure 5 ); however, in the fifth week, only 60% (3 / 5) of the chickens infected with SH20 had virus detected in their feather medullary, and the virus bands in the feather medullary of 2 of the chickens were extremely weak; while 80% (4 / 5) of the chickens infected with CVI988 / Rispens had virus detected in their feather medullary, indicating that the virus shedding time of chickens infected with SH20 was significantly shorter than that of the vaccine virus CVI988 / Rispens ( Figure 6 ).

[0049] Compared with CVI988 / Rispens, SH20 infection stimulated SPF chickens to produce antibodies more quickly: 80% (4 / 5) of the chickens infected with SH20 were antibody positive in the third week, while only 40% (2 / 5) of the chickens infected with CVI988 / Rispens were antibody positive; in the fifth week, the antibody levels of chickens infected with SH20 and CVI988 / Rispens were similar ( Figure 7 ).

[0050] Example 5 Rescue of virus strain rSH20

[0051] The viral genome was extracted from CEF cells infected with SH20, digested with β-Agarase I, purified and recovered large fragment DNA, connected with pCC1Fos vector, packaged with bacteriophage MaxPlax, transformed into EPI300-T1R competent cells and plated. Finally, 6 cosmids covering the viral genome were obtained, named pSH20-1, pSH20-2, pSH20-3, pSH20-4, pSH20-5 and pSH20-6. These cosmids were linearized and transfected into the secondary CEF by calcium phosphate transfection. After 4 hours of transfection, the cell supernatant was discarded and washed once with PBS; 2 ml of glycerol shock solution was added and incubated at room temperature for 2 minutes; washed 3 times with PBS, and cultured in DMEM complete culture medium with 10% FBS. After 12 hours, the cell culture medium was replaced with 2% FBS DMEM culture medium for continued culture. After 4-5 days of transfection, cytopathic effects were observed in blind passage 2, and the rescued virus strain rSH20 was obtained.

[0052] Example 6 The vaccine prepared by rSH20 can produce good immune protection in chickens

[0053] One-day-old SPF chickens (n=10) were immunized with live Marek's disease vaccine (CVI988 / Rispens strain, Qingdao Yibang Bioengineering Co., Ltd.) and vaccine prepared by rSH20 by intramuscular injection, and a negative control group was set up. On the 7th day after immunization, all chickens were intraperitoneally injected with virulent md5 at a dose of 1000 PFU / chicken. The incidence and mortality of the experimental chickens were observed continuously until 10 weeks after the challenge, and then all the experimental chickens were killed to observe and record the pathological conditions of various tissues and organs. The results showed that the clinical morbidity of chickens in the PBS immunization group was 100% (10 / 10) and the mortality rate reached 80% (8 / 10), while the chickens immunized with live Marek's disease vaccine (CVI988 / Rispens strain) and vaccine prepared by rSH20 had no clinical morbidity and mortality. In addition, all the chickens in the PBS immunization group were infected with Md5, while the chickens immunized with the Marek's disease live vaccine (CVI988 / Rispens strain) and the vaccine prepared with rSH20 could resist the attack of Md5, and the protection rate against infection reached 100% (Table 2).

[0054] Table 2 Immune effect of rSH20 on 1-day-old SPF chickens

[0055]

[0056] The above-mentioned embodiments only express the implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A weak Marek's virus strain, the whole genome sequence of which is a deletion of the nucleotide sequence shown in SEQ ID NO.1 after the 123439th base of the Marek's virus gene sequence DQ530348.1, and an insertion of the long terminal repeat sequence of the avian reticuloendotheliosis virus shown in SEQ ID NO.2 after the 123439th base.

2. The attenuated Marek's strain according to claim 1, characterized in that: The whole genome sequence of the Marek's attenuated strain also lacks the 792 bp nucleotide sequence at positions 129707-130498 of the DQ530348.1 gene sequence.

3. The attenuated Marek's strain according to claim 1, characterized in that: The whole genome sequence of the Marek's attenuated strain also lacks the 177 bp nucleotide sequence at positions 136606-136782 of the DQ530348.1 gene sequence, and lacks the 421 bp nucleotide sequence at positions 142067-142487 of the DQ530348.1 gene sequence.

4. The attenuated Marek's strain according to claim 1, characterized in that: The whole genome sequence of the Marek's attenuated strain also lacks the 842 bp nucleotide sequence at positions 142577-143418 of the DQ530348.1 gene sequence, and lacks the 842 bp nucleotide sequence at positions 177331-178172 of the DQ530348.1 gene sequence.

5. The attenuated Marek's strain according to claim 1, characterized in that: The whole genome sequence of the Marek's attenuated strain also lacks the 562bp nucleotide sequence at positions 161868-162429 of the DQ530348.1 gene sequence, and lacks the 72bp nucleotide sequence at positions 80479-80550 of the DQ530348.1 gene sequence.

6. The attenuated Marek's strain according to claim 1, characterized in that: The full genome sequence of the Marek's attenuated strain is the nucleotide sequence shown in SEQ ID NO.3 added at positions 158561-158862.

7. A method for constructing a Marek's attenuated strain rescue system, characterized in that: The following steps are involved: Extracting the genome of the Marek's attenuated strain according to any one of claims 1 to 6, digesting and purifying the large DNA fragments, connecting them to the vector, and transforming them into competent cells after phage packaging to obtain 6 cosmids covering the viral genome respectively; The six cosmids were linearized and transfected into secondary CEF cells by calcium phosphate transfection method; Add glycerol shock solution and incubate at room temperature, wash with PBS and then add DMEM complete culture medium containing 8-12% FBS; The cell culture medium was replaced with DMEM culture medium containing 1-3% FBS, and the culture was continued. After 4-5 days of transfection, cytopathic effects were observed in 2-3 generations of blind passage, and the rescued Marek's weak strain was obtained.

8. A Marek's attenuated strain rescued by the construction method of claim 7.

9. A Marek's disease vaccine, characterized in that: The attenuated Marek's virus strain comprises the attenuated Marek's virus strain according to any one of claims 1 to 6, or the attenuated Marek's virus strain obtained by rescue according to claim 8.

10. Use of the attenuated Marek's disease strain according to any one of claims 1 to 6 in the preparation of a vaccine for preventing or treating Marek's disease.

Images