Mammalian cell expression vector, expression plasmid and expression system

Abstract

The invention discloses a mammalian cell expression vector, an expression plasmid and an expression system. The expression vector sequentially comprises the following elements: (a) a promoter; (b) a Kozak sequence; (c) a polyadenine sequence, the polyadenine sequence sequentially comprises a bGH PolyA sequence and a 5 'UTR PolyA sequence, the nucleotide sequence of the bGH PolyA sequence is as shown in SEQ ID NO.5, and the nucleotide sequence of the 5' UTR PolyA sequence is as shown in SEQ ID NO.6; (d) copying the start site; and (e) screening marker genes. According to the present invention, the expression vector is optimized by the expression element, such that the exogenous gene can be conveniently, efficiently and flexibly inserted and edited by the expression vector so as to achieve the stable extracellular or intracellular expression of the exogenous protein, and the expression efficiency of the exogenous protein can be improved by carrying out the expression plasmid construction based on the expression vector; and more efficient expression and purification of the foreign protein are realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene engineering, and specifically relates to a mammalian cell expression vector, an expression plasmid containing the expression vector, and a corresponding expression system. Background Art

[0002] Protein is an important raw material for life science research. Through the recombinant protein expression system, the target protein can be correctly and efficiently expressed, and extracted and purified to obtain a sufficient amount of the target protein, and functional research and structural analysis of the target protein can be carried out. This is of great significance for studying biological macromolecules and promoting the development of life sciences.

[0003] At present, the main recombinant protein expression systems include E. coli expression system, yeast expression system, insect cell expression system and mammalian cell expression system. Among them, the mammalian expression system has very complete glycosylation modification function and folding mechanism, which can simulate the natural modification of proteins, and can correctly express very complex foreign proteins through post-translational processing, modification and secretion of recombinant proteins.

[0004] However, mammalian cell expression systems have problems such as low expression levels, complex gene expression regulation, and relatively difficult downstream purification. In addition, the current expression vectors are not flexible in inserting foreign genes, and additional amino acids will exist in the sequence after enzyme cleavage, which affects the protein expression level after transfection. For mammalian cell expression systems, they mainly include expression vectors and host cells. Therefore, it is very necessary to construct expression vectors that enable mammalian cells to efficiently secrete and express foreign proteins. Summary of the invention

[0005] In view of this, the primary purpose of the present invention is to provide a mammalian cell expression vector. The present invention optimizes the expression vector, especially the expression element, so that the expression vector can conveniently, efficiently and flexibly insert and edit exogenous genes, so that the exogenous protein can be stably expressed extracellularly or intracellularly, thereby improving the expression efficiency of the exogenous protein.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] One aspect of the present invention discloses a mammalian cell expression vector, wherein the expression vector has the following elements in sequence:

[0008] (a) Promoter;

[0009] (b) Kozak sequence;

[0010] (c) a polyadenine sequence, wherein the polyadenine sequence comprises a bGH PolyA sequence and a 5'UTR PolyA sequence in sequence, wherein the nucleotide sequence of the bGH PolyA sequence is shown in SEQ ID NO.5, and the nucleotide sequence of the 5'UTR PolyA sequence is shown in SEQ ID NO.6;

[0011] (d) replication origin site;

[0012] (e) Screening marker genes.

[0013] The optimized expression vector can facilitate the insertion and editing of the target protein, and such insertion or editing is based on seamless cloning, which is convenient for restriction endonuclease linearization of the vector. After cloning, no additional amino acids will exist in the sequence, thereby improving the expression or purification efficiency of the exogenous protein.

[0014] Another aspect of the present invention provides a mammalian cell expression plasmid, which contains the expression vector described above, and a human antibody constant sequence is inserted between the Kozak sequence and the polyadenine sequence of the expression vector.

[0015] Another aspect of the present invention provides another mammalian cell expression plasmid, which contains the expression vector described above, and a protein purification tag and an enzyme cleavage site are sequentially inserted between the Kozak sequence and the polyadenine sequence of the expression vector.

[0016] Another aspect of the present invention provides another mammalian cell expression plasmid, which contains the expression vector described above, and a protein purification tag and a marker gene are sequentially inserted between the Kozak sequence and the polyadenine sequence of the expression vector.

[0017] Another aspect of the present invention provides a mammalian cell expression system, which contains the expression plasmid described above and a host cell.

[0018] Beneficial effects of the present invention:

[0019] The present invention optimizes and designs a new expression vector, and designs a corresponding expression plasmid based on the expression vector. The expression vector can conveniently, flexibly and seamlessly clone, insert and edit a target gene, avoiding the problems of inflexible insertion of target genes in existing expression vectors and the presence of additional amino acids (such as enzyme cleavage site amino acids) in the sequence after cloning. The expression vector can improve the expression efficiency of exogenous proteins and achieve more efficient expression or purification of exogenous proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a map of the expression vector pIHM-vector provided in Example 1 of the present invention.

[0021] Figure 2 This is a map of the expression plasmid pIHM-HC constructed in Example 2 of the present invention.

[0022] Figure 3 This is a map of the expression plasmid pIHM-KC constructed in Example 2 of the present invention.

[0023] Figure 4 This is a map of the expression plasmid pIHM-LC constructed in Example 2 of the present invention.

[0024] Figure 5 This is a map of the expression plasmid pIHM-Fc-HRV3C constructed in Example 2 of the present invention.

[0025] Figure 6 This is a map of the expression plasmid pIHM-6×his-mEOS constructed in Example 2 of the present invention.

[0026] Figure 7 The recombinant plasmid pIHM-RVC20-HC ( Figure 7 a) and pIHM-RVC20-KC( Figure 7 b) spectrum.

[0027] Figure 8 This is the gel electrophoresis detection result of the recombinant plasmid constructed in Application Example 1 of the present invention secreting and expressing the antibody protein RVC20.

[0028] Fig. 9 This is a map of the recombinant plasmid pIHM-Fc-HRV3C-mEOS constructed in Application Example 2 of the present invention.

[0029] Fig.10 This is the gel electrophoresis detection result of the recombinant plasmid constructed in Application Example 2 of the present invention secreting and expressing the target protein mEOS.

[0030] Fig.11 This is a map of the recombinant plasmid pIHM-6×his-RV-N-mEOS constructed in Application Example 3 of the present invention.

[0031] Fig.12 This is the gel electrophoresis detection result of the recombinant plasmid constructed in Application Example 3 of the present invention secreting and expressing the target protein RV-N. DETAILED DESCRIPTION

[0032] Embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0034] The first aspect of the present invention provides a mammalian cell expression vector. In view of the problem that the current mammalian cell expression vector is not flexible in inserting foreign genes, and after insertion, additional amino acids (such as restriction sites of inserted proteins, etc.) are easily present in the sequence, thereby affecting the protein expression amount after transfection. The present invention optimizes and designs a new expression vector, which can flexibly insert and edit foreign proteins, thereby improving the expression amount or purification efficiency of foreign proteins.

[0035] The expression vector of the present invention is obtained by optimizing and combining multiple important elements. In the present invention, the expression vector has the following elements, and these elements are preferably combined in the following order:

[0036] (a) Promoter;

[0037] (b) Kozak sequence;

[0038] (c) a polyadenine sequence, wherein the polyadenine sequence comprises a bGH PolyA sequence and a 5'UTR PolyA sequence in sequence, wherein the nucleotide sequence of the bGH PolyA sequence is shown in SEQ ID NO.5, and the nucleotide sequence of the 5'UTR PolyA sequence is shown in SEQ ID NO.6;

[0039] (d) replication origin site;

[0040] (e) Screening marker genes.

[0041] In the present invention, the promoter is a key element in gene regulation, and its main function is to serve as the starting point of transcription. In the present invention, the promoter used is not particularly limited, and any promoter known in the art that can control gene expression in eukaryotic cells can be used. Preferably, the promoter used in the present invention is CMV promoter, and its nucleotide sequence is shown in SEQ ID NO.3.

[0042] In some implementation cases of the present invention, the expression vector further includes an enhancer, which is located upstream of the promoter. As a key cis-transcription element in gene regulation, the enhancer is a small region on DNA that can bind to proteins. After binding to proteins, the transcription of genes will be enhanced. In the present invention, the enhancer is not particularly limited, and it is preferred to use an enhancer that is compatible with the promoter. Preferably, the enhancer used in the present invention is a CMV enhancer, and its nucleotide sequence is shown in SEQ ID NO.2.

[0043] In the present invention, the Kozak sequence is a specific sequence located on both sides of the start codon AUG in eukaryotic mRNA. In the present invention, the Kozak sequence is introduced into the expression vector to enhance transcription. In the present invention, the nucleotide sequence of the Kozak sequence is shown in SEQ ID NO.4.

[0044] In the present invention, the polyadenine sequence is particularly optimized so that when it participates in regulating gene expression, it affects the translation efficiency and degradation rate of mRNA, helps protein binding, and helps to increase the yield of the target protein. The polyadenine sequence described in the present invention includes a bGH PolyA sequence and a 5'UTR PolyA sequence in sequence, the nucleotide sequence of the bGH PolyA sequence is shown in SEQ ID NO.5, and the nucleotide sequence of the 5'UTR PolyA sequence is shown in SEQ ID NO.6.

[0045] In the present invention, the replication origin site is used as the starting point of plasmid replication, and any initiation replication sequence known in the art can be used. Preferably, the high-copy pUC replication ori site used in the present invention has a nucleotide sequence shown in SEQ ID NO.7.

[0046] In the present invention, the screening marker gene is a gene of known function or known sequence, which can play the role of specific marker when inserted into the expression vector. In this article, the screening marker gene mainly refers to antibiotic resistance gene, and specific examples include ampicillin, kanamycin, chloramphenicol, spectinomycin, tetracycline, bleomycin, streptomycin, hygromycin, gentamicin, apramycin sulfate, erythromycin, and nourseothricin, but it is not limited to this. Preferably, the screening marker gene used in the present invention is an ampicillin resistance gene, and its nucleotide sequence is shown in SEQ ID NO.8.

[0047] It is understood that the expression vector also contains a multiple cloning site for the target gene, where the multiple cloning site refers to a plurality of restriction endonuclease sites for cloning the target gene, and any of various common multiple cloning sites in the art can be used to facilitate the insertion of the coding sequence of the foreign protein. In addition, it is understood that the inserted coding sequence of the target gene or foreign protein can be in front of or behind the multiple cloning site, or in the middle of the multiple cloning site, which can be selected according to actual needs, and those skilled in the art have such ability.

[0048] The corresponding expression vector can be obtained by sequentially connecting the above-mentioned elements using molecular biological techniques well known in the art. It can be understood that the connection of the above-mentioned elements can be a continuous connection without gaps or a gap connection, which can be designed according to needs. In a preferred embodiment of the present invention, the full-length nucleotide sequence of the expression vector is shown in SEQ ID NO.1.

[0049] The second aspect of the present invention provides a mammalian cell expression plasmid, which is constructed based on the expression vector described above, in which a human antibody constant sequence is preferably inserted between a Kozak sequence and a polyadenine sequence to obtain the expression plasmid.

[0050] Wherein, in the present invention, the human antibody constant sequence may be a heavy chain constant region sequence of a human antibody, or may be a light chain constant region sequence of a human antibody. In some specific implementation cases of the present invention, the human antibody constant sequence is a human antibody heavy chain constant sequence having a nucleotide sequence as shown in SEQ ID NO.9, a human antibody Kappa chain constant sequence having a nucleotide sequence as shown in SEQ ID NO.10, or a human antibody Lambda chain constant sequence having a nucleotide sequence as shown in SEQ ID NO.11.

[0051] The third aspect of the present invention provides another mammalian cell expression plasmid, which is based on the expression vector described above, and a protein purification tag and an enzyme cleavage site are sequentially inserted between the Kozak sequence and the polyadenine sequence of the expression vector.

[0052] In the present invention, the protein purification tag refers to a tag sequence that can be fused with the target gene or exogenous protein to facilitate the expression, detection, tracing and purification of the target gene or exogenous protein. Common tags in the art include HA tags, Flag tags, His tags, etc., but are not limited to these. In some specific implementation cases of the present invention, the protein tag used is a single-chain protein A affinity purification protein tag Fc tag, and its nucleotide sequence is shown in SEQ ID NO.12. The restriction site is the HRV 3C restriction site (nucleotide sequence SEQ ID NO.13).

[0053] The fourth aspect of the present invention provides another mammalian cell expression plasmid, which is based on the expression vector described above, and a protein purification tag and a marker gene are sequentially inserted between the Kozak sequence and the polyadenine sequence of the expression vector.

[0054] In this embodiment, the protein purification tag is a polyhistidine peptide purification tag (His-tag), and in some specific embodiments of the present invention, its nucleotide sequence is shown in SEQ ID NO.14. The marker gene is a fluorescent marker protein, which can covalently bind or physically adsorb fluorescent substances to a certain group of the target gene or exogenous protein to be studied, and use the fluorescent characteristics to perform qualitative, localized and quantitative analysis on the labeled object. It is understandable that these fluorescent marker proteins can be more conventional green fluorescent protein GFP, yellow fluorescent protein YFP, red fluorescent protein RFP, mCherry, etc. in the art, and those skilled in the art can also optimize them based on actual needs. The purpose of optimization includes but is not limited to improving the localization effect of the marker gene. In some specific embodiments of the present invention, the marker gene is a fluorescent marker protein with a nucleotide sequence shown in SEQ ID NO.15. The fluorescent marker protein in the present invention is optimized to improve the positioning stability.

[0055] It is understandable that based on the expression plasmid in the present invention, the full-length nucleotide sequence of the corresponding expression plasmid can be obtained by using exogenous proteins well known to those skilled in the art, as well as genetic engineering techniques well known to those skilled in the art, such as PCR amplification, artificial synthesis or recombination. This is achievable by those skilled in the art, so it will not be elaborated here.

[0056] The fifth aspect of the present invention discloses a mammalian cell expression system, comprising the expression plasmid described above and a host cell.

[0057] The target gene is inserted into the expression plasmid described above, and then the expression plasmid carrying the target gene is transfected into the host cell, so that the corresponding foreign protein is secreted and expressed, and the expressed foreign protein is obtained by separation and purification.

[0058] The host cell described in the present invention is a mammalian cell, and specific examples thereof include CHO, HELA, BSR, HEK 293T / 17, VERO, etc., but are not limited thereto.

[0059] The specific transfection adopts physical mediation (such as electroporation, microinjection and gene gun, etc.), chemical mediation (such as calcium phosphate coprecipitation, cationic polymer method, liposome transfection method, etc.), biological mediation (such as virus-mediated method, etc.) well known to those skilled in the art, and can be selected accordingly according to actual needs. Further, the transfected cells can be cultured using conventional methods in the art to achieve the purpose of expressing the inserted foreign protein in the present invention. Generally, according to the different host cells used, a conventional culture medium adapted to the host cells is selected, and culture is carried out under growth conditions suitable for the host cells. After the cells grow to a suitable density, a conventional method in the art (such as chemical induction, etc.) is used, and then cultured for a period of time to obtain foreign proteins that can be expressed in the cells or secreted outside the cells. Subsequently, these proteins can be separated and purified using separation methods well known to those skilled in the art, specifically including but not limited to protein precipitants, centrifugation, osmotic bacteria breaking, molecular sieve chromatography, adsorption chromatography, ion exchange chromatography, high performance liquid chromatography and other various liquid chromatography techniques at least one or a combination of several.

[0060] In addition, it should be noted that in the present invention, the "exogenous protein", "target gene", "target protein", "encoding sequence of exogenous protein" and the like have the same meaning and can be used interchangeably. The exogenous protein can be, but is not limited to, surface immune-related HIV neutralizing antibody protein, such as viral envelope glycoprotein (Env) and the like.

[0061] The present invention is described below by means of specific examples. It should be noted that the following specific examples are only for illustrative purposes and do not limit the scope of the present invention in any way. In addition, unless otherwise specified, methods without specific conditions or steps are conventional methods, and the reagents and materials used can be obtained from commercial channels.

[0062] Example 1 Construction of mammalian cell expression vector pIHM-vector

[0063] According to the elements in the table below, the elements were sequentially connected and assembled using molecular biological techniques well known in the art to obtain an expression vector pIHM-vector with a full-length nucleotide sequence as shown in SEQ ID NO.1, and its map is shown in Figure 1 As shown in .

[0064] order Component Name Serial Number (1) CMV enhancer SEQ ID NO.2 (2) CMV promoter SEQ ID NO.3 (3) Kozak sequence SEQ ID NO.4 (4) bGH PolyA SEQ ID NO.5 (5) 5'UTR PolyA SEQ ID NO.6 (6) pUC replication ori site SEQ ID NO.7 (7) Ampicillin resistance gene (AmpR) SEQ ID NO.8

[0065] Example 2 Construction of expression plasmid

[0066] 1. pIHM-HC expression plasmid

[0067] The human antibody heavy chain constant sequence shown in SEQ ID NO.9 was inserted into the expression vector pIHM-vector constructed in Example 1, specifically, between the Kozak sequence and the polyadenine sequence, to obtain a human antibody expression plasmid pIHM-HC with a total length of 5597 bp, as shown in the following figure: Figure 2 shown.

[0068] 2. pIHM-KC expression plasmid

[0069] The human antibody Kappa chain constant sequence shown in SEQ ID NO.10 was inserted into the expression vector pIHM-vector constructed in Example 1, specifically, between the Kozak sequence and the polyadenine sequence to obtain a human antibody expression plasmid pIHM-KC with a total length of 4940 bp, as shown in the following figure: Figure 3 shown.

[0070] 3. pIHM-LC expression plasmid

[0071] The human antibody lambda chain constant sequence shown in SEQ ID NO.11 was inserted into the expression vector pIHM-vector constructed in Example 1, specifically, between the Kozak sequence and the polyadenylation sequence to obtain a human antibody expression plasmid pIHM-LC with a total length of 4951 bp, as shown in the following figure: Figure 4 shown.

[0072] 4. pIHM-Fc-HRV3C expression plasmid

[0073] The nucleotide sequence Fc tag sequence shown in SEQ ID NO.12 and the HRV3C restriction site sequence shown in SEQ ID NO.13 were sequentially inserted into the expression vector pIHM-vector constructed in Example 1. Specifically, the Fc tag sequence and the HRV3C restriction site sequence were sequentially inserted between the Kozak sequence and the polyadenine sequence to obtain a human antibody purification tag expression plasmid pIHM-Fc-HRV3C with a full length of 6047 bp. The map is shown in FIG. Figure 5 shown.

[0074] 5. pIHM-6×his-mEOS expression plasmid

[0075] The nucleotide sequence 6×his tag sequence shown in SEQ ID NO.14 and the fluorescent protein sequence shown in SEQ ID NO.15 were sequentially inserted into the expression vector pIHM-vector constructed in Example 1. Specifically, the 6×his tag sequence and the fluorescent protein sequence were sequentially inserted between the Kozak sequence and the polyadenine sequence to obtain a covalent fluorescent expression plasmid pIHM-6×his-mEOS with a total length of 5276 bp, and its map is shown in FIG. Figure 6 shown.

[0076] Application Example 1

[0077] In this application example, humanized monoclonal antibody Anti-RABV G / Glycoprotein Antibody (RVC20) is taken as an example, the expression plasmid in Example 2 is used to construct a recombinant plasmid, and its expression effect is verified.

[0078] 1. Construction of pIHM-RVC20-HC

[0079] (1) The heavy chain gene template of RVC20 antibody was used to amplify the sequence. The amplified gene sequence was operated according to the instructions of the 2×TransStartFastPfu PCR SuperMix polymerase (all gold) kit.

[0080] (2) Use DNA agarose gel electrophoresis to detect the size of the amplified gene fragment, recover the gene according to the instructions of the gel recovery kit (all gold), and dissolve it in sterile water. The primer design information is as follows:

[0081] Upstream primer RVC20VH-HD-pIHM-Age-F (5'→3'):

[0082] CCTGTTCCTGGTGGCCACGGCCACCGGTGTGCATTCTCAGGTTCAGCTGCAGGAGAGCGG (SEQ ID NO. 16);

[0083] Downstream primer RVC20VH-HD-pIHM-Apa-R (5'→3'):

[0084] TAGGGGCCAGGGGGAACACTGAGGGCCCTTTGGTAGAAGCGGAAGACACTGTCACCAGGGTT (SEQ ID NO. 17).

[0085] (3) The pIHM-HC expression plasmid in Example 2 was double-digested with AgeI and ApaI (Takara) respectively, and the conditions were as per the instructions provided by the manufacturer.

[0086] (4) The fragments after enzyme digestion were purified by DNA gel purification and connected by Gibson Assembly reaction using ClonExpress II One Step Cloning Kit (Novagen).

[0087] (5) The ligation product was transformed into Escherichia coli DH5α. The specific method was based on the CaCl2 heat shock transformation method in the third edition of Molecular Cloning.

[0088] (6) The colonies were cultured at 37°C on LB plates (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar powder 20 g / L, LB medium without agar in the following text) containing 100 μg / mL ampicillin. After 16 to 24 hours, positive colonies were screened by colony PCR. The specific screening method is as follows:

[0089] Prepare a 200 μL PCR tube, add 5-10 μL sterile water, pick up the colony with a sterile pipette tip, break it up in sterile water, add an equal volume of 2× buffer and an appropriate amount of Rapid Taq polymerase provided by the 2× Rapid Taq Master Mix kit (NoviZan), and perform colony PCR in a PCR instrument (the primers are RVC20VH-HD-pIHM-Age-F and RVC20VH-HD-pIHM-Apa-R, respectively, with nucleotide sequences as shown in SEQ ID NOs. 16 and 17). The experimental conditions were set according to the instructions provided by the PCR enzyme kit.

[0090] (7) Detect the amplified gene fragments by DNA agarose gel electrophoresis, culture the colonies corresponding to the correct amplification results, and send them to a sequencing company for sequencing to ensure that the sequence of the plasmid is correct. The extracted plasmid is stored at -80°C.

[0091] The constructed pIHM-RVC20-HC plasmid (full length 5990 bp) is shown in the figure Figure 7 As shown in a.

[0092] 2. Construction of pIHM-RVC20-KC

[0093] (1) Amplify the sequence using the light chain gene template of the RVC20 antibody. The amplified gene sequence was operated according to the instructions of the 2×TransStartFastPfu PCR SuperMix polymerase (all gold) kit.

[0094] (2) Use DNA agarose gel electrophoresis to detect the size of the amplified gene fragment, recover the gene according to the instructions of the gel recovery kit (all gold), and dissolve it in sterile water. The primer design information is as follows:

[0095] Upstream primer RVC20VL-HD-pIHM-Age-F (5'→3'):

[0096] TCCTGTTCCTGGTGGCTACCGCCACCGGTGTGCACAGCGACATCCAGATGACCCAGAGCCCCTCC A (SEQ ID NO. 18);

[0097] Downstream primer RVC20VL-HD-pIHM-BsiW-R (5'→3'):

[0098] TGAAAACGCTAGGAGCGGCCACCGTACGCTTGATCTCCACCTTGGTGCCG (SEQ ID NO. 19).

[0099] The steps for constructing pIHM-RVC20-KC are the same as those for constructing pIHM-RVC20-HC, except that the restriction sites and primers are different. Specifically, pIHM-RVC20-KC was constructed by double restriction digesting the pIHM-KC expression plasmid in Example 2 with AgeI and BsiWI (Takara Company), and the PCR primers were RVC20VL-HD-pIHM-Age-F and RVC20VL-HD-pIHM-BsiW-R, whose nucleotide sequences are shown in SEQ ID NOs. 18 and 19, respectively.

[0100] The constructed pIHM-RVC20-KC plasmid (full length 5270 bp) is shown in the figure Figure 7 As shown in b.

[0101] 3. Set up experimental group and control group to conduct the experiment of secretory expression of antibody protein RVC20. The specific groups are as follows:

[0102] The experimental groups were: pIHM-RVC20-HC and pIHM-RVC20-KC recombinant plasmids;

[0103] The control group was pCDNA3.1-RVC20, whose heavy chain and light chain genes were commissioned to be synthesized by Jiutian Gene and cloned into pcDNA3.1-hIgG1 and pcDNA3.1-hKappa vectors.

[0104] The specific operation of the secretory expression of antibody protein RVC20 is as follows. The operation of the control group is the same as that of the experimental group:

[0105] The above successfully constructed plasmids were respectively transferred into 200 ml 293 Freestyle cells (R79007, Thermo Fisher Scientific). The specific steps are as follows:

[0106] 100 μg of each of the two plasmids were added to 4 mL of OptiPRO SFM Serum Free Medium (12309019, Thermo Fisher Scientific) and mixed. Then, 200 μL of transfection reagent LiFect293 Transfection Reagent (LIFESCT, Cat#: M0002-10) (1 μg of plasmid corresponds to 1 μL of transfection reagent) was slowly added to the OptiPRO SFM medium containing the plasmids. After vortexing 2 to 3 times with a vortexer, the mixture was centrifuged for 5 to 10 seconds and allowed to stand at room temperature for 4 to 5 minutes. The cell bottle was placed flat on the biosafety cabinet, and the incubated plasmid transfection mixture was pipetted with a pipette and slowly dripped onto the diluted cells (0.9 to 1 × 10 6 / mL), then draw 4-5mL of liquid from the cell bottle to rinse the 15mL centrifuge tube, and add it to the transfected cell bottle again; put it in a cell culture incubator at 37°C, 8% CO2 and culture for 6-7 days. The cell culture fluid is centrifuged at 10000g for 15-30 minutes, and the supernatant sample is filtered through a 0.22μm filter membrane.

[0107] The supernatant obtained by filtration is combined with the Protein A chromatography column. Then, non-specific binding proteins are eluted with PBS buffer for 5 to 10 times the volume of the chromatography column. The protein is eluted with pH 3.0, 0.2 mol / L glycine-HCl buffer, and the pH value of the effluent is immediately adjusted to 7.0 with 1.0 mol / L pH 9.0 Tris-HCl buffer. 1× loading buffer is added, and the sample is boiled for 5 minutes to denature the sample. The protein bands are separated by SDS-PAGE and identified with Coomassie Brilliant Blue staining FastBlue protein fast staining solution (White Shark Product No.: BL607A).

[0108] Results Figure 8 .

[0109] Figure 8 In the figure, M represents the protein molecular weight marker; 1a and 1b represent the electrophoresis results of the control group under DTT reducing conditions and non-reducing conditions, respectively; 2a and 2b represent the electrophoresis results of the experimental group under DTT reducing conditions and non-reducing conditions, respectively.

[0110] After nanodrop concentration measurement, the total mass of the RVC20 antibody purified by pCDNA3.1 in the control group was 0.064 mg, and the total mass of the RVC20 antibody expressed by the pIHM vector in the experimental group was 0.546 mg, indicating that the expression plasmid constructed with pIHM as the vector in the present invention can significantly improve the expression of the target protein.

[0111] Application Implementation 2

[0112] 1. In this application example, the recombinant plasmid pIHM-Fc-HRV3C-mEOS was recombined with the pIHM-Fc-HRV3C expression plasmid. The specific steps are as follows:

[0113] (1) The pIHM-Fc-HRV3C expression plasmid was double-digested with BamHI and BglII (Takara) according to the manufacturer's instructions.

[0114] (2) The fragments of the gene-synthesized mEOS sequence (synthesized by General Biotech) (nucleotide sequence shown as SEQ ID NO. 20) were ligated by express cloning Gibson Assembly reaction using ClonExpress II One Step Cloning Kit (Novizan).

[0115] (3) The ligation product was transformed into Escherichia coli DH5α. The specific method was based on the CaCl2 heat shock transformation method in the third edition of Molecular Cloning.

[0116] (4) The colonies were cultured at 37°C on LB plates (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar powder 20 g / L, LB medium without agar in the following text) containing 100 μg / mL ampicillin. After 16 to 24 hours, positive colonies were screened by colony PCR. The specific screening method is as follows:

[0117] Prepare a 200 μl PCR tube, add 5-10 μl sterile water, pick up the colony with a sterile pipette tip, break it into sterile water, add an equal volume of 2× buffer and an appropriate amount of Rapid Taq polymerase provided by the 2× Rapid Taq Master Mix kit (NoviZan), and perform colony PCR in a PCR instrument. The experimental conditions are set according to the instructions provided by the PCR enzyme kit. The PCR primers are:

[0118] Upstream primer 8400-pIHM-F (5'→3'):

[0119] TTCCTTTCCATGGGTCTTTTCTG (SEQ ID NO. 21);

[0120] Downstream primer 8400-pIHM-R (5'→3'):

[0121] GAGTGGCACCTTCCAGGGTCAA (SEQ ID NO. 22).

[0122] (5) Use DNA agarose gel electrophoresis to detect the amplified gene fragments, culture the colonies corresponding to the correct amplification results, and send them to a sequencing company for sequencing to ensure that the sequence of the plasmid is correct. The extracted plasmid is stored at -80°C.

[0123] The constructed pIHM-Fc-HRV3C-mEOS plasmid (full length 6731 bp) is shown in the figure Fig. 9 As shown in .

[0124] 2. Transfer the successfully constructed plasmid into 200 ml 293 Freestyle cells (R79007, Thermo Fisher Scientific). The specific steps are as follows:

[0125] 150 μg of pIHM-Fc-HRV3C-mEOS plasmid was added to 4 mL OptiPRO SFM Serum Free Medium (12309019, Thermo Fisher Scientific) and mixed. Then 150 μL of transfection reagent LiFect293 Transfection Reagent (LIFESCT, Cat#: M0002-10) (1 μg of plasmid corresponds to 1 μL of transfection reagent) was slowly added to the OptiPRO SFM medium containing the plasmid. After vortexing 2 to 3 times with a vortexer, the mixture was centrifuged for 5 to 10 seconds and allowed to stand at room temperature for 4 to 5 minutes. The cell bottle was placed flat on the biosafety cabinet, and the incubated plasmid transfection mixture was aspirated with a pipette and slowly added to the diluted cells (0.9 to 1 × 10 6 / mL), then draw 4-5mL of liquid from the cell bottle to rinse the 15mL centrifuge tube, and add it to the transfected cell bottle again; put it in a cell culture incubator at 37°C, 8% CO2 and culture for 6-7 days. The cell culture fluid is centrifuged at 10000g for 15-30 minutes, and the supernatant sample is filtered through a 0.22μm filter membrane.

[0126] The supernatant obtained by filtration is combined with the Protein A chromatography column. Then, non-specific binding proteins are eluted with PBS buffer for 5 to 10 times the volume of the chromatography column. The protein is eluted with pH 3.0, 0.2 mol / L glycine-HCl buffer, and the pH value of the effluent is immediately adjusted to 7.0 with 1.0 mol / L pH 9.0 Tris-HCl buffer. 1× loading buffer is added, and the sample is boiled for 5 minutes to denature the sample. The protein bands are separated by SDS-PAGE and identified with Coomassie Brilliant Blue staining FastBlue protein fast staining solution.

[0127] The results are as follows Fig.10 As shown in .

[0128] Fig.10In the figure, M represents the protein molecular weight marker, and 1 represents the detection result of pIHM-Fc-HRV3C-mEOS under non-DTT reducing conditions. After nanodrop concentration determination, the protein yield was 3.1 mg.

[0129] Application Example 3

[0130] 1. In this application example, the recombinant plasmid pIHM-6×his-RV-N-mEOS was constructed by recombining the pIHM-6×his-mEOS expression plasmid. The specific steps are as follows:

[0131] (1) The pIHM-6×his-mEOS expression plasmid was double-digested with BamHI and XbaI (Takara) according to the manufacturer's instructions.

[0132] (2) The fragments of the gene-synthesized RV-N sequence (synthesized by General Biotech) (nucleotide sequence shown in SEQ ID NO. 23) were connected by express cloning Gibson Assembly reaction using ClonExpress II One Step Cloning Kit (Novizan).

[0133] (3) The ligation product was transformed into Escherichia coli DH5α. The specific method was based on the CaCl2 heat shock transformation method in the third edition of Molecular Cloning.

[0134] (4) The colonies were cultured at 37°C on LB plates (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar powder 20 g / L, LB medium below does not contain agar) containing 100 μg / mL ampicillin. After 16 to 24 hours, positive colonies were screened by colony PCR. The specific screening method is as follows:

[0135] Prepare a 200 μl PCR tube, add 5 to 10 μl of sterile water, pick up the colony with a sterile pipette tip, break it up in sterile water, add an equal volume of 2× buffer and an appropriate amount of Rapid Taq polymerase provided by the 2× Rapid Taq Master Mix kit (NoviZan), and perform colony PCR in a PCR instrument (the primers are 8400-pIHM-F and 8400-pIHM-R with nucleotide sequences as shown in SEQ ID NO. 21 and 22, respectively). The experimental conditions are set according to the instructions provided by the PCR enzyme kit.

[0136] (5) Use DNA agarose gel electrophoresis to detect the amplified gene fragments, culture the colonies corresponding to the correct amplification results, and send them to a sequencing company for sequencing to ensure that the sequence of the plasmid is correct. The extracted plasmid is stored at -80°C.

[0137] The constructed pIHM-6×his-RV-N-mEOS plasmid (full length 6626 bp) is shown in the figure Fig.11 As shown in .

[0138] 2. Transfer the successfully constructed plasmid into 200 ml 293 Freestyle cells (R79007, Thermo Fisher Scientific). The specific steps are as follows:

[0139] 150 μg of pIHM-6×his-RV-N-mEOS plasmid was added to 4 mL OptiPRO SFM Serum Free Medium (12309019, Thermo Fisher Scientific) and mixed. Then 150 μL of transfection reagent LiFect293 Transfection Reagent (LIFESCT, Cat#: M0002-10) (1 μg of plasmid corresponds to 1 μL of transfection reagent) was slowly added to the OptiPRO SFM medium containing the plasmid. After vortexing 2 to 3 times with a vortexer, the mixture was centrifuged for 5 to 10 seconds and allowed to stand at room temperature for 4 to 5 minutes. The cell bottle was placed flat on the biosafety cabinet, and the incubated plasmid transfection mixture was aspirated with a pipette and slowly added to the diluted cells (0.9 to 1×10 6 / mL), then draw 4-5mL of liquid from the cell bottle to rinse the 15mL centrifuge tube, and add it to the transfected cell bottle again; put it in a cell culture incubator at 37°C, 8% CO2 and culture for 6-7 days. The cell culture fluid is centrifuged at 10000g for 15-30 minutes, and the supernatant sample is filtered through a 0.22μm filter membrane.

[0140] The supernatant obtained by filtration was combined with HisSep Ni-NTA Agarose Resin chromatography column (Yisheng Bio, catalog number: 20502ES50). Then, 5-10 times the volume of the chromatography column was washed with PBS buffer containing 50mM imidazole to elute the non-specific binding protein. The protein was eluted with PBS buffer containing 500mM imidazole. 1× loading buffer was added, and the sample was boiled for 5 minutes to denature the sample. The protein bands were separated by SDS-PAGE and identified with Coomassie Brilliant Blue staining FastBlue protein fast staining solution.

[0141] Results Fig.12 .

[0142] Fig.12 In the figure, M represents the protein molecular weight marker, 1A and 1B are the detection results of pIHM-6×his-RV-N-mEOS under DTT reducing conditions and non-reducing conditions, respectively. After nanodrop concentration determination, the protein yield was 2.8 mg.

[0143] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0144] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A mammalian cell expression vector, characterized in that: The expression vector has the following elements in sequence: (a) Promoter; (b) Kozak sequence; (c) a polyadenine sequence, wherein the polyadenine sequence includes a bGH PolyA sequence and a 5'UTR PolyA sequence in sequence, wherein the nucleotide sequence of the bGH PolyA sequence is shown in SEQ ID NO.5, and the nucleotide sequence of the 5'UTR PolyA sequence is shown in SEQ ID NO.6; (d) replication origin site; (e) Screening marker genes.

2. The expression vector according to claim 1, characterized in that The promoter is a CMV promoter, and its nucleotide sequence is shown in SEQ ID NO.3; Preferably, the expression vector further comprises an enhancer, and the enhancer is located upstream of the promoter; Preferably, the enhancer is a CMV enhancer, and its nucleotide sequence is shown in SEQ ID NO.

2.

3. The expression vector according to claim 1, characterized in that The replication initiation site is the pUC replication ori site, and its nucleotide sequence is shown in SEQ ID NO.

7.

4. The expression vector according to claim 1, characterized in that The selection marker gene is an ampicillin resistance gene, and its nucleotide sequence is shown in SEQ ID NO.

8.

5. The expression vector according to claim 1, wherein The full-length nucleotide sequence of the expression vector is shown in SEQ ID NO.

1.

6. A mammalian cell expression plasmid, characterized in that: The invention comprises the expression vector according to any one of claims 1 to 5, and a human antibody constant sequence is inserted between the Kozak sequence and the polyadenine sequence of the expression vector.

7. The mammalian cell expression plasmid according to claim 6, characterized in that: The human antibody constant sequence is a human antibody heavy chain constant sequence as shown in SEQ ID NO.9, a human antibody Kappa chain constant sequence as shown in SEQ ID NO.10, or a human antibody Lambda chain constant sequence as shown in SEQ ID NO.

11.

8. A mammalian cell expression plasmid, characterized in that: It contains the expression vector according to any one of claims 1 to 5, and a protein purification tag and an enzyme cleavage site are sequentially inserted between the Kozak sequence and the polyadenine sequence of the expression vector; Preferably, the protein purification tag is a protein A affinity purification protein tag Fc tag with a nucleotide sequence as shown in SEQ ID NO.12, and the restriction site is the HRV 3C restriction site.

9. A mammalian cell expression plasmid, characterized in that: It contains the expression vector according to any one of claims 1 to 5, and a protein purification tag and a marker gene are sequentially inserted between the Kozak sequence and the polyadenine sequence of the expression vector; Preferably, the protein purification tag is a polyhistidine peptide purification tag, and the marker gene is a fluorescent marker protein; Preferably, the nucleotide sequence of the fluorescent marker protein is as shown in SEQ ID NO.

15.

10. A mammalian cell expression system, characterized in that: Containing the expression plasmid according to any one of claims 6 to 9, and further containing a host cell; Preferably, the host cell is a mammalian cell; Preferably, the expression system is achieved by transfecting an expression plasmid carrying a target gene into a host cell, thereby secreting and expressing the corresponding foreign protein, and separating and purifying the expressed foreign protein.

Images