Non-methanol induced expression H5 subtype avian influenza virus subunit antigen and preparation and application of vaccine thereof

Abstract

The invention belongs to the field of biology, and discloses preparation and application of a non-methanol-induced expression H5 subtype avian influenza virus subunit antigen and a vaccine thereof, PDAK is applied to pichia pastoris expression of avian influenza virus H5 subtype HA protein, an HA protein multiple-insertion recombinant strain with a PDAK promoter is successfully constructed, and in the research process, it is found that the H5 subtype avian influenza virus subunit antigen and the vaccine thereof have the advantages that the H5 subtype avian influenza virus subunit antigen and the vaccine thereof can be used for preparing the H5 subtype avian influenza virus subunit antigen; by adopting the recombinant plasmid disclosed by the invention, multiple insertions can be generated in a pichia pastoris strain, the target protein expression quantity can be obviously improved, and the foreign protein expression efficiency of the recombinant plasmid is superior to that of a PAOX1 promoter and a PGAP promoter; according to the invention, the HA protein of the PDAK promoter is multiply inserted into the recombinant strain to express the HA protein to prepare the subunit vaccine, after the vaccine is immunized, a higher hemagglutination inhibition antibody level can be generated aiming at homologous strains, and the survival rate of experimental chickens after challenge is 100%.

Description

Technical Field

[0001] The present application relates to the biological field, and in particular to a method for non-methanol-induced expression of H5 subtype avian influenza virus subunit antigens and the preparation and application of a vaccine thereof. Background Art

[0002] Avian influenza viruses belong to the Orthomyxoviridae family and have 18 hemagglutinin (HA) subtypes and 11 neuraminidase (NA) subtypes, classified into three types: A, B, and C. Highly pathogenic avian influenza viruses (HPAIs) are classified as type A, a serious zoonotic pathogen that threatens the poultry industry. They are divided into multiple subtypes based on antigenic variation, such as H5, H7, and H9. The H5 and H7 subtypes, in particular, not only cause severe disease in poultry but also possess strong cross-species transmission capabilities, enabling transmission from birds to mammals, including humans. For example, the H5N1 subtype has been found to infect humans and cause severe disease, and the H5N1 virus can be transmitted between humans and poultry. Although the probability of human-to-human transmission is low, the virus's variability creates the potential for mutation and reassortment, potentially leading to human-to-human spread and the risk of a large-scale epidemic. AIVs cause significant losses to the poultry industry and pose an increasing threat to human health, making immunization against avian influenza particularly important.

[0003] Vaccination has always been the most economical and effective method for preventing avian influenza virus. Subunit vaccines contain only the protein portion of the virus, not the live virus, and are safe and do not cause disease transmission. They can effectively stimulate the body to produce antibodies and memory immune responses, and are mainly used for poultry immunization. The Pichia pastoris expression system is one of the most commonly used systems for recombinant protein production. The promoter of the alcohol oxidase gene, P AOX1 It is one of the most commonly used promoters in Pichia pastoris expression system, but P AOX1 The promoter is a methanol-inducible promoter. This toxic and flammable substance requires special handling and is not suitable for the production of edible and medical products. In addition, the byproduct of methanol metabolism, hydrogen peroxide (H2O2), will cause oxidative stress and may lead to degradation of recombinant proteins. GAP As a constitutive promoter, the promoter can use non-methanol carbon sources to express the target protein, avoiding the harm of methanol, but its expression level may not be as high as that of methanol-inducible promoters such as AOX1. Summary of the Invention

[0004] The purpose of this application is to provide a recombinant plasmid, through which P DAKThe promoter is applied to the expression of HA protein of H5 subtype of avian influenza virus in Pichia pastoris. During the research process, we found that the recombinant plasmid of the present invention can produce multiple insertions in eukaryotic cells, which can significantly increase the expression of the target protein. Its exogenous protein expression efficiency is better than that of P. AOX1 Promoter, P GAP promoter;

[0005] The present invention will P DAK The HA protein of the promoter was multiple inserted into the recombinant strain to express the HA protein to prepare a subunit vaccine. After immunization with the vaccine, a higher level of hemagglutination inhibition antibodies could be produced against the homologous strain, and the survival rate of the experimental chickens after the infection was 100%.

[0006] At the same time, the present invention also discloses the preparation and application of the non-methanol-induced expression of H5 subtype avian influenza virus subunit antigen and the vaccine thereof.

[0007] To achieve the above objectives, the present application invents a recombinant plasmid, characterized in that the recombinant plasmid contains a dihydroxyacetone kinase promoter gene fragment, a dihydroxyacetone kinase terminator gene fragment and a target gene.

[0008] In the above-mentioned recombinant plasmid, the target gene is the HA gene.

[0009] In the above-mentioned recombinant plasmid, the gene sequence of the recombinant plasmid is shown as SEQ ID NO: 1.

[0010] At the same time, the present invention also discloses a method for preparing a non-methanol-inducible recombinant Pichia pastoris strain, which comprises linearizing the recombinant plasmid described above and recovering the linearized fragment;

[0011] The linearized fragment was transformed into a Pichia pastoris strain for expression, and a recombinant Pichia pastoris strain capable of expressing HA protein was screened.

[0012] In addition, the present invention also discloses a non-methanol-induced expression of an H5 subtype avian influenza virus subunit antigen, wherein the non-methanol-induced expression of the H5 subtype avian influenza virus subunit antigen is induced to secrete an HA protein by a recombinant Pichia pastoris strain using dihydroxyacetone; the recombinant Pichia pastoris strain is a recombinant Pichia pastoris strain prepared by the method according to claim 4.

[0013] At the same time, the present invention also discloses the use of the above-mentioned non-methanol-induced expression of H5 subtype avian influenza virus subunit antigens in preparing vaccines for preventing and treating avian influenza.

[0014] Finally, a vaccine is disclosed, which contains the protein solution for non-methanol-induced expression of H5 subtype avian influenza virus subunit antigens as described above and an adjuvant. The vaccine can be used to prevent avian influenza virus.

[0015] The beneficial effects of this application are:

[0016] (1) The recombinant Pichia pastoris obtained by constructing the recombinant plasmid of the present invention can be induced to secrete proteins by dihydroxyacetone, thus avoiding the harm caused by methanol induction.

[0017] (2) The protein secreted by the recombinant Pichia pastoris can produce a high level of hemagglutination-inhibiting antibodies against the homologous strain after being prepared into a vaccine;

[0018] (3) Multiple insertions were generated in the recombinant Pichia pastoris, which can significantly increase the expression level of the target protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Recombinant plasmid P DAK -Map of H5HA1;

[0020] Figure 2 is the electrophoresis diagram of PCR of positive transformants;

[0021] Figure 3 This is a screenshot of the sequencing results of positive transformants;

[0022] Figure 4 The expression strain of Pichia sp GS115 (P DAK -H5HA1) expressing DAK-HA protein in Pichia pastoris strain GS115 / pPICZαA-P DAK - SDS-PAGE detection of HA1 protein expressed by H5HA1. The numbers in the figure are: M: protein molecular weight standard 1: GS115 / pPICZαA-H5HA1-24 h protein; 2: GS115 / pPICZαA-H5HA1-48 h protein; 3: GS115 / pPICZαA-H5HA1-72 h protein;

[0023] Figure 5 This is an SDS-PAGE detection diagram of HA1 protein expressed by Pichia pastoris strain GS115 / pPICZαA-H5HA1; the symbols in the figure are: M: protein molecular weight standard 1: GS115 / pPICZαA-P DAK -H5HA1-24 h protein; 2:GS115 / pPICZαA-P DAK -H5HA1-48 h protein; 3:GS115 / pPICZαA-P DAK -H5HA1-72 h protein;

[0024] Figure 6Figure 1 is an SDS-PAGE analysis of HA1 protein expressed in Pichia pastoris strain GS115 / pGAPZαA-H5HA1. The numbers in the figure are: M: protein molecular weight standard; 1: GS115 / pGAPZαA-H5HA1-24h protein; 2: GS115 / pGAPZαA-H5HA1-48h protein; 3: GS115 / pGAPZαA-H5HA1-72h protein.

[0025] Figure 7 Pichia pastoris strain GS115 / pPICZαA-P DAK - Western-Blot detection of HA1 protein expressed by H5HA1; the numbers in the figure are: M: protein molecular weight standard 1: GS115 / pPICZαA-H5HA1-24 h protein; 2: GS115 / pPICZαA-H5HA1-48 h protein; 3: GS115 / pPICZαA-H5HA1-72 h protein;

[0026] Figure 8 This is a Western-Blot analysis of the HA1 protein expressed by the Pichia pastoris strain GS115 / pPICZαA-H5HA1. The numbers in the figure are: M: protein molecular weight standard 1: GS115 / pPICZαA-P DAK -H5HA1-24 h protein; 2:GS115 / pPICZαA-P DAK -H5HA1-48 h protein; 3:GS115 / pPICZαA-P DAK -H5HA1-72 h protein;

[0027] Figure 9 This is a Western-Blot analysis of the HA1 protein expressed in the Pichia pastoris strain GS115 / pGAPZαA-H5HA1. The numbers in the figure are: M: protein molecular weight standard; 1: GS115 / pGAPZαA-H5HA1-24h protein; 2: GS115 / pGAPZαA-H5HA1-48h protein; 3: GS115 / pGAPZαA-H5HA1-72h protein;

[0028] Figure 10 This is a graph showing changes in serum antibody titers detected by HI at different times in Example 2;

[0029] Figure 11 This is a trend chart of the change in serum antibody titer detected by HI at different times in Example 2;

[0030] Figure 12 This is a graph showing the survival rates of each group after challenge in Example 3;

[0031] Figure 13 The viral titers of each organ tissue in each group after challenge in Example 3;

[0032] Figure 14 This is a diagram showing the status of various organs 3 days after the challenge in Example 3;

[0033] Figure 15 This is a lung tissue section image 4 days after infection, where the brown arrow indicates bone metaplasia, the blue arrow indicates interstitial vascular congestion, the red arrow indicates lymphocyte infiltration, the orange arrow indicates epithelial cell loss, the green arrow indicates bleeding, the yellow arrow indicates atrial dilatation, and the black box indicates the location of the magnified field of view. DETAILED DESCRIPTION

[0034] In the description of this application, it should be noted that if specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.

[0035] Example 1P DAK -Construction of H5HA1 plasmid

[0036] (1) Search the NCBI website and download the amino acid sequence of A / Avian / Netherlands / H5N1 / 2008 (H5) H5HA1 (accession number MW310457.1);

[0037] (2) Human-preferred nucleic acid codons were selected to optimize the nucleic acid sequence encoding H5HA1. Restriction enzyme sites EcoRI and XbaI were added to the 5' and 3' ends of the H5HA1 nucleic acid sequence, respectively. The nucleic acid sequence was synthesized by Shanghai Sangon Biotechnology Co., Ltd. and stored in the pUC19 vector.

[0038] The optimized nucleic acid sequence of H5HA1 is shown in SEQ ID NO.1;

[0039] (3) The gene sequence was downloaded from the NCBI database, and the promoter of the PAS_chr3_DAK gene (Gene ID: 8200330) was amplified using primers P1 / P2, and the terminator was amplified using primers P3 / P4:

[0040] Primer P1: TTGGTCATGAGATCAGATCTCTGATGCTGTGAGGGAGAAA; (SEQ ID NO. 2)

[0041] Primer P2: GGAAATCTCATCGTTTCGAATTAAAGTGTATAAATTCCTT; (SEQ ID NO.3)

[0042] Primer P3: CAAGGTATCTGTTGATGCTAAGCTGTATGCTGACCTTCTG; (SEQ ID NO. 4)

[0043] Primer P4: TGCTCACACTACAACTTGGTTTCAGATTTGAAGTATGCAT; (SEQ ID NO.5)

[0044] The amplification conditions used for PCR cloning were: 95°C for 3 min; 95°C for 15 s, 56°C for 30 s, and 72°C for 90 s, 35 cycles; and 72°C for 3 min.

[0045] The PAS_chr3_DAK gene sequence (Gene ID: 8200330) is shown in SEQ ID NO. 6:

[0046] Promoter sequence (SEQ ID NO: 7):

[0047] Terminator sequence (SEQ ID NO: 8):

[0048] (4) The ori fragment was amplified using primers P5 / P6 from the pPICZαA plasmid vector, and the vector fragment was reversely amplified using primers P7 / P8;

[0049] Primer P5:accaagttgtagtgtgagcaaaaggccagcaaaa; (SEQ ID NO: 9)

[0050] Primer P6: AGATCTgatctcatgaccaa; (SEQ ID NO: 10)

[0051] The amplification conditions used for PCR cloning were: 95°C for 3 min; 95°C for 15 s, 56°C for 30 s, and 72°C for 90 s, 35 cycles; and 72°C for 3 min.

[0052] Primer P7: TTCGAAacgatgagatttcc; (SEQ ID NO: 11)

[0053] Primer P8: catcaacagataccttgttggtctccagcttgcaaa; (SEQ ID NO: 12)

[0054] The amplification conditions used for PCR cloning were: 95°C for 3 min; 35 cycles of 95°C for 15 s, 56°C for 90 s, and 72°C for 90 s; and 72°C for 3 min.

[0055] The nucleotide sequence of the ori fragment is shown in SEQ ID NO: 13;

[0056] The nucleotide sequence of the vector fragment is shown in SEQ ID NO: 14:

[0057] (5) Using primers P3 / P2, the terminator fragment, ori fragment, and promoter fragment of the PAS_chr3_DAK gene were fused by overlap extension PCR to obtain a fusion fragment;

[0058] Primer P3: CAAGGTATCTGTTGATGCTAAGCTGTATGCTGACCTTCTG;

[0059] Primer P2: GGAAATCTCATCGTTTCGAATTAAAGTGTATAAATTCCTT.

[0060] The nucleotide sequence of the fusion fragment is shown in SEQ ID NO: 15:

[0061] (6) The product after the fusion fragment recovery and the product after the linearized vector recovery were connected to form a complete circular plasmid using a seamless cloning kit. According to the seamless cloning system shown in Table 1, the linearized vector fragment and the fusion fragment were added to the PCR tube at a molar ratio of 1:3 (the operation process was carried out on ice). After being thoroughly pipetted and mixed, the mixture was reacted in a metal bath at 50°C for 60 minutes. After the reaction was completed, the PCR tube was placed on ice for 2 minutes to cool and wait for heat shock transformation.

[0062] Table 1 Seamless cloning system

[0063]

[0064]

[0065] (7) Heat shock transformation and PCR screening and identification: Add 4 μL of seamless cloning product to DH5α competent cells, flick several times, and incubate on ice for 30 min; then heat shock in a 42°C water bath for 90 s, and then quickly return to ice for incubation for 5 min; add 1 mL of LB liquid culture medium and gently blow to mix, incubate in a constant temperature shaker at 37°C and 200 rpm for 60 min, centrifuge at 4000 rpm / min for 3 minutes to collect the bacteria, discard 900 μL of the liquid, keep 100 μL of the supernatant and blow to mix, evenly spread on an LB plate containing bleomycin hydrochloride antibiotics, and incubate in an incubator at 37°C overnight. After that, extract a small amount of plasmid for sequencing and identification.

[0066] (8) According to the enzyme digestion system shown in Table 2, the synthetic HA gene fragment and the constructed P were cut with restriction endonucleases EcoRI and XbaI. DAKThe target fragment was then recovered and connected at 37°C for 1 hour according to the connection system shown in Table 3. The connection product was transformed into DH5α competent cells, and a small amount of plasmid was extracted for sequencing identification. The sequencing results were: recombinant plasmid P DAK The nucleotide sequence of -H5HA1 is shown in SEQ ID NO: 16, and the plasmid map is shown in Figure 1 shown.

[0067] Table 2 EcoRI and XbaI enzyme digestion system

[0068]

[0069] Table 3 Plasmid ligation system

[0070]

[0071]

[0072] (9) Transformation of recombinant plasmid into Pichia pastoris strain to construct recombinant strain

[0073] The recombinant plasmid P DAK -H5HA1 was linearized using the restriction endonuclease BglII and digested at 37°C for 2 hours. The completion of the digestion was verified by electrophoresis. The linearized fragment was recovered using a gel recovery kit and transformed into the eukaryotic expression strain GS115 using a Pichia pastoris chemical transformation kit. The recovered linearized fragment was then spread onto a solid YPD plate with Zeocin and cultured overnight at 30°C for 48-72 hours.

[0074] Table 4 BglII enzyme digestion system

[0075]

[0076] (10) Identification of positive transformants

[0077] The single colony on the plate was identified by PCR with primers 5-αfactor-F / 3-AOX1-R for the target gene HA. The identification results were as follows: Figure 2 As shown, the fragment size of 1515 bp is consistent with the theoretical value. The PCR reaction products of the positive transformants were sent to Guangzhou Aiji Biotechnology Co., Ltd. for gene sequencing;

[0078] 5-αfactor-F:TCCTTCAATTTTTACTGCTG;

[0079] 3-AOX1-R:GCAAATGGCATTCTGACATCC;

[0080] To further analyze the genomic characteristics of the strain, the PCR reaction solution of the positive transformant was sent to Beijing Novogene Technology Co., Ltd., and the second-generation and third-generation library sequencing technologies were used. It was found that the multiple insertions in the strain were mainly manifested as repeated insertions of the exogenous target gene. The results are as follows Figure 3 shown.

[0081] pass Figure 3 It can be seen that multiple insertions exist in the positive transformants, and this result is closely related to the improvement of protein production capacity described later.

[0082] (11) Compare P DAK 、P AOX1 With P GAP Ability of three promoters to express HA protein

[0083] Comparison of P by shake flask fermentation DAK 、P AOX1 With P GAP The ability of the three promoters to express HA protein. The recombinant Pichia pastoris strain GS115 / pPICZαA-H5HA1 used P AOX1 Promoter, methanol-inducible secretory expression, expression conditions are as follows: select a fresh, white, smooth yeast colony on YPD solid medium, inoculate it into 10 ml of BMGY liquid medium, and culture overnight to an OD600 of 1.5. Collect the cells by centrifugation, and then suspend the resulting cells in BMMY liquid medium to control the initial OD600 to 0.6. Continue to culture in a shaker at 30°C and 250 rpm. Supplement the BMMY medium with 0.5% methanol as a carbon source every 24 hours. Collect the culture medium at 24, 48, and 72 hours, centrifuge at 8000 rpm for 15 minutes, and collect the supernatant.

[0084] BMGY liquid medium solution was prepared as follows: 10 g / L yeast extract, 20 g / L tryptone, 13.4 g / L YNB, 10 g / L glycerol, 100 mmol / L potassium phosphate buffer (pH 6.0), and sterilized at 121°C for 20 min.

[0085] BMMY liquid culture medium solution was prepared as follows: 10 g / L yeast extract, 20 g / L tryptone, 13.4 g / L YNB, 100 mmol / L phosphate buffer (pH 6.0), sterilized at 121°C for 20 min, cooled to about 50°C, and added with 0.5% (v / v) methanol.

[0086] The recombinant Pichia pastoris strain GS115 / pGAPZαA-H5HA1 was constructed using P GAPThe promoter, constitutively secretes expression, and its culture strategy is as follows: recombinant yeast is inoculated into 10 ml of BMDY liquid medium, cultured at 30°C, 250 rpm for 16-20 hours to an OD600 of 1.5, and then centrifuged to collect the cells. GS115 / pGAPZαA-H5HA 1 is then suspended in BMGY medium, with the initial OD600 controlled at ≈0.6. The culture is continued with shaking, and 0.5% glycerol is added to the BMGY medium every 24 hours. The culture fluid is collected at 24, 48, and 72 hours, centrifuged at 8000 rpm for 15 minutes, and the supernatant is collected.

[0087] BMDY liquid culture medium solution was prepared as follows: 10 g / L yeast extract, 20 g / L tryptone, 13.4 g / L YNB, 100 mmol / L potassium phosphate buffer (pH 6.0). Sterilize at 121°C for 20 min, cool to approximately 50°C, and add 1% (v / v) glucose.

[0088] Recombinant Pichia pastoris strain GS115 / P DAK -H5HA1 uses P DAK Promoter, non-methanol-induced secretory expression, the culture strategy is: inoculate the recombinant yeast into 10 ml BMDY liquid medium and culture overnight to OD600 = 1.5, collect the bacteria by centrifugation, suspend the obtained part of the bacteria in BMDHAY liquid medium, control OD600≈0.6, continue to culture with shaking, collect the culture fluid at 24 / 48 / 72 hours, centrifuge at 8000 rpm for 15 min, and collect the supernatant.

[0089] BMD HA Y liquid culture medium solution was prepared as follows: 10 g / L yeast extract, 20 g / L tryptone, 13.4 g / L YNB, 100 mmol / L phosphate buffer (pH 6.0), sterilized at 121°C for 20 min, cooled to about 50°C, and 0.5% (v / v) DHA (dihydroxyacetone) was added.

[0090] Pichia sp GS115 (P DAK The protein expressed by DAK-HA was named DAK-HA, and the protein concentration of DAK-HA was determined by BCA protein concentration assay kit at 24, 48, and 72 hours. Figure 4 、 Figure 7 As shown, the concentration of DAK-HA protein was the highest at 48h, which was 1.25 mg / ml;

[0091] The protein expressed by the Pichia sp GS115 (pPICZαA-H5HA1) was named AOX1-HA. The protein concentration of AOX1-HA was determined at 24, 48, and 72 h using a BCA protein concentration assay kit. The test results are as follows: Figure 5 、 Figure 8 As shown, the protein concentration of hAOX1-HA was the highest at 72 h, which was 0.96 mg / ml;

[0092] The protein expressed by the Pichia sp GS115 (pGAPZαA-H5HA1) was named GAP-HA. The protein concentration of GAP-HA at 24, 48, and 72 h was determined using a BCA protein concentration assay kit. The test results are as follows: Figure 6 、 Figure 9 As shown, the GAP-HA protein concentration was the highest at 48h, which was 0.56mg / ml.

[0093] Example 2 Animal Immunization Experiment

[0094] 1. Vaccine preparation

[0095] Take the activated Pichia sp GS115 (P DAK HA protein was expressed from a single yeast colony expressing H5α-H5HA1. The plasmid was extracted from the DH5αpUC19-CpG strain maintained in our laboratory. Each bird in the HA group was injected with 50 μg of protein, while the HA-CpG group received 50 μg of protein and 10 μg of CpG adjuvant per bird. The prepared HA, HA-CpG, and sterile PBS solutions were mixed with SEPPIC MONTANIDE™ ISA 71VG adjuvant at a volume ratio of 3:7. The protein solution was then mixed with the oil-emulsion adjuvant using a vaccine emulsifier to prepare a water-in-oil vaccine.

[0096] 2. Avian influenza vaccine immunization program and immune serum collection

[0097] The experiment was divided into four groups: PBS group, HA group, HA-CpG group, and commercial vaccine control group.

[0098] Fourteen-day-old SPF chickens were randomly divided into four groups, with 20 chickens in each group, and immunized by multiple subcutaneous injections in the neck. The immunization conditions were as follows: each chicken in the PBS group was injected with 0.13 ml of emulsified PBS solution; each chicken in the HA group was injected with 0.33 ml of the corresponding vaccine; each chicken in the HA-CpG group was injected with 0.39 ml of the corresponding vaccine; and each chicken in the commercial vaccine control group was injected with 0.2 ml of the corresponding vaccine.

[0099] Blood was collected every 7 days after immunization for a total of 5 weeks using disposable blood collection tubes without additives. The tubes were placed in a 37°C incubator for 2 hours, and the upper serum was aspirated. The tubes were then placed in a centrifuge and centrifuged at 5000 rpm for 10 minutes to remove excess cellular components. The HI antibody titer in the immunized chicken serum was then detected using a hemagglutination inhibition test.

[0100] Blood was collected from the jugular vein every 7 days after immunization and serum was separated for avian influenza virus specific HI antibody detection for 5 weeks. The hemagglutination inhibition antibody level of each group against rD8 strain of avian influenza H5N2 was detected. Figure 10-11 shown.

[0101] The HI antibody titers of each immunization group continued to increase within 3 weeks after immunization and reached a peak 21 days after immunization. Even 35 days after immunization, the HI antibody titers of each immunization group were still higher than the protection line level (4log2).

[0102] At week one after immunization, the average HI titer in the HA-CpG group was 2.87 log2, while that in the commercial vaccine group was 3.55 log2. There was a statistically significant difference between the two groups (p<0.05). The average HI titer in the HA group was 1.67 log2, which was significantly different from that in the HA-CpG group (p<0.01).

[0103] In the second week, the HI titer slowly increased. The average HI titer in the HA-CpG group was 5.15 log2, while the average HI titer in the commercial vaccine group was 6.73 log2. The difference between the two groups was extremely significant (p < 0.0001). The average HI titer in the HA group was 2.75 log2, which was also significantly different from the HA-CpG group (p < 0.0001).

[0104] At week 3 after immunization, the average HI titers in the HA-CpG, commercial vaccine, and HA groups all reached peak values ​​of 7.68 log2, 8.18 log2, and 5.33 log2, respectively. There was no statistical difference between the HA-CpG and commercial vaccine groups, but there was a highly significant difference between the HA-CpG and HA groups (p < 0.0001).

[0105] At four and five weeks after immunization, the average titers in each group showed a slow downward trend. The HA-CpG group's antibody titer slowly decreased to 6.93 log2, the commercial vaccine group's antibody titer slowly decreased to 7.25 log2, and the HA group's antibody titer slowly decreased to 4.78 log2. There was no statistical difference between the HA-CpG group and the commercial vaccine group, but the difference between the HA-CpG group and the HA group was extremely significant (p < 0.0001). No antibodies were detected in the PBS control group.

[0106] The above results show that the HA-CpG group with CpG adjuvant has a significant improvement compared with the HA protein group alone, and has played a certain positive auxiliary role; although the antibody titer is slightly lower than that of the commercial vaccine group, the gap is not significant, and the activated immune response can still produce sufficient antibody levels, which is comparable to the immune protection efficacy produced by the commercial vaccine.

[0107] Example 3: Challenge experiment

[0108] Three weeks after immunization, 10 chickens were randomly selected from each group and administered with a challenge dose of 100 μL / chicken (10 6 Chickens were challenged with a 50 μL (EID50 / 100 μL) flask. Clinical symptoms were observed and recorded for 14 consecutive days after challenge. Throat and cloacal swabs were collected 3, 5, 7, and 9 days after challenge. Three chickens per group were randomly euthanized on day 3 after challenge. Lung tissue was collected from each group, fixed in 4% paraformaldehyde, and sent to Wuhan Sewell Biotechnology Co., Ltd. for preparation of pathological sections.

[0109] 1. Immune protection efficacy detection

[0110] (1) Survival of chickens after infection

[0111] The chickens were immunized for 21 days before the challenge and protection experiment. 6 After the challenge, the HA protein group, HA-CpG group, commercial vaccine group and PBS control group were monitored for clinical symptoms for 14 days, and the survival of the chickens in each group was recorded.

[0112] The results are as follows Figure 12 As shown, the survival rates of the HA-CpG and commercial vaccine groups were 100%, the survival rate of the HA protein group was 90%, and the survival rate of the PBS control group was 0%, with all chickens failing to survive the challenge. Furthermore, the chickens in the PBS control group displayed obvious clinical symptoms, including neck retraction, ruffled feathers, ruffled feathers, swollen eyelids, and freezing with closed eyes, typical signs of viral infection. The HA protein group showed mild lethargy.

[0113] In contrast, the HA-CpG group and the commercial vaccine group showed no obvious clinical symptoms and appeared to be in a normal healthy state.

[0114] (2) In vitro detoxification test

[0115] On days 3, 5, 7, and 9 after challenge, throat and cloaca swabs were collected from the chickens in each group and inoculated into chicken embryos for testing. The test results are shown in Table 5:

[0116] The PBS control group showed obvious throat and cloaca detoxification at all time points, and the final survival rate of the chickens in this group was 0, indicating that this group failed to produce immune protection; in contrast, the HA protein group had more significant throat and cloaca detoxification in the early stage (days 3 and 5); but as the immune response gradually strengthened, the detoxification decreased significantly, and almost no detoxification was observed on day 9; the HA-CpG group had relatively low throat and cloaca detoxification, which further decreased on day 5 and almost no detoxification on day 9; the immune effect was almost equivalent to that of the commercial vaccine group, and the detoxification protection rate of both groups almost reached 100% protection on days 7 and 9, and both groups were able to maintain significant protection effects for a long time.

[0117] Table 5 Throat and cloaca swab test results

[0118]

[0119] (3) Tissue viral load

[0120] On the fourth day after challenge, three mice were taken from each experimental group for autopsy. Heart, liver, spleen, lung, and kidney tissues were collected to isolate the virus and inoculate chicken embryos to determine the virus EID50. The specific steps are as follows:

[0121] Step 1: Cut each tissue sample into small pieces and add PBS at a ratio of 1:5, then add grinding beads and grind thoroughly to prepare a cell suspension;

[0122] Step 2: Place the cell suspension in a -80°C refrigerator and freeze and thaw repeatedly three times to release the virus inside the cells into the solution;

[0123] Step 3: Centrifuge at 8000 rpm for 10 min, filter the supernatant through a 0.22 μm filter membrane, and take 100 μL of the sample solution for 10-fold serial dilution;

[0124] Step 4: Take the original solution and 10 -1 ~10 -5 A total of 6 dilutions were inoculated into 9- to 11-day-old chicken embryos, 100 μL / embryo, with 3 replicates for each dilution;

[0125] Step 5: Incubate the inoculated chicken embryos in a 37°C incubator for 48 hours, observing them once in the morning and once in the evening. Discard any chicken embryos that died within 24 hours.

[0126] Step 6: Collect the chicken embryo allantoic fluid for hemagglutination test and use the Reed-Muench method to determine the quantitative virus titer.

[0127] The results are as follows Figure 13As shown in the figure, on day 4 after challenge, no virus was detected in any organ tissues in the HA-CpG group and the commercial vaccine group, while virus was detected in the spleen, lung, and kidney tissues in the HA protein group, but the virus titer was significantly lower than that in the PBS control group. In the PBS control group, virus was detected in all tissues.

[0128] The results showed that the HA-CpG and commercial vaccine groups had significant immune effects, effectively inhibiting the spread of the virus in various tissues, with no virus detected in any tissue. Although the HA protein group detected virus in the spleen, lung, and kidney tissues, the viral titer was significantly low. The PBS control group showed no inhibitory effect, with virus detected in all tissues at high titers.

[0129] (4) Pathological changes in chickens after virus infection

[0130] On the third day after infection, three chickens were randomly dissected from each group to observe the organ lesions. Figure 14 As shown, three days after infection, the PBS control group showed significant organ lesions and pathological changes. The heart turned dark red and showed obvious congestion. Multiple red and purple hemorrhages and swelling were observed on the surface of the heart. The liver showed multiple punctate hemorrhages, edema, and localized necrosis. The spleen was enlarged, congested, and necrotic. The stomach was bleeding severely. The lungs were congested, with extensive bleeding, congestion, and edema. The tracheal mucosa was damaged, with multiple hemorrhages and mucus accumulation. HA protein-treated groups showed mild lesions in various tissues. No significant lesions were observed in the HA-CpG and commercial vaccine groups.

[0131] Pathological changes in various organs in the PBS control group demonstrated that viral infection severely impacted the chickens' organs, particularly in vital organs such as the heart, lungs, liver, and spleen, manifesting as congestion, hemorrhage, edema, and localized necrosis. However, the HA protein, HA-CpG, and commercial vaccine groups demonstrated varying degrees of immune protection, with the HA-CpG and commercial vaccine groups showing no significant lesions, demonstrating superior immune protection.

[0132] (5) Pathological sections

[0133] The SPF chickens were killed and dissected on the 4th day after the infection. The lungs of each chicken were collected and placed in a centrifuge tube. 4% paraformaldehyde was added for fixation. After HE staining, pathological tissue sections were prepared. The histopathological changes of the lung tissues of the chickens in each group were observed under an optical microscope. The results are shown in Figure 2. Figure 15 shown.

[0134] Results showed that in the HA protein group, the parabronchial structure was clear, covered with cuboidal epithelium, but moderate hemorrhage was visible (green arrows). Hemorrhage was more pronounced in the atrial and parabronchial regions, with a small amount of atrial dilatation (yellow arrows). The respiratory capillary structure was unclear in some areas, but the effect was mild. There was some inflammatory response, especially localized hemorrhage and immune cell infiltration (red arrows). There was also some localized tissue damage, but it was less severe than in the PBS control group, indicating partial immune protection, but the effect was insufficient, with some pathological damage still present. In the HA-CpG group, there was less hemorrhage in the parabronchial structure (green arrows), less atrial dilatation, clear respiratory capillary structure, no obvious damage, and no significant inflammatory cell infiltration. This demonstrated a better immune response, indicating an effective immune response and tissue protection. In the commercial vaccine group, there was no significant epithelial loss in the parabronchial structure, with a small amount of lymphocyte infiltration around the atrial region (red arrows), and a milder inflammatory response. There was less hemorrhage, clear capillary structure, and no significant atrial dilatation or severe pathological damage. In the PBS control group, more epithelial cell loss (orange arrows) can be seen on the sections, there are more hemorrhages in the parabronchus and lung chambers (green arrows), there are severe pathological damage, local capillaries are severely damaged, there are many small areas of unclear respiratory capillary structure, interstitial vascular congestion (blue arrows), and inflammatory cell infiltration is more obvious (red arrows), indicating that the virus caused severe tissue damage and immune response in this group.

[0135] Analysis of pathological sections revealed that the HA-CpG group demonstrated excellent immune efficacy compared to commercial vaccine protection, with a milder immune response and effective control of pathological damage. The HA protein group exhibited moderate tissue damage and an incomplete immune response. The PBS control group, lacking immune protection, exhibited the most severe pathological changes, with extensive hemorrhage, inflammatory cell infiltration, and tissue damage. This suggests that the CpG immune adjuvant effectively enhanced the immune response and protected tissues from excessive damage.

[0136] In summary, by inserting multiple dihydroxyacetone kinase promoters (P DAK The recombinant Pichia pastoris strain was prepared by AOX1 、P GAP The two promoters were induced under the dominant induction conditions for 72 h, P DAK The protein secretion content of the recombinant Pichia pastoris strain induced by dihydroxyacetone was the highest, and the highest concentration reached 1.25 mg / ml at 48 h, reaching P GAP promoter more than twice that of the recombinant Pichia strain;

[0137] At the same time, the protein expressed by the recombinant Pichia yeast strain was used to prepare the vaccine (HA-CpG group). Compared with the commercial vaccine, there was no statistical difference in the HI antibody titer of this vaccine. Then, in the chicken infection experiment, whether it was the chicken survival, in vitro detoxification detection, tissue viral load, or pathological changes after the chicken was infected with the virus and pathological sections, the HA-CpG vaccine showed a significant inhibitory effect on the virus, and the effect was not significantly different from that of the commercial vaccine.

[0138] In summary, the recombinant Pichia pastoris strain prepared by the present invention has obvious advantages in protein expression, and its immune performance is not significantly different from that of commercial vaccines, indicating that the vaccine development path of the present invention is safe and feasible.

[0139] The above embodiments are preferred implementation modes of the present application, but the implementation modes of the present application are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present application shall be considered as equivalent replacement methods and shall be included in the scope of protection of the present application.

Claims

1. A recombinant plasmid, characterized in that: The recombinant plasmid contains a dihydroxyacetone kinase promoter gene fragment, a dihydroxyacetone kinase terminator gene fragment and a target gene.

2. The recombinant plasmid according to claim 1, characterized in that The target gene is the HA gene.

3. The recombinant plasmid according to claim 1, characterized in that The gene sequence of the recombinant plasmid is shown in SEQ ID NO:

18.

4. A method for preparing a non-methanol-inducible recombinant Pichia pastoris strain, characterized in that: linearizing the recombinant plasmid according to claim 2 or 3, and recovering the linearized fragment; The linearized fragment was transformed into a Pichia pastoris strain for expression, and a recombinant Pichia pastoris strain capable of expressing HA protein was screened.

5. A method for expressing H5 subtype avian influenza virus subunit antigens without methanol induction, characterized in that: The non-methanol-induced expression of H5 subtype avian influenza virus subunit antigen is induced to secrete the HA protein by a recombinant Pichia pastoris strain using dihydroxyacetone; the recombinant Pichia pastoris strain is a recombinant Pichia pastoris strain prepared by the method according to claim 4.

6. Use of the non-methanol-induced expression of H5 subtype avian influenza virus subunit antigens according to claim 5 in preparing vaccines for preventing and treating avian influenza.

7. A vaccine, characterized in that The vaccine contains the protein solution for non-methanol-induced expression of H5 subtype avian influenza virus subunit antigens as described in claim 5 and an adjuvant, and the vaccine can be used to prevent avian influenza virus.

Images