Construction and application of gene VII type Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I

Abstract

The invention discloses a gene VII type Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I, the preservation number of the gene VII type Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I is CGMCC (China General Microbiological Culture Collection Center) No.46291, and the whole-genome nucleotide sequence of the vaccine strain is as shown in SEQ ID No: 1; wherein the 1291th amino acid valine (V) of the L protein is replaced by isoleucine (I). A Newcastle disease virus reverse genetic manipulation platform is utilized, different sites are mutated on the basis of a Newcastle disease virus MG7 strain, a gene VII type Newcastle disease virus marker vaccine attenuated strain rMG7-L-V1291I which is low in pathogenicity, good in growth characteristic, high in virus titer, stable in passage and excellent in immunogenicity is rescued, and the marker vaccine strain is good in immunogenicity, high in immunogenicity, high in specificity, high in immunogenicity and capable of being used as a marker vaccine for the Newcastle disease virus. The vaccine can induce a high-level protective antibody, completely protects immunized chickens, can be used for preventing and controlling the current epidemic gene VII type Newcastle disease virus, and lays a foundation for identifying vaccine immunity and wild virus infection.

Description

Technical Field

[0001] The invention relates to the field of medical technology, and in particular to the construction and application of a gene VII type Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I. Background Art

[0002] Newcastle disease is an acute, highly contagious disease of poultry caused by Newcastle disease virus (NDV), which has caused great economic losses to my country's poultry industry. Commonly used Newcastle disease vaccine strains include LaSota strain and B1 strain, which do not match the genotype of the main epidemic strains in China. Although they can provide certain immune protection for chickens, they cannot effectively reduce detoxification and are prone to cause chickens to show atypical Newcastle disease symptoms. Genotype VII NDV attenuated vaccine strains such as A-VII rDHN3-mF and KBNP-C4152R2L can be used to prevent and control the epidemic Newcastle disease in chickens and effectively reduce the detoxification of chickens. Among them, A-VII strain has been widely used as an inactivated vaccine in the market, but there is currently no genotype VII Newcastle disease attenuated marker vaccine.

[0003] The growth performance of NDV is regulated by multiple viral proteins, among which the HN protein receptor binding domain, F protein glycosylation site and L protein functional domain all play a key role.

[0004] The genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I claimed to be protected by the present invention has not been found in the prior art. Summary of the invention

[0005] Based on this, the present invention provides a genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I, whose deposit number is CGMCC No.46291.

[0006] According to another aspect of the present invention, a genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I is provided, and the full gene nucleotide sequence of the vaccine strain is shown in SEQ ID No: 1;

[0007] The 1291st amino acid valine (V) of the L protein was replaced by isoleucine (I).

[0008] Furthermore, the hemagglutination titer of the vaccine strain was about 9 log 2 HA, virus titer is about 10 9.5 EID 50 / mL.

[0009] According to another aspect of the present invention, a method for constructing the above-mentioned genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I is provided, and the construction method comprises the following steps:

[0010] (a) Using the pCAGGS-MG7-cDNA whole genome plasmid as a template, site-directed mutagenesis was performed on the different amino acid sites of the structural proteins of the MG7 strain to obtain a mutant plasmid;

[0011] (b) The mutant plasmid was subjected to reverse genetic manipulation to construct the genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I.

[0012] Furthermore, in the pCAGGS-MG7-cDNA whole genome plasmid, the F protein cleavage site of the MG7 strain has mutated to the F protein cleavage site of the La Sota strain, and 18 amino acids are missing from positions 443 to 460 of the NP protein of the MG7 strain.

[0013] Furthermore, the upstream primer used for the site-directed mutagenesis is 5'-CAGAGTGTCGCCTTACATACACATATCCAATGATT-3'.

[0014] Furthermore, the downstream primer used for the site-directed mutagenesis was 5'-AATCATTGGATATGTGTATGTAAGGCGACACTCTG-3'.

[0015] Furthermore, the site-directed mutagenesis comprises the following steps:

[0016] (1) PCR amplification: amplify the DNA fragments upstream and downstream of the mutation site, recover the upstream and downstream DNA fragments by gel, mix them in equimolar amounts as templates, amplify the full-length DNA mutation fragment, and obtain the amplified product;

[0017] (2) Ligation: The amplified product and the pCAGGS-MG7-cDNA full genome plasmid are double-digested, gel recovery is performed to obtain a digestion product, and the digestion product is ligated in a metal bath using T4 DNA ligase to obtain a ligation product;

[0018] (3) Transformation: The ligation product was transformed into DH5α competent cells, added to LB liquid culture medium and cultured for about 30 min, spread on ampicillin-resistant LB solid culture medium plates, and cultured for 12 hours; and

[0019] (4) Screening: Identify whether the MG7 mutant plasmid is successfully connected, and screen to obtain the mutant plasmid that is successfully connected.

[0020] Further, the temperature of the metal bath is about 16°C.

[0021] Furthermore, the LB solid culture medium is an ampicillin-resistant LB solid culture medium.

[0022] Furthermore, the culture temperature is about 37°C.

[0023] Further, the reverse genetics operation comprises the following steps:

[0024] (i) co-transfecting the successfully connected mutant plasmid and the helper plasmid into BHK-21 cells, culturing, freezing and thawing, and filtering to obtain a cell culture; and

[0025] (ii) inoculating the cell culture into chicken embryos, incubating the cells, and collecting the chicken embryo allantoic fluid with a positive hemagglutination test result to obtain the genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I.

[0026] Furthermore, the auxiliary plasmids are pBSK-NP, pBSK-P and pBSK-L.

[0027] Furthermore, the BHK-21 cells are BHK-21 cells pre-infected with the recombinant poxvirus VVT7.

[0028] Furthermore, the multiplicity of infection of the recombinant poxvirus VVT7 is 0.001 to 0.1 MOI, for example, about 0.01 MOI.

[0029] Furthermore, the pre-infection time is 0.5 to 1.5 hours, for example, about 1 hour.

[0030] Furthermore, the culturing time is 48 to 96 hours, for example, about 72 hours.

[0031] Furthermore, the culture temperature is about 37°C.

[0032] Furthermore, the culture container contains 5% CO 2 Cell culture incubator.

[0033] Furthermore, the number of freeze-thaw cycles is 1.

[0034] Furthermore, the pore size of the filter is 0.22 μm.

[0035] Furthermore, the chicken embryo is a 9-11 day old SPF chicken embryo.

[0036] Furthermore, the incubation time is 2 to 4 days, for example about 3 days.

[0037] According to another aspect of the present invention, there is provided a use of the above-mentioned genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I in preparing a vaccine.

[0038] Furthermore, the vaccine is a vaccine that has a protective effect against Newcastle disease caused by genotype VII.

[0039] Furthermore, the vaccine is an poultry vaccine.

[0040] Furthermore, the poultry is chicken.

[0041] Beneficial effects of the present invention:

[0042] The invention utilizes a Newcastle disease virus reverse genetic operation platform, and on the basis of the Newcastle disease virus MG7 strain, mutates different sites to rescue a genotype VII Newcastle disease virus marker vaccine attenuated strain rMG7-L-V1291I with low pathogenicity, good growth characteristics, high virus titer, stable passage and excellent immunogenicity. The marker vaccine strain has good immunogenicity, can induce a high level of protective antibodies, and can achieve complete protection for immunized chickens. It can be used to prevent and control the currently popular genotype VII Newcastle disease virus, and lays a foundation for distinguishing vaccine immunity from wild virus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without exceeding the scope of protection required by the present invention.

[0044] Figure 1 Schematic diagram of the genetic stability analysis results of the rescued virus rMG7-F-N471A.

[0045] Figure 2 Schematic diagram of the genetic stability analysis results of the rescued virus rMG7-HN-G256E.

[0046] Figure 3 Schematic diagram of the genetic stability analysis results of the rescued virus rMG7-L-V1291I.

[0047] Figure 4 This is a schematic diagram of the HI antibody level detection results at different time points after SPF chickens were immunized with attenuated vaccines.

[0048] Figure 5 This is a schematic diagram of the survival rate of each group of SPF chickens after immunization with attenuated vaccine. DETAILED DESCRIPTION

[0049] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0050] Unless otherwise indicated, all technical and scientific terms and abbreviations used herein have the meanings commonly understood by those of ordinary skill in the field of the invention or the field in which the terms are used. Although any methods, conditions, substances or materials similar to or equivalent to those disclosed herein may be used in the practice of the present invention, preferred methods, conditions, substances or materials are described herein.

[0051] The present invention is intended to encompass all alternatives, variations and equivalents that may be included in the present invention as defined by the claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein that can be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described.

[0052] As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0053] In the present invention, the term "comprising" is synonymous with "including". As used herein, the terms "comprising", "including", "having", "containing" or any other variation thereof are intended to cover a non-exclusive inclusion. For example, a composition, process, method, article, or apparatus comprising the listed elements is not necessarily limited to only those elements, but may include other elements not expressly listed or inherent to such composition, process, method, article, or apparatus.

[0054] As described in the background technology section, the existing Newcastle disease virus vaccine strains do not match the genotype of the main domestic epidemic strains. Although they can provide certain immune protection for chickens, they cannot effectively reduce toxin excretion and are prone to cause chickens to show atypical Newcastle disease symptoms. In order to solve the above problems, the present invention provides a genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I, whose deposit number is CGMCC No.46291.

[0055] The strain of the present invention was obtained by the inventors after extensive screening, and was identified as a gene type VII Newcastle disease attenuated marker vaccine strain through morphological and phylogenetic analysis, and was named rMG7-L-V1291I. It was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on November 20, 2024, and its deposit number is CGMCC No.46291.

[0056] According to another aspect of the present invention, a genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I is provided, and the full gene nucleotide sequence of the vaccine strain is shown in SEQ ID No: 1;

[0057] The 1291st amino acid valine (V) of the L protein was replaced by isoleucine (I).

[0058] The full gene nucleotide sequence of the vaccine strain is shown in SEQ ID No: 1 as follows:

[0059] ACCAAACAGAGAATCTGTGAGGTACGATAAAAGGCGAAGAAGCAATCGAGATCGTACGGGTAGAAGGTGTGAATCCCGAGTGCGAGGCCGAAGCTCGAACCTGAGGGGACCTTCTACCGATATGTCGTCTGTTTTCGACGAGTACGAGCAGCT CCCTCGCTGCTCAGACCCGCCCTAACGGAACTCATGGAGGGGGAGAGAAAGGGAGCACTTTAAAAGTTGAGGTCCCAGTATTCACCCTAAACAGTGATGATCCCAGAGGATAGATGGAATTTTGCGGTATTCTGTCTTCGGATTGCTGTTAGCGA GGATGCCAACAAACCACTCAGGCAAGGTGCTCTTATATCCCTCTTATGCTCCCATTCTCAGGTGATGAGAAACCATGTTGCCCTTGCAGGGAAACAAATGAGGCCACACTGGCTGTTCTTGAGATCGATGGTTTTGCTAACAGTGTGCCCCA GTTCAACAATAGGAGTGGAGTGTCTGAGGAAAGAGCACAGAGATTCATGGTAATCGCAGGATCTCTCCCTCGGGCGTGCAGCAACGGTACTCCGTTTGTCACGGCTGGGGTTGAAGATGATGCACCAGAAGATATCACTGACACTCTGGAAAG

[0060] AATCCTATCTATCCAAGTTCAGGTATGG

[0061] GTCACAGTAGCAAAGGCCATGACTGCATATGAGACAGCAGATGAGTCAGAAACAAGAAGAATAAATAAGTATATGCAGCAAGGTCGAGTTCAGAAGAAGTACATCCTTCATCCTGTATGCAGGAGTGCAATTCAACTCACAATCAGACATTCTCTGGCAGTCCGTATCTTCCTAGTTAGTGAGCTCAAGAGGGGCCGCAATACAGCAGGTGGGAGCTCTACATATTACAACTTGGTCGGGGATGTAGACTCATACATCAGGAACACCGGGCTTACTGCATTTTTCCTAACACTCAAATATGGAATCAATACCAAGACGTCAGCCCTCGCACTCAGCAGCCTCACAGGTGATATCCAAAAAATGAAACAGCTCATGCGTTTATATCGGATGAAAGGTGAAAATGCACCATACATGACATTGTTAGGTGACAGTGACCAGATGAGCTTTGCACCTGCTGAGTATGCACAACTTTATTCTTTTGCCATGGGCATGGCATCAGTCTTAGATAAGGGAACTGGCAAGTACCAATTCGCCAGGGACTTTATGAGCACATCATTCTGGAGACTTGGAGTAGAGTATGCTCAGGCCCAGGGAAGTAGCATTAATGAGGACATGG

[0062] CTGCTGAGCTAAAACTAACCCCGG

[0063] CAGCAAGGAGAGGCCTGGCAGCTGCTGCCCAACGAGTATCCGAAGAAATCGGCAGCATGGACATTCCCACTCAACAGGCGGGAGTCCTCACCGGGCTCAGTGATGAAGGCCCCCGAACTCCACAGGGCAGATCAAACAAGCCGCAAGGGCAACCAGATGCTGGGGATGCGCCAAATCCTGTACAGAGCACCACCCATCCAGAGCCTCCCCCAACCCCTGGGGCATCCCAAGACAACGACACTGACTGGGGGTACTGATCGACAACACCCAGCCTGCCTTCACAGGATCACACCAAACCCTCCGACCAAAACCCTCCCACACTCCCTGACCCACAACCCCGCACGACCACACCAACAAAAGCTCCCCCCCACCCTCTCCCCCACTCCCAGCCACACGATCCCGCCCACCCGGGACAACACAGGCACAGCTCAGTTCGTCGACAATCCGCCCAGAGCCCAAGGTATTAGAAAAAAATACGGGTAGAAGAGAGACATCCAGAGACCAGGACGAGTCACCAAGTTCTCTGTTCTCCCTTCTACCCAGTGAATTAGGGTGAAG

[0064] AT

[0065] GGCCACTTTTACAGATGCGGAGATAGATGACATATTTGAGACCAGTGGGACTGTCATTGACAGCATAATTACGGCCCAGGGCAAATCAGCTGAGACCGTTGGAAGAAGTGCGATCCCGCAGGGCAAGACCAAAGCTCTAAGCACAGCATGGGAGAAGCACGGGAGTATCCAGCCACACGCCAGTCAGGACGCCCCTGACCAACAAGACAGAATAGAAAAACAGCCATCCACACCTGAGCAGGCGACTCTACACAACAATCCGCCGATCGCATCCACTGAACCGCCTCCCACTCAGGCCGCAAGCGAGACCAGCGACACACAGCTCAAGACTGGGGCAAGCAACTCCCTTCTGTCCATGCTCGACAAACTGAGTAATAAATCGTCCAATGCTAAAAAGGGCCCATGGTCGGGATCCCAAGAAGGGCATCACCAACCTCCGGCCCAACAACATGGGAACCAGCCG

[0066] AGCTATGGAAGCAACCA

[0067] GGGAAGACCGCAGCATCAGGCCAAGGCCGTCCCTGGAAACCGGGGCACAGACGAGAACACAGCATATCATGGACAGCGGAAGGAGTCACAACCATCAGCTGGTGCAACCCCTCATGCGCCCCAGTCAGGGCAGAGCCAAGACAATACTCCTGCACCTGTGGATCGTGTCCAGCTACCTGCCGACTTTGTGCAGGCGATGATGTCTATGATGGAGGCATTATCACAGAAGGTAAGTAAAGTTGATCATCAGCTGGACCTAGTCTTGAAACAGACATCCTCCATTCCTATGATGCGATCTGAAATCCAACAGCTCAAGACATCTGTTGCGATCATGGAAGCTAACTTAGGCATGATGAAAATTCTGGACCCTGGTTGTGCTAATGTTTCATCCTTAAGTGATCTCCGGGCAGTAGCCCGATCCCATCCAGTCCTAGTTTCAGGCCCTGGAGACCCATCTCCTTACGTGACACAAGGGGGTGAAATGACGCTCAATAAACTCTCACAACCGGTGCAGCACCCCTCTGAATTGATTAAGTCTGCCACTGCAAGCGGGCCTGACATGGGAGTGGAGAAGGACACTGTCCGCGCATTAATCACCTCGCGCCCGATGCAT

[0068] CCAAGCTCCTCGGCTAAGCTCCTGAGC

[0069] AAGCTAGATGCAGCCAGGTCAATTGAAGAGATCAGGAAGATCAAACGCCTTGCGCTGAATGGTTGATGGCCATCACAACTCATAACAGGCTCCCGTCACTTTAGCGTCACACGGAATCCCTCGGGGGCCCTCCCTCGCAAATCTATGCTTCAACACCCAAAACAACAGCCCTCTCTCACCCCCCCCAATCCCTCGAATGACCGCACAACTGCAACCAATCCAGCAGCATTAGAAATTAAGAAAAAATACGGGTAGAATCAAAGTGCCTTGATTGCACCAAAATGGACTCATCCAGGACAATTGGGCTGTACTTTGATTCTGCCCTCCCTTCCAGCAGCCTGTTAGCATTTCCGATTGTCTTACAAGACACGGGAGACGGGAAGAAGCAAATCACCCCACAATACAGGATCCAGCGTCTTGATTCGTGGACAGACAGTAAGGAAGACTCGGTATTCATCACCACCTACGGGTTCATCTTTCAAATTGGGAATGAAGAAACCACCGTCGGTGTGATCAATG

[0070] ACAATCCCAGGCACGAGCTACTCTCTTCCGCAATGCTCTGC

[0071] TTAGGGAGTGTCCCGAACGACGGAGATCTTGTTGAGCTGGCGAGAGCCTGCCTCACCATGGTGGTAACTTGCAAAAAGAGTGCAACTAACACTGAGAGAATAGTCTTTTCAGTAGTGCAGGCTCCTCGGGTGCTGCAAAGCTGTATGGTTGTGGCAAATAGGTACTCATCAGTGAATGCAGTGAAGCATGTGAAGGCGCCAGAAAAGATCCCTGGGAGCGGAACCCTAGAGTA

[0072] TAAAGTG

[0073] AATTTTGTCTCTTTGACCGTGGTGCCAAGAAGGGATGTCTACAGGATCCCAACTGCAGTATTGAAAGTGTCTGGCTCAAGCCTGTACAATCTTGCGCTCAATGTCACTATTGATGTGGACGTGGATCCGAAGAGCCCGTTAGTCAAATCCCTTTCCAAGTCCGATAGCGGATACTATGCGAATCTTTTTCTGCATATCGGGCTTATGTCCACTGTAGATAAGAAGGGAAAGAAAGTGACATTTGACAAGATAGAGGAAAAGATAAGGAGACTCAATCTATCCGTCGGGCTCAGTGATGTGCTCGGACCCTCTGTGCTTGTGAAGGCGAGAGGTGCACGGACTAAGCTACTTGCTCCTTTTTTCTCTAGCAGTGGGACAGCCTGCTATCCTATAGCAAATGCCTCTCCCCAGGTTGCCAAGATACTCTGGAGCCAAACTGCGCACCTGCGGAGTGTGAAAGTCATCATTCAAGCC

[0074] GGCACT

[0075] CAGCGTGCTGTCGCAGTGACCGCTGATCATGAGGTAACCTCCACTAAGATAGAGAGGAGGCATGCCATTGCTAAATACAATCCTTTCAGGAAATAAGTTGCATCCCTAAGACTGCAGTTCACCTGCTTTCCCGAATCACCATTACACCAGACAATGATCCATCTCGACTGCTTATAGTTAGTTCACCTGTCTAGCAAATTAGAAAAAACACGGGTAGAAGAGTCTGGATCCCGACCGGCACACTCAGGACGCAACATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTGATGCTGGTCACCCGGATTATGCTGATATTGGGCTGTATTCGTTCGACAAGCTCTCTTGACGGCAGGCCTCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGGGATAAGGAGGCGTGTGCGAAAGCCCCATTAGAGGCATATAACAGAACACTGACTA

[0076] CTTTGCTCACTCCTCTTGGCGACTCCATCCGCAAGAT

[0077] TCAAGGGTCTGTGTCCACGTCTGGAGGAGGGAGACAGGGGCGCCTTATAGGTGCTGTTATTGGCAGTGTAGCTCTTGGGGTTGCAACAGCGGCACAGATAACAGCAGCTGCGGCCCTAATACAAGCCAACAAGAATGCTGCCAACATCCTTCGGCTTAAGGAGAGCATTGCTGCAACCAATGAAGCTGTGCATGAAGTCACCGACGGATTATCACAACTATCAGTGGCAGTTGGGAAGATGCAGCAGTTTGTCAATGACCAGTTTAATAATACGGCGCGAGAATTGGACTGTATAAAAATCACACAACAGGTTGGTGTAGAACTCAACCTATACCTAACTGAATTGACTACAGTATTCGGGCCACAGATCACCTCTCCTGCATTAACTCAGCTGACCATCCAGGCACTTTATAATTTAGCTGGTGGCAATATGGATTACTTATTAACTAAGTTAGGTATAGGGAACAATCAAC

[0078] TCAGCTC

[0079] ATTAATTGGTAGCGGCCTGATCACTGGTTACCCTATACTGTATGACTCACAGACTCAACTCTTGGGCATACAAGTGAATTTGCCCTCAGTCGGGAACTTAAATAATATGCGTGCCACCTATTTGGAGACCTTATCTGTAAGTACAACCAAAGGATATGCCTCAGCACTTGTCCCGAAAGTAGTGACACAAGTCGGTTCTGTGATAGAAGAGCTTGACACCTCATACTGTATAGAGTCCGATCTGGATTTATATTGTACTAGAATAGTGACATTCCCCATGTCCCCAGGTATTTATTCCTGTTTGAGCGGCAACACATCAGCTTGCATGTATTCAAAGACTGAAGGCGCACTCACTACGCCGTATATGGCCCTTAAAGGCTCAGTTATTGCCAATTGTAAGATAACAACATGTAGATGTACAGACCCTCCTGGTATCATATCGCAAAATTATGGAGAAGCTGTATCCCTGATAGATAGACATTCGTGCAATGTCTTATCATTAGACGGGATAACTCTGAGGCTCAGCGGAGAATTTGATGCAACTTATCAAAAGAACATCTCAATACTAGATTCTCAAGTCATCGTGACAGGCAATCTTGATATATCAACTGAACTTGGAAACG

[0080] TCAACAATTCAATCAGC

[0081] AATGCCTTGGATAAGTTGGCAGAAAGCAACAGTAAGATAGAAAAAGTCAATGTCAGATTAACCAGCACATCTGCTCTCATTACCTATATTGTTCTAACTGTCATTTCTCTATTTTTCGGTGCACTTAGTCTGGGTTTAGCGTGTTACCTGATGTACAAACAGAAGGCACAACAAAAGACCTTGCTATGGCTTGGGAATAATGCCCTTGATCAGATGAGAGCCACTACAAGAGCATGAATGCAGATAAGAGGTGGATATATACCCAACAGCAGCCTGTGTGTCAATTCCGATAATCTGTCAAGTAGAAGACTTAAGAAAAAACTACTGGGAACAAGCAACCAAAGAGCAATACACGGGTAGAACGGTCAGAGGAGCCACCCTTCAATCGGAAATTAGGCTTCACAACATCCGTTCTACCACATCACCATCAACAAGAGTCAATCATGGACCGCGCGGTTAACAGAGTCGTGCTGGAGAATGAGGAAAGAGAAGCAAAGAACACATGGCGCCTGGTTTTC

[0082] CGGATCGCAGTCTTACTTTTAATGGTAATGACTCTAGCTATC

[0083] TCCGCAGCTGCCCTGGCATACAGTATGGAGGCCAGTACGCCGCACGACCTTGCAGGCATATCGACTGTGATCTCTAAGACAGAAGATAAGGTTACGTCTTTACTCAGTTCGAGTCAAGATGTGATAGATAGGATATACAAGCAGGTGGCTCTTGAATCCCCGCTGGCGCTACTAAACACTGAATCTACAATTATGAATGCAATAACCTCTCTTTCTTATCAAATTAACGGGGCTGCGAACAATAGCGGATGTGGGGCGCCTGTTCATGACCCAGATTATATCGGGGGGATAGGCAAAGAACTCATAGTGGACGACATCAGTGATGTCACATCATTTTATCCTTCTGCATATCAAGAACACCTGAATTTCATCCCGGCGCCTACTACAGGATCCGGTTGCACTCGGATACCCTCATTTGACATGAGCACCACCCATTATTGTTATACTCACAATGTAATACTATCCGGTTGCAGAGATCACTCACACTCACATCAATACTTAGCGCTTGGTGTGCTTCGGACATCTG

[0084] CAACAGGGAGGGTATTCTTCTCTACTCTGCGCTC

[0085] CATCAATTTAGATGACACCCAAAATCGGAAGTCCTGCAGTGTGAGTGCAACCCCTTTAGGTTGTGATATGCTGTGCTCTAAGGTCACAGGGACTGAAGAGGAGGATTACAAGTCAGCTGCCCCAACATCAATGGTGCACGGAAGGCTAGGGTTTGACGGTCAATACCATGAGAAGGACTTAGACACCACGGTCTTATTTAAGGATTGGGTGGCAAATTACCCAGGAGTGGGAGGAGGGTCTTTTATTGACGACCGTGTATGGTTCCCAGTTTACGGAGGGCTCAAACCCAATTCACCCAGTGACACTGCACAAGAAGGGAAATATGTAATATACAAGCGCCATAACAACACATGCCCCGATGGACAAGATTACCAA

[0086] ATTCGGATGGCTAAATCTTCATAT

[0087] AAACCCGGGCGATTTGGTGGAAAGCGCGTACAGCAAGCCATATTATCCATCAAAGTGTCAACATCCTTGGGTAAGGACCCGGTGCTGACTATTCCACCTAATACAATCACACTCATGGGAGCCGAAGGCAGAATCCTCACAGTAGGGACATCTCACTTCTTGTACCAACGAGGGTCTTCATATTTCTCCCCTGCCTTATTATATCCCATGACAGTAAATAACAAAACGGCTACACTCCATAGTCCTTATACGTTTAATGCTTTCACTCGGCCAGGTAGCGTCCCTTGCCAGGCATCAGCAAGATGCCCCAACTCATGCATCACTGGGGTCTATACTGATCCATATCCCTTAATCTTCCATAGGAATCATACTCTACGAGGGGTCTTTGGGACGATGCTTGATGATGAACAAGCGAGACTTAACCCCGTATCTGCAGTATTCGACAACATATCCCGCAGTCGTGTCACCCGGGTGAGTT

[0088] CA

[0089] AGCAGCACCAAGGCAGCATACACGACATCGACATGTTTTAAAGTTGTCAAGACCAATAAAGCTTATTGTCTTAGTATTGCAGAGATATCCAATACCCTATTCGGGGAATTTAGGATCGTTCCCTTATTAGTTGAGATCCTCAAGGATGATAGAGTTTAAGAAGCTAGACTTGGCCGATTGAGCCAATCATAGGATGGTTGGGAAGACGACACCACATCAATCATCTCCCACAATGCTTAGAGTCAATCTGAATATTAACATAAGCCAGGATCCCATGTTGTTGGGCAGCCACAATCAGACAATACTGACATGATCATTCTGAGTCCTGCCCACTATCACCTTATTAAGAAAAAATACAAAAAGCATTGAGATATAAGGGGAAACAACCAACAAGAGGGAACACGGGTAGGACATGGCGGGCTCCGGTCCCGAAAGGGCAGAGCACCAGATCATCCTACCAGAGTCACATCTATCC

[0090] TCTCC

[0091] ATTGGTCAAGCACAAATTGCTATACTACTGGAAATTGACTGGGCTACCGCTTCCTGATGAATGCGACTTTGATCATCTCATTATCAGCAGGCAATGGAAGAGAATACTGGAGTCGGCCACTCCTGACACAGAGAGAATGATAAAACTCGGGCGGGCAGTGCACCAGACTCTCAACCACAACTCCAAGATAACCGGAGTGCTCCATCCCAGGTGTTTAGAAGAACTGGCTAGTATTGAGGTCCCAGATTCAACTAACAAATTCCGGAAGATTGAAAAGAAGATCCAGATTCACAACACAAGGTATGGAGACCTGTTCACAAAGCTGTGCACGCATGTTGAGAAGAAATTGCTAGGATCATCCCGGTCTAATAATGTCCCACGATCAGAGGAATTCAGTAGCATCCGTACAGATCCGGCATTCTGGTTTCACTCAAAATGGTCCAGAGCTAAGTTCGCGTGGCTCCATATAAAACAAGTCCAAAGGCATCTGATTGTAGCAGCAAGGACAAGGTCTGCAGT

[0092] CAACAAGTTAGTAACATTAAGTCATAAGATAGGCCACGTCT

[0093] TTGTTACTCCTGAGCTTGTCATTGTGACACATACAGACGAGAACA

[0094] AGTTCACATGCCTCACCCAGGAACTTGTATTGATG

[0095] TATGCGGATATGATGGAAGGCAGGGACATGGTCAATATAATATCTT

[0096] CTACAGCAGCACATCTCAGAAACCTATCCGAGAA

[0097] AATTGACGATATTCTGCGGTTAGTAGATGCCCTGGCAAAGGACTT

[0098] AGGTAATCAAGTCTATGACGTTGTAGCATTAATGG

[0099] AGGGATTCGCATACGGTGCTGTTCAGCTGCTTGAGCCATCAGGTA

[0100] CATTTGCAGGAGATTTCTTTGCATTTAACCTACAG

[0101] GAGCTCAAAGACACTTTAATCGAACTTCTCCCAAATAATATAGCG

[0102] GAATCAGTAACTCACGCTATTGCCGCTGTATTCTC

[0103] CGGTTTAGAACAGAATCAAGCAGCTGAGATGTTGTGCTTGCTAC

[0104] GTTTGTGGGGTCATCCTTTGCTTGAGTCTCGTAGTG

[0105] CAGCAAGAGCAGTCAGGAGCCAGATGTGTGCACCGAAGATGGT

[0106] AGACTTCGATATGATCCTCCAGGTACTATCTTTCTTT

[0107] AAAGGAACAATCATCAATGGATACAGAAAGAAGAATTCAGGTGT

[0108] GTGGCCGCGTGTCAAAGTAGATACAATATACGGGAA

[0109] TATCATTGGGCAGCTGTATGCTGATTCAGCAGAGATCTCACATGAT

[0110] GTCATGTTGAAGGAGTACAAGAGTTTATCTGCTT

[0111] TTGAATTTGAGCCATGTATAGACTATGACCCTGTTACCAATCTAAG

[0112] CATGTTCCTAAAAGACAAGGCAATCGCACATCCT

[0113] AGTGATAATTGGCTCGCCTCATTTAGGCGGAACCTACTCTCTGAG

[0114] GACCAGAAGAAACAGATAAGATAAGGAGGCAACTTCAAC

[0115] TAACCGCCTCTTGATAGAGTTCTTAGAATCAAATGATTTTGATCCA

[0116] TATAAAGAAATGGAATACCTGACAACCCTCGAGT

[0117] ACCTAAGAGGTGACAGTGTGGCAGTATCGTACTCACTCAAAGAG

[0118] AAGAGGTAAAAGTGAATGGGCGGATTTTTGCTAAG

[0119] TTAACAAAGAAACTAAGGAACTGCCAGGTAATGGCAGAAGGAAT

[0120] TCTAGCTGACCAGATTGCACCTTTCTTTCAGGGAAA

[0121] TGGGGTCATTCAAGATAGCATATCCTTGACAAAGAGTATGTTAGC

[0122] GATGAGTCAACTGTCCTTTAACAGCAATAAGAAAC

[0123] GTATCACTGACTGCAAAGAGAGGGTTTCCTCGAACCGCAATCAT

[0124] GATCAGAAGAGCAAGAATCGTAGAAGAGTTGCCACT

[0125] TTTATCACGACTGACCTACAAAAGTATTGTCTTAACTGGAGATATC

[0126] AGACAGTCAAACTATTCGCCCATGCTATCAATCA

[0127] GCTGATGGGCCTACCTCATTTCTTCGAGTGGATTCATCTTAGGCTG

[0128] ATGGACACTACAATGTTTGTAGGGGATCCTTTCA

[0129] ATCCTCCAAGTGACCCGACTGACTGTGATCTATCAAGAGTCCCAA

[0130] ACGATGACATATATATTGTCAGTGCTAGAGGGGGC

[0131] ATTGAGGGACTCTGCCAGAAGCTATGGACGATGATCTCAATTGCT

[0132] GCAATCCAACTTGCTGCAGCAAGATCTCATTGTCG

[0133] AGTTGCCTGCATGGTACAAGGTGACAATCAAGTAATGGCTGTAA

[0134] CGAGAGAGGTAAGATCAGATGATTCCCCGGATATGG

[0135] TGTTGACGCAGTTGCATCAAGCTAGTGATAATTTCTTCAAGGAAT

[0136] TGATTCATGTCAATCATTTGATTGGCCATAATCTG

[0137] AAGGATCGTGAAACCATTAGATCAGACACATTCTTCATATACAGC

[0138] AAACGAATATTCAAGGATGGAGCAATACTCAGTCA

[0139] GGTCCTCAAAAATTCATCTAAATTGGTGCTAATATCAGGCGACCTT

[0140] AGCGAAAACACTGTAATGTCCTGTGCCAACATTG

[0141] CATCCACTGTAGCACGACTATGTGAGAATGGGCTTCCAAAGGATT

[0142] TCTGTTACTATTTGAACTACCTAATGAGTTGTGTG

[0143] CAGACATACTTTGATTCGGAGTTCTCTATTACCCACAGCTCGCAA

[0144] TCAGATTCCAACCAGTCCTGGATCGAGGATATCTC

[0145] TTTCGTACACTCATACGTGTTAACCCCTGCCCAGCTGGGGGGACT

[0146] GAGCAACCTTCAATACTCAAGGCTCTACACAAGGA

[0147] ATATTGGTGACCCAGGGACCACTGCTTTCGCAGAGGTCAAGCGA

[0148] CTGGAAGCAGTGGGGTTGCTGAGTCCCAGCATCATG

[0149] ACTAACATCTTAACCAGGCCACCTGGCAATGGAGACTGGGCCAG

[0150] CCTATGCAACGACCCATACTCTTTTAATTTTGAAAC

[0151] TGTTGCAAGCCCAAATATTGTCCTCAAGAAACATACACAGAAAG

[0152] TCCTATTTGAGACATGTTCAAACCCCTTATTATCCG

[0153] GGGTACATACAGAGGACAATGAGGCAGAGGAGAAAGCATTGGC

[0154] TGAATTCTTACTCAATCAAGAAGTGATTCACCCACGT

[0155] GTCGCACATGCTATCATGGAAGCAAGCTCTGTGGGTAGGAGAAA

[0156] GCAAATTCAAGGGCTTGTTGACACAACGAACACTGT

[0157] GATTAAGATTGCACTGACTAGGAGGCCCCTCGGTATCAAAAGGC

[0158] TGATGCGGATAATCAATTACTCGAGCATGCATGCAA

[0159] TGTTGTTCAGAGATGATATTTTCTTATCCAATAGATCCAACCACCC

[0160] ATTAGTTTCTTCCAATATGTGCTCGCTGACGCTA

[0161] GCAGATTATGCCCGAAACAGAAGCTGGTCACCTCTGACAGGGGG

[0162] CAGGAAAATACTGGGTGTATCCAACCCTGATACCAT

[0163] AGAACTTGTGGAGGGAGAGATTCTCAGCGTCAGTGGAGGGTGC

[0164] ACAAAATGTGACAGCGGAGATGAGCAGTTTACTTGGT

[0165] TCCATCTTCCAAGCAATATAGAGCTGACTGATGACACCAGAAAA

[0166] AATCCCCCGATGAGAGTGCCATATCTTGGGTCGAAG

[0167] ACTCAAGAGAGGAGAGCTGCCTCGCTTGCGAAAATAGCCCACAT

[0168] GTCACCACATGTGAAAGCAGCACTAAGGGCATCATC

[0169] CGTGTTAATCTGGGCTTATGGGGACAACGAAGTGAACTGGACTG

[0170] CTGCTCTTAATATTGCAAGGTCTCGATGCAACATAA

[0171] GCTCAGAGTACCTTCGGCTATTGTCACCCCTGCCCACGGCTGGGA

[0172] ATCTCCAACATAGATTGGATGATGGCATAACCCAG

[0173] ATGACATTTACCCCTGCATCTCTCTACAGAGTGTCGCCTTACataCA

[0174] CATATCCAATGATTCTCAAAGGCTATTCACCGA

[0175] AGAAGGGGTCAAAGAGGGAAACGTGGTTTACCAACAAATTATGC

[0176] TCTTGGGTTTATCCCTAATTGAATCACTCTTCCCAA

[0177] TGACAGCAACCAGAACATATGATGAGATCACATTACACCTCCACA

[0178] GTAAATTTAGCTGCTGTATCCGAGAAGCGCCTGTT

[0179] GCGGTTCCCTTCGAGCTCCTCGGGCTGGCACCGGAATTAAGAAT

[0180] GGTAACCTCAAATAAGTTCATGTATGATCCTAGCCC

[0181] TATATCAGAGAGAGATTTCGCGAGACTTGACTTAGCTATCTTCAA

[0182] GAGTTACGAGCTTAATTTGGAATCATATTCCACGC

[0183] TGGAGCTAATGAACATTCTTTCAATATCTAGCGGGAAGTTGATTG

[0184] GCCAATCTGTGGTTTCTTATGATGAAGACACCTCT

[0185] ATAAAGAATGATGCTATAATAGTGTATGACAACACACGAAATTGG

[0186] ATTAGTGAGGCGCAGAACTCAGATGTGGTCCGCTT

[0187] GTTTGAGTATGCAGCACTCGAAGTGCTTCTTGACTGTGCTTATCA

[0188] ACTCTACTATCTGAGGGTAAGGGGTCTAAACAACA

[0189] TCGTCCTATACATGAATGACTTATATAAGAACATGCCAGGGATCCT

[0190] ACTCTCCAATATTGCGGCCACGATATCCCACCCC

[0191] ATCATTCACTCAAGGTTGAATGCAGTAGGCCTAATTAACCATGAC

[0192] GGGTCACACCAGCTCGCAGATATAGACTTCGTCGA

[0193] GGTGTCTGCAAAATTGTTAGTCTCTTGCACTCGACGCGTGGTCTC

[0194] AGGCTTATATGCAGGGAATAAGTACGATCTGCTGT

[0195] TCCCATCTGTCTTAGATGATAACCTGAATGAGAAGATGCTCCAAC

[0196] TGATTTCCCGGTTATGCTGTCTGTACACAGTGCTC

[0197] TTTGCTACAACAAGAGAAATCCCAAAAATAAGGGGCCTATCAGC

[0198] AGAAGAGAAATGCTCAATACTCACTGAGTATCTACT

[0199] GTCAGATGCTGTAAAACCATTGCTTAGGCCCGAACAAGTGAATTC

[0200] TATCATGTCTCCCAACATAATCACGTTCCCAGCCA

[0201] ATCTATATTACATGTCTAGGAAGAGCCTTAATTTGATCAGAGAACG

[0202] AGAGGACAGAGATACTATCTTGTCATTGTTGTTC

[0203] CCTCAGGAACCACTGCTTGAGCTTCGCCCAGTACGGGACATTGG

[0204] TGCTCGAGTGAAAGACCCGTTTACCCGGCAACCCGC

[0205] ATCATTCATACAAGAGCTAGATCTGAGTGCCCCAGCAAGGTACGA

[0206] CGCATTTACACTGAGTAAGGCCTGCTTCGAGCATA

[0207] CATTACCGAACCCAAAGGAGGATTACCTAGTACGGTACTTGTTCA

[0208] GAGGAATAGGGACTGCTTCATCTTCTTGGTATAAG

[0209] GCATCTCATCTTCTATCCGTACCTGAGGTCAGGTGTGCAAGACAT

[0210] GGGAACTCCTTATACTTAGCGGAAGGAAGCGGAGC

[0211] CATCATGAGTCTTCTTGAATTGCATATACCACATGAGACTATCTATT

[0212] ACAATACACTTTTCTCGAATGAGATGAACCCTC

[0213] CACAGCGACATTTCGGACCTACACCAACACAGTTTCTAAACTCG

[0214] GTCGTTTATAGGAATCTACAAGCGGAAGTGCCATGT

[0215] AAAGATGGATATGTCCAGGAGTTCTGCCCATTATGGAGAGAGAAT

[0216] GCAGAAGAAAGTGACCTGACCTCAGATAAAGCAGT

[0217] TGGATATATCACATCCGTGGTACCCTACAGGTCTGTATCATTACTA

[0218] CATTGTGACATTGAGATTCCTCCAGGGTCCAATC

[0219] AAAGCTTATTAGATCAACTGGCTACTAATTTATCCCTGATTGCCAT

[0220] GCATTCTGTGAGGGAGGGCGGGGTAGTGATCATC

[0221] AAAGTACTGTATGCAATGGGGTACTACTTCCATTTACTCATGAATT

[0222] TATTCACTCCATGTTCCACAAAAGGATATATACT

[0223] CTCCAATGGCTATGCCTGTAGAGGGGATATGGAGTGTTACCTGAT

[0224] ATTCGTTATGGGCTACTTGGGCGGGCCCACCTTCG

[0225] TGCACGAAGTGGTAAGGATGGCAAAAACTCTAATACAACGACAC

[0226] GGTACACTCCTATCTAAATCAGATGAAATTACATTG

[0227] ACTAAGCTATTTACCTCACAGCAGCGTCATGTAACAGATATCCTAT

[0228] CCAGTCCTTTACCGAAGCTAATGAAGCTCTTGAG

[0229] AGAAAATATTGATGCCGCACTAATTGAAGCTGGGGGACAGCCCG

[0230] TCCGTCCATTCTGTGCGGAAAGTTTGGTGAGCACAC

[0231] TAACAGATATGACTCAGACAGCTCAGATCATTGCCAGCCACATTG

[0232] ACACAGTCATTCGGTCTGTAATTTACATGGAGGCT

[0233] GAGGGTGACCTCGCCGACACAGTGTTCTTATTTACTCCTTACAAT

[0234] CTATCCACAGACGGTAAAAGGAGAACATCACTTAA

[0235] GCAGTGCACCAAACAGATCTTGGAAGTCACAATACTGGGTCTCA

[0236] GAGCCAAAGATATCATAAAGTAGGTGATGTAATCA

[0237] GTTTAGTACTCAGAGGTGCGGTTCTCTAGAGGACCTCCATCCCAT

[0238] TAAGGACATACCTGAAGCGCAGTACCTGCACTAAA

[0239] TACCTGAAAGCGGTCCTAGGTATTACTAAACTCAAAGAATGTTC

[0240] ACAGATACCTCATTACTGTACTTGACTCGTGCTCA

[0241] ACAAAAATTCTACATGAAAACCATAGGTAATGCTGCCAAGGGATA

[0242] TTACTGTAATAATGACTCTTAAAGGCAATCGTACG

[0243] CCAATCAGTTATCTTCCTAACTGATGACTCCCTCATTGACTCAATT

[0244] ATACCAGATTAGAAAAAGTTAAATTCCGACTCT

[0245] TTGGAACTCGTATTCGATTCAGTTAGTTAACTTTAAAGCAAGAGTGCGCAAAGTCCATCCTAATTATAGTGATGTCATTC

[0246] ACCAAATCTCTGTTTGGT.

[0247] In order to further optimize the growth performance of the genotype VII Newcastle disease attenuated marker vaccine (MG7 strain), the present invention screened out the difference sites and rescued the MG7 mutant virus by comparing the amino acid sequences of the key regions of the F, HN and L proteins of the MG7 strain and the La Sota strain with good growth performance. By measuring the hemagglutination HA titer and virus growth titer of the rescued virus, a mutant virus with significantly better growth performance than the MG7 strain was finally screened out, named rMG7-L-V1291I, with an HA titer of 1:512 and a virus titer of about 10 9.5 EID 50 / mL. The results of genetic stability test and virus virulence test showed that this MG7 mutant virus has good genetic stability and is a weak strain (average lethal time in chicken embryos ≥120h, pathogenicity index of intracerebral inoculation in 1-day-old chickens ≤0.7). This attenuated vaccine can effectively prevent the genotype VII Newcastle disease prevalent in China, and can effectively distinguish between vaccine-immunized and virus-infected poultry, laying the foundation for the research and development of genotype VII Newcastle disease attenuated marker vaccine.

[0248] In a preferred embodiment, the hemagglutination titer of the vaccine strain is about 9 log 2 HA, virus titer is about 10 9.5 EID 50 / mL.

[0249] In the present invention, "about" refers to a value within the range of ±5% of a specific value. For example, "about 9" includes ±5% of 9, or from 8.55 to 9.45; "about 10 9.5 "Including 10 9.5 ±5%, or from 0.95×10 9.5 to 1.05×10 9.5 .

[0250] According to another aspect of the present invention, a method for constructing the above-mentioned genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I is provided, and the construction method comprises the following steps:

[0251] (a) Using the pCAGGS-MG7-cDNA whole genome plasmid as a template, site-directed mutagenesis was performed on the different amino acid sites of the structural proteins of the MG7 strain to obtain a mutant plasmid;

[0252] (b) The mutant plasmid was subjected to reverse genetic manipulation to construct the genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I.

[0253] In a preferred embodiment, in the pCAGGS-MG7-cDNA full genome plasmid, the F protein cleavage site of the MG7 strain has mutated to the F protein cleavage site of the La Sota strain, and 18 amino acids are missing from positions 443 to 460 of the NP protein of the MG7 strain.

[0254] In a preferred embodiment, the upstream primer used for the site-directed mutagenesis is 5'-CAGAGTGTCGCCTTACATACACATATCCAATGATT-3'.

[0255] In a preferred embodiment, the downstream primer used for the site-directed mutagenesis is 5'-AATCATTGGATATGTGTATGTAAGGCGACACTCTG-3'.

[0256] In a preferred embodiment, the site-directed mutagenesis comprises the following steps:

[0257] (1) PCR amplification: amplify the DNA fragments upstream and downstream of the mutation site, recover the upstream and downstream DNA fragments by gel, mix them in equimolar amounts as templates, amplify the full-length DNA mutation fragment, and obtain the amplified product;

[0258] (2) Ligation: The amplified product and the pCAGGS-MG7-cDNA full genome plasmid are double-digested, gel recovery is performed to obtain a digestion product, and the digestion product is ligated in a metal bath using T4 DNA ligase to obtain a ligation product;

[0259] (3) Transformation: The ligation product was transformed into DH5α competent cells, added to LB liquid culture medium and cultured for about 30 min, spread on ampicillin-resistant LB solid culture medium plates, and cultured for 12 hours; and

[0260] (4) Screening: Identify whether the MG7 mutant plasmid is successfully connected, and screen to obtain the mutant plasmid that is successfully connected.

[0261] In the present invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 30" includes ±5% of 30, or from 28.5 to 31.5.

[0262] In a preferred embodiment, the temperature of the metal bath is about 16°C.

[0263] In the present invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 16" includes ±5% of 16, or from 15.2 to 16.8.

[0264] In a preferred embodiment, the LB solid medium is an ampicillin-resistant LB solid medium.

[0265] In a preferred embodiment, the culture temperature is about 37°C.

[0266] In the present invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 37" includes ±5% of 37, or from 35.15 to 38.85.

[0267] In a preferred embodiment, the reverse genetics procedure comprises the following steps:

[0268] (i) co-transfecting the successfully connected mutant plasmid and the helper plasmid into BHK-21 cells, culturing, freezing and thawing, and filtering to obtain a cell culture; and

[0269] (ii) inoculating the cell culture into chicken embryos, incubating the cells, and collecting the chicken embryo allantoic fluid with a positive hemagglutination test result to obtain the genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I.

[0270] In a preferred embodiment, the helper plasmid is pBSK-NP, pBSK-P and pBSK-L.

[0271] In a preferred embodiment, the BHK-21 cells are BHK-21 cells pre-infected with the recombinant poxvirus VVT7.

[0272] In the present invention, when the multiplicity of infection, time, or other values ​​or parameters are expressed as a range, a preferred range, or a range defined by a series of upper preferred values ​​and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pairing of any range upper limit or preferred value with any range lower limit or preferred value, regardless of whether the range is disclosed separately. For example, when the range "0.001-0.1" is disclosed, the described range should be interpreted as including the range "0.001-0.1", "0.001-0.08", "0.001-0.06", "0.001-0.04", "0.001-0.02", "0.02-0.1", "0.02-0.08", "0.02-0.06", "0.02-0.04", "0.04-0.1", "0.04-0.06", "0.06-0.1", "0.06-0.08", "0.08-0.1", etc. When a numerical range is described herein, unless otherwise indicated, that range is intended to include the endpoints and all integers and fractions within that range.

[0273] In a preferred embodiment, the multiplicity of infection of the recombinant poxvirus VVT7 is 0.001-0.1 MOI, such as about 0.01 MOI.

[0274] In the present invention, "about" refers to a value within the range of ±5% of a specific value. For example, "about 0.01" includes ±5% of 0.01, or from 0.0095 to 0.0105.

[0275] In a preferred embodiment, the pre-infection time is 0.5 to 1.5 hours, such as about 1 hour.

[0276] In the present invention, "about" refers to a value within the range of ±5% of a specific value. For example, "about 1" includes ±5% of 1, or from 0.95 to 1.05.

[0277] In a preferred embodiment, the culture time is 48 to 96 hours, such as about 72 hours.

[0278] In the present invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 72" includes ±5% of 72, or from 68.4 to 75.6.

[0279] In a preferred embodiment, the culture temperature is about 37°C.

[0280] In the present invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 37" includes ±5% of 37, or from 35.15 to 38.85.

[0281] In a preferred embodiment, the culture container contains 5% CO 2 Cell culture incubator.

[0282] In a preferred embodiment, the freeze-thaw cycle is repeated once.

[0283] In a preferred embodiment, the pore size of the filter is 0.22 μm.

[0284] In a preferred embodiment, the chicken embryo is a 9-11 day old SPF chicken embryo.

[0285] In a preferred embodiment, the incubation time is 2 to 4 days, such as about 3 days.

[0286] In the present invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 3" includes ±5% of 3, or from 2.85 to 3.15.

[0287] According to another aspect of the present invention, there is provided a use of the above-mentioned genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I in preparing a vaccine.

[0288] In a preferred embodiment, the vaccine is a vaccine that has a protective effect against Newcastle disease caused by genotype VII.

[0289] In a preferred embodiment, the vaccine is an avian vaccine.

[0290] In a preferred embodiment, the poultry is chicken.

[0291] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions or conditions recommended by the manufacturer.

[0292] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the methods of the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0293] The above features mentioned in the present invention or the features mentioned in the embodiments can be combined in any way. All the features disclosed in this patent specification can be used in combination with any combination form, and each feature disclosed in the specification can be replaced by any alternative feature that can provide the same, equal or similar purpose. Therefore, unless otherwise specified, the disclosed features are only general examples of equal or similar features.

[0294] Example

[0295] 1. Materials and methods

[0296] 1.1 Plasmids and cells

[0297] pCAGGS-MG7-cDNA whole genome plasmid (MG7 strain F protein cleavage site has mutated to La Sota strain F protein cleavage site, and NP protein 443-460 positions lack 18 amino acids); three auxiliary plasmids pBSK-NP, pBSK-P, pBSK-L and BHK-21F cells are all preserved by our laboratory.

[0298] 1.2. Viruses, bacteria and experimental animals

[0299] The recombinant poxvirus VVT7 was amplified and preserved by our laboratory; the competent Escherichia coli DH5α was purchased from Dalian Bao Biotechnology Co., Ltd.; SPF chicken embryos and one-day-old SPF chickens were purchased from Beijing Boehringer Ingelheim Co., Ltd.

[0300] 1.3 Primer design and synthesis

[0301] The corresponding mutation primers were designed based on the pCAGGS-MG7-cDNA whole genome plasmid using biological software such as Oligo7 (as shown in Table 1).

[0302] Table 1 Primer information

[0303] Primer name Primer sequence (5′-3′) rMG7-F-N471A-F GAACTTGGAAACGTCGCGAATTCAATCAGCAATGCC rMG7-F-N471A-R GGCATTGCTGATTGAATTCGGCGACGTTTCCAAGTTC rMG7-HN-G256E-F GTGCTCTAAGGTCACAGAAACTGAAGAGGAGGATT rMG7-HN-G256E-R AATCCTCCTCTTCAGTTTCTGTGACCTTAGAGCAC rMG7-L-V1291I-F CAGAGTGTCGCCTTACATACACATATCCAATGATT rMG7-L-V1291I-R AATATTGGATATGTGTATGTAAGGCGACACTCTG

[0304] 1.4. Construction of MG7 mutant plasmid

[0305] Using the pCAGGS-MG7-cDNA whole genome plasmid as a template, site-directed mutagenesis was performed on the different amino acid sites of each structural protein of the MG7 strain. The specific method is as follows: first, PCR amplify the upstream and downstream DNA fragments of the mutation site, and then gel-recover the upstream and downstream DNA fragments and mix them in equal molar amounts as templates, and overlap PCR amplify the full-length DNA mutation fragment (Table 2 and Table 3). The full-length DNA mutation fragment and the pCAGGS-MG7-cDNA whole genome plasmid were double-digested, and the plasmid and target fragment after double digestion were recovered by gel. The double-digested plasmid and the fragment were connected in a 16°C metal bath overnight using T4DNA ligase. The ligation product was transformed into DH5α competent cells, and after adding 500μL LB liquid culture medium and culturing at 37°C for 30min, an appropriate amount of culture solution was applied to LB solid culture medium plate (ampicillin resistance) and cultured at 37°C overnight. Monoclonal colonies were picked from the solid plate and inoculated into 5mL LB liquid culture medium (ampicillin resistance) and cultured at 37°C overnight. After the culture is completed, a small amount of MG7 mutant plasmid is extracted, and nucleic acid electrophoresis is used to identify whether the MG7 mutant plasmid is successfully connected. The MG7 mutant plasmid suspected to be successfully connected is sent to the company for sequencing, and the positive plasmid is used to rescue the MG7 mutant virus.

[0306] Table 2 PCR reaction system

[0307] Reagents Volume (50 μL) PrimeStar DNA Polymerase 0.5μL 5× PrimeStar Buffer 10μL dNTP solution 4μL Upstream primer 1.5μL Downstream primer 1.5μL DNA template (25ng / μL) 1μL <![CDATA[ddH 2 The]]> Make up to 50 μL

[0308] Table 3 Site-directed mutagenesis PCR program

[0309]

[0310]

[0311] 1.5. MG7 mutant virus rescue

[0312] When the BHK-21F cell density in the cell plate was about 70%, the cell culture supernatant was discarded, 1 mL of Opti-MEM was added, and the recombinant poxvirus VVT7 (0.01 MOI) was used to pre-infect BHK-21F cells for 1 h. The MG7 mutant plasmid and three auxiliary plasmids (pBSK-NP, pBSK-P and pBSK-L) were co-transfected into BHK-21 cells, and the transfected cell plates were placed at 37°C with 5% CO 2 Culture in a cell culture incubator for 72 hours. After freezing and thawing the cells in the cell plate repeatedly once, filter the cell culture with a 0.22μm filter and inoculate all of them into 9-11-day-old SPF chicken embryos. Place the wax-sealed SPF chicken embryos in a 37℃ incubator for another 3 days. After 3 days of incubation, draw the chicken embryo allantoic fluid for HA test, collect the chicken embryo allantoic fluid with positive HA test results, and sequence and identify.

[0313] 1.6. Genetic stability test of MG7 mutant virus

[0314] Dilute the MG7 mutant virus 10% in sterile PBS. 5 After the 5th, 10th and 15th generations of MG7 mutant virus RNA were extracted according to the instructions of the viral RNA extraction kit, and the DNA fragment containing the mutation site was amplified by RT-PCR. The target fragment was recovered by gel and sent to the company for sequencing. The sequencing results were analyzed using SeqMan software to verify the genetic stability of the MG7 mutant virus.

[0315] 1.7. Virulence determination of MG7 mutant virus

[0316] Referring to the WOAH standard, the virulence of the MG7 mutant virus was determined by the two indicators of MDT and ICPI.

[0317] MDT assay: First, the MG7 mutant virus allantoic fluid was diluted 10 times in a row, and then 10 -9 ~10 -6 The diluted virus solution was inoculated into 9-11 day old SPF chicken embryos, and finally the SPF chicken embryos were placed in a 37℃ incubator for 7 days. The embryos were illuminated twice a day, and dead embryos within 24 hours were discarded. The death time of each chicken embryo was recorded, and the MDT value of the mutant virus was calculated. The NDV virulence determination criteria are as follows: the MDT of weak strains is greater than 90 hours, the MDT of medium virulence strains is between 60 hours and 90 hours, and the MDT of strong strains is less than 60 hours.

[0318] ICPI determination: First, dilute the MG7 mutant virus allantoic fluid 10 times, then inoculate the virus solution into the skull of 1-day-old chicks, 50 μL / chicken, 10 chicks per group, observe the status of the chicks every day and score them (normal chickens: 0 points; diseased chickens: 1 point; dead chickens: 2 points), observe for a total of 8 days, and finally calculate the ICPI value of the mutant virus. The NDV virulence determination criteria are as follows: the ICPI of weak strains is less than 0.7, the ICPI of medium strains is between 0.7 and 1.5, and the ICPI of strong strains is greater than 1.60.

[0319] 1.8. Immunization of SPF chickens with attenuated vaccines and protection against virus infection

[0320] Four-week-old SPF chickens were randomly divided into 6 groups, each with 16 chickens. MG7 strain, three MG7 mutant viruses and La Sota strain were immunized via nose and eye drops (10 7 EID 50 / 100μL / bird) once, and the PBS control group was inoculated with 100μL sterile PBS in the same way. Blood was collected from the subwing vein of SPF chickens at 1, 2 and 3 weeks after immunization, and serum was separated. NDV-97 strain was used at 10 / bird on the 21st day after immunization of SPF chickens with attenuated vaccine. 5 EID 50 The SPF chickens were challenged with 100 μL of the drug via intramuscular injection. The chickens were observed for 14 days and the physiological conditions and mortality of the SPF chickens were recorded (as shown in Table 4).

[0321] Table 4 Immunization and challenge scheme

[0322] strain Vaccination dose Vaccination route Blood collection time Challenge dose rMG7-F-N471A <![CDATA[10 7 EID 50 / 100μL / wing]]> Nose and eye drops Week 1, 2, 3 <![CDATA[10 5 EID 50 / only]]> rMG7-HN-G256E <![CDATA[10 7 EID 50 / 100μL / wing]]> Nose and eye drops Week 1, 2, 3 <![CDATA[10 5 EID 50 / only]]> rMG7-L-V1291I <![CDATA[10 7 EID 50 / 100μL / wing]]> Nose and eye drops Week 1, 2, 3 <![CDATA[10 5 EID 50 / only]]> MG7 <![CDATA[10 7 EID 50 / 100μL / wing]]> Nose and eye drops Week 1, 2, 3 <![CDATA[10 5 EID 50 / only]]> LaSota <![CDATA[10 7 EID 50 / 100μL / wing]]> Nose and eye drops Week 1, 2, 3 <![CDATA[10 5 EID 50 / only]]> PBS Nose and eye drops Week 1, 2, 3 <![CDATA[10 5 EID 50 / only]]>

[0323] 1.9. Detection of the replication ability of weak virus strains in vivo after immunization of SPF chickens

[0324] On the 2nd, 4th, 6th, 8th and 10th day after immunization of SPF chickens, the laryngeal and cloacal swabs of SPF chickens in each vaccine immunization group were collected and placed in 500 μL of PBS containing double antibodies, and then vigorous shaking and mixing were allowed to stand for 30 minutes. The supernatant of the swab extract was inoculated into 9- to 11-day-old chicken embryos, and 3 pieces were inoculated in each dilution gradient, 100 μL / piece. After incubation in a 37°C incubator for 48 hours, the HA titer of the chicken embryo allantoic fluid was determined. If the HA titer was ≥1:16, the swab was judged to be detoxified, and the detoxification rate was finally calculated.

[0325] 1.10. Detection of HI antibody titer after immunization of SPF chickens

[0326] First, add 25 μL PBS to the hemagglutination plate, then add 25 μL of the detection antigen and dilute it 2-fold continuously, then add 25 μL PBS, and finally add 25 μL 1% chicken red blood cell suspension, shake and mix, let it stand for 15 minutes, and read the HA titer. Prepare 4 units of antigen according to the HA titer of the detection antigen, first add 25 μL PBS to the hemagglutination plate, then add 25 μL of the serum to be tested and dilute it 2-fold continuously, then add 25 μL 4 units of detection antigen, shake and mix, let it stand for 15 minutes, and finally add 25 μL 1% chicken red blood cell suspension, shake and mix, let it stand for 15 minutes, and read the HI titer of the serum to be tested.

[0327] 1.11. Detection of toxin excretion level in SPF chickens after challenge

[0328] Swabs of SPF chickens in each vaccine immunization group were collected on the 3rd, 5th, 7th, 9th and 11th days after SPF chickens were challenged with the virus, and were placed in 1mL of PBS containing double antibodies, mixed vigorously and allowed to stand for 30 minutes. The supernatant of the swab extract was diluted 10 times continuously and inoculated into 9- to 11-day-old chicken embryos, with 3 eggs inoculated in each dilution gradient, 100μL / egg. After incubation in a 37℃ incubator for 48h, the HA titer of the chicken embryo allantoic fluid was determined. If the HA titer was ≥1:16, the swab was judged to be detoxified, and the virus content of the swab was finally calculated.

[0329] 1.12. Detection of virus in various organs of SPF chickens after infection

[0330] On the 3rd and 5th days after SPF chickens were immunized with the virus, 3 SPF chickens were randomly and painlessly killed in each group, and 6 organs including liver, spleen, kidney, bursa of Fabricius, pancreas and small intestine were collected, and PBS containing double antibodies was added, and then 2 high-pressure sterilized steel beads were added, and the tissue was homogenized at low temperature for 10 minutes using a high-throughput tissue grinder. After the homogenization, the centrifugal supernatant was diluted 10 times continuously and inoculated into 9-11-day-old chicken embryos, and 3 pieces were inoculated in each dilution gradient, 100μL / piece. After incubation in a 37℃ incubator for 48h, the HA titer of the chicken embryo allantoic fluid was determined. If the HA titer was ≥1:16, the organ was judged to contain the virus, and the virus content of the organ was finally calculated.

[0331] 2. Results and Analysis

[0332] 2.1. Rescue and growth characteristics analysis of MG7 mutant virus

[0333] Using the pCAGGS-MG7-cDNA whole genome plasmid as a template, PCR was used to amplify the full-length DNA fragment containing the mutation site. After double restriction digestion, ligation, transformation and sequencing identification, this study successfully constructed multiple MG7 mutant plasmids.

[0334] The allantoic fluid of chicken embryos with positive HA test results was collected, the rescued virus RNA was extracted, and the target fragment containing the amino acid site mutation was amplified by RT-PCR and sent to the company for sequencing. The sequencing results showed that the amino acid site mutation of the rescued MG7 mutant virus was successful.

[0335] The MG7 mutant virus was serially passaged in 9- to 11-day-old chicken embryos. By measuring the HA titer and virus titer of the MG7 mutant virus, this study finally screened out three mutant viruses with better growth performance than the MG7 strain and named them rMG7-F-N471A, rMG7-HN-G256E and rMG7-L-V1291I (as shown in Table 5).

[0336] Table 5 Analysis of growth characteristics of rescued MG7 mutant viruses in chicken embryos

[0337]

[0338]

[0339] 2.2 Analysis of genetic stability of MG7 mutant virus

[0340] The RNA of the 5th, 10th and 15th generation viral allantoic fluid of rMG7-F-N471A, rMG7-HN-G256E and rMG7-L-V1291IMG7 mutant viruses was extracted, and the mutant fragments were amplified by RT-PCR and sequenced. The sequencing results showed that the three MG7 mutant viruses rMG7-F-N471A, rMG7-HN-G256E and rMG7-L-V1291I were continuously passaged in 9-11 day old SPF chicken embryos to the 15th generation, and the mutation sites could be stably inherited without reversion mutation (such as Figure 1 , Figure 2 and Figure 3 shown).

[0341] 2.3. Virulence analysis of MG7 mutant virus

[0342] The MDT and ICPI values ​​of the three MG7 mutant viruses were determined according to the WOAH standard. The experimental data showed that the MDT and ICPI values ​​of the three MG7 mutant viruses rMG7-F-N471A (MDT≥120h, ICPI=0.13), rMG7-HN-G256E (MDT≥120h, ICPI=0.02) and rMG7-L-V1291I (MDT≥120h, ICPI=0) all met the requirements of NDV attenuated strains (as shown in Table 6).

[0343] Table 6 Virulence analysis of MG7 mutant viruses

[0344]

[0345] 2.4 Analysis of the replication ability of MG7 mutant virus in vivo after immunization of SPF chickens

[0346] The replication ability of MG7 mutant virus in SPF chickens was tested. The results showed that all attenuated strains could replicate in SPF chickens, and the shedding rate of virus in the larynx and cloaca was the highest on days 4 and 6 after immunization; among them, the shedding rate of the rMG7-F-N471A vaccine immunization group was higher than that of the MG7 vaccine immunization group. Therefore, the replication ability of the rMG7-F-N471A mutant strain in SPF chickens was better than that of the MG7 strain (as shown in Table 7).

[0347] Table 7 Results of toxin excretion test in SPF chickens after immunization with attenuated vaccine

[0348]

[0349] 2.5. Detection of HI antibody titer after immunization of SPF chickens

[0350] The MG7 strain was used as the detection antigen to determine the HI antibody titer in the serum of SPF chickens in each vaccine immunization group at different time points after immunization. The results showed that the HI antibody titer in the serum of SPF chickens in each vaccine immunization group increased continuously after the start of immunization and reached the highest at the third week. The HI antibody titer in the MG7 and its mutant virus vaccine immunization group was between 1:16 and 1:32. Compared with the MG7 vaccine immunization group, there was no significant difference in the HI antibody titer in the rMG7-F-N471A, rMG7-HN-G256E and rMG7-L-V1291I vaccine immunization groups ( Figure 4 ).

[0351] 2.6. Detection of toxin excretion level and toxin carrying status of various organs in SPF chickens after challenge

[0352] The NDV-97 strain was used to challenge the SPF chickens 21 days after the attenuated vaccine was immunized. The results showed that all the SPF chickens in the PBS control group became ill and died within 6 days, the protection rate of the SPF chickens in the MG7 vaccine group was 90%, and the protection rate of the SPF chickens in the other vaccine groups was 100% (such as Figure 5 As shown). Swab titration results showed that compared with the MG7 and La Sota vaccine immunization groups, no virus was detected in the laryngeal and cloacal swabs of SPF chickens in the rMG7-F-N471A and rMG7-HN-G256E vaccine immunization groups, while the swab shedding rate of the rMG7-L-V1291I vaccine immunization group was 20%. This shows that the rMG7-F-N471A mutant and the rMG7-HN-G256E mutant can provide 100% protection for SPF chickens as attenuated vaccines and can effectively prevent SPF chickens from shedding virus (as shown in Table 8).

[0353] Virus titration was performed on the collected organs. The organ titration results showed that the virus could be detected in all organs of the PBS control group; the virus could only be isolated in the bursa of Fabricius in the rMG7-F-N471A and rMG7-HN-G256E vaccine immunization groups; the virus could be isolated in the spleen, pancreas and bursa of Fabricius in the rMG7-L-V1291I vaccine immunization group; the virus could be isolated in the pancreas, bursa of Fabricius and kidney in the MG7 vaccine immunization group; the virus was distributed in the liver, spleen, pancreas and bursa of Fabricius in the La Sota vaccine immunization group. The above results show that compared with the MG7 and La Sota vaccine immunization groups, the rMG7-F-N471A mutant and the rMG7-HN-G256E mutant as attenuated vaccines can effectively inhibit the replication of the virus in the organs of SPF chickens (as shown in Table 9).

[0354] Table 8 Results of virus shedding after challenge with NDV-97 strain in SPF chickens immunized with attenuated vaccine for 21 days

[0355]

[0356] Among them, “-” means that all SPF chickens died.

[0357] Table 9 Distribution of virus in different tissues of SPF chickens immunized with attenuated vaccine after challenge with NDV-97 strain for 21 days

[0358]

[0359]

[0360] The embodiments of the present invention are described in detail above. Specific examples are used herein to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, changes or deformations made by those skilled in the art based on the ideas of the present invention, the specific implementation methods and application scope of the present invention, all belong to the scope of protection of the present invention. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. A genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I, characterized in that: Its deposit number is CGMCC No.46291.

2. A genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I, characterized in that: The full gene nucleotide sequence of the vaccine strain is shown in SEQ ID No: 1; Among them, the valine (V) at position 1291 of the L protein was replaced by isoleucine (I); Preferably, the vaccine strain has a hemagglutination titer of about 9 log2 HA and a viral titer of about 10 9.5 EID 50 / mL.

3. A method for constructing the genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I according to claim 1 or 2, characterized in that: The construction method comprises the following steps: (a) Using the pCAGGS-MG7-cDNA whole genome plasmid as a template, site-directed mutagenesis was performed on the different amino acid sites of the structural proteins of the MG7 strain to obtain a mutant plasmid; (b) The mutant plasmid is subjected to reverse genetic manipulation to construct the genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I.

4. The construction method according to claim 3, characterized in that: In the pCAGGS-MG7-cDNA full genome plasmid, the F protein cleavage site of the MG7 strain has mutated to the F protein cleavage site of the La Sota strain, and 18 amino acids are missing from positions 443 to 460 of the NP protein of the MG7 strain.

5. The construction method according to claim 3, characterized in that: The upstream primer used for the site-directed mutagenesis was 5'-CAGAGTGTCGCCTTACATACACATATCCAATGATT-3'; Preferably, the downstream primer used for the site-directed mutagenesis is 5'-AATCATTGGATATGTGTATGTAAGGCGACACTCTG-3'.

6. The construction method according to claim 3, characterized in that: The site-directed mutagenesis comprises the following steps: (1) PCR amplification: amplify the DNA fragments upstream and downstream of the mutation site, recover the upstream and downstream DNA fragments by gel, mix them in equimolar amounts as templates, amplify the full-length DNA mutation fragment, and obtain the amplified product; (2) Ligation: The amplified product and the pCAGGS-MG7-cDNA full genome plasmid are double-digested, gel recovery is performed to obtain a digestion product, and the digestion product is ligated in a metal bath using T4 DNA ligase to obtain a ligation product; (3) Transformation: The ligation product was transformed into DH5α competent cells, added to LB liquid culture medium and cultured for about 30 min, spread on ampicillin-resistant LB solid culture medium plates, and cultured for 12 hours; as well as (4) Screening: Identify whether the MG7 mutant plasmid is successfully connected, and screen the mutant plasmids that are successfully connected; Preferably, the temperature of the metal bath is about 16°C; Preferably, the LB solid medium is an ampicillin-resistant LB solid medium; Preferably, the temperature of the culturing is about 37°C.

7. The construction method according to claim 3, characterized in that: The reverse genetics operation comprises the following steps: (i) co-transfecting the successfully connected mutant plasmid and the helper plasmid into BHK-21 cells, culturing, freezing and thawing, and filtering to obtain a cell culture; and (ii) inoculating the cell culture into chicken embryos, incubating, and collecting chicken embryo allantoic fluid with a positive hemagglutination test result to obtain the genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I.

8. The construction method according to claim 7, characterized in that: The auxiliary plasmids are pBSK-NP, pBSK-P and pBSK-L; Preferably, the BHK-21 cells are BHK-21 cells pre-infected with the recombinant poxvirus VVT7; More preferably, the multiplicity of infection of the recombinant poxvirus VVT7 is 0.001 to 0.1 MOI, such as about 0.01 MOI; More preferably, the pre-infection time is 0.5 to 1.5 h, such as about 1 h; More preferably, the culturing time is 48 to 96 hours, for example about 72 hours; More preferably, the culture temperature is about 37°C; More preferably, the culture container is a cell culture incubator containing 5% CO2; More preferably, the number of freeze-thaw cycles is 1; More preferably, the pore size of the filter is 0.22 μm; Preferably, the chicken embryo is a 9-11 day old SPF chicken embryo; Also preferably, the incubation time is 2 to 4 days, such as about 3 days.

9. Use of the genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I according to claim 1 or 2 in preparing a vaccine.

10. The use according to claim 9, characterized in that The vaccine is a vaccine that has a protective effect against Newcastle disease caused by genotype VII; Preferably, the vaccine is an avian vaccine; More preferably, the poultry is chicken.

Images