Application of chitin in the early stage of Plasmodiophora brassicae infection for the prevention and control of crucifer root lesion

Abstract

The application provides application of chitin in early infection of plasmodiophora brassicae in prevention and control of brassica root tumour disease, and is based on the technology and application of blocking chitin synthesis of zoosporangium in early infection of plasmodiophora brassicae to prevent and control brassica root tumour disease. It is proved by experiments that the zoosporangium in early infection of plasmodiophora brassicae contains chitin, and the chitin is synthesized by plasmodiophora brassicae chitin synthase genes PbCHS3 and PbCHS7, thereby providing a new target for prevention and control of brassica root tumour disease. Through expression of PbCHS3 and PbCHS7 silencing vectors, exogenous small RNA treatment or application of polyoxin, which can block chitin synthesis, in arabidopsis and rape, brassica root tumour disease can be prevented and controlled efficiently, and key technology and method for prevention and control of brassica root tumour disease are provided.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and particularly relates to genes. PbCHS 3 and genes PbCHS Application of 7 and its homologous sequences in the control of clubroot disease in cruciferous crops. Background Technology

[0002] Cruciferous crops are diverse and bring huge economic benefits to the global agricultural industry. Currently, common economic crops in the cruciferous family include rapeseed (…). Brassica napus ), cabbage ( B . Brassica rapa ), cabbage ( B . Brassica oleracea ), mustard greens ( B . Brassica juncea ) and radish ( Raphanus sativus Oils such as edible oil, vegetables, animal feed, and industrial oil are important sources of human edible oil, vegetables, animal feed, and industrial oil, and are also one of the world's most important economic crops.

[0003] Clubroot disease of cruciferous plants is caused by the obligate, live parasitic protozoan *Plasmodiophora* (fungi). Plasmodiophora brassicae Brassica rapa Plasmodium falciparum is a global soil-borne disease that can affect almost all cruciferous crops. It is a major disease affecting crops such as rapeseed, cabbage, Chinese cabbage, and radish. Currently, in some parts of the world, the disease affects more than 3.2 million hectares annually, impacting more than one-third of the total cruciferous crop planting area. Average yield losses reach 20% to 30%, and in severe cases, fields suffer complete crop failure, resulting in economic losses of hundreds of billions of yuan annually. Furthermore, the fungus survives in the soil as dormant spores within diseased root debris and remains infectious for over 10 years, making control extremely difficult.

[0004] Extensive research has been conducted on methods for controlling clubroot disease, but a truly effective cure has yet to be found. Discovering and utilizing clubroot-resistant genes to breed resistant varieties is considered the most economical and effective measure for controlling clubroot. Clubroot fungi exhibit physiological race differentiation, and existing clubroot-resistant loci mainly originate from turnips (Turnip spp.). PbCHSssp. rapifera, and the resistance is dominant and Brassica-specific, and the resistant varieties are lost in about three years after their application in production, which makes the breeding cycle long and far from meeting the production demand. In addition, the immune-resistant host disease resistance gene cannot block the initial infection of the plasmodiophora, which leads to a large number of secondary zoospores in the host epidermal cells of the resistant plants, and increases the risk of host resistance loss and spread of the plasmodiophora. Since the plasmodiophora belongs to protists, its species classification status is unique, and most of the existing fungicides for oomycetes, fungi and bacteria are ineffective for the plasmodiophora, and the fungicides that can be used for the prevention and treatment of the plasmodiophora in production are extremely scarce. With the continuous expansion of the planting area of cruciferous crops, it is urgent to seek a new method and new technology for the prevention and control of the plasmodiophora of cruciferous vegetables. SUMMARY

[0005] Therefore, the purpose of the present application is to provide key targets of the plasmodiophora for improving the resistance of cruciferous crops to the plasmodiophora, and targeted inhibition of the targets can achieve the improvement of the resistance of cruciferous crops to the plasmodiophora, which provides new key targets and technical means for the improvement of the resistance of cruciferous crops to the plasmodiophora and the persistent and efficient prevention and control.

[0006] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0007] The present application provides the application of blocking the chitin synthesis of zoospore cysts in the early infection stage of the plasmodiophora in the prevention and control of the plasmodiophora of cruciferous crops, and the cruciferous crops include rape, Chinese cabbage, cabbage, mustard and radish.

[0008] The present application also provides the application of the gene PbCHS 3 and the gene PbCHS 7 and their homologous sequences in the prevention and control of the plasmodiophora of cruciferous crops, and the cruciferous crops include rape, Chinese cabbage, cabbage, mustard and radish.

[0009] The present application also provides the application of silencing and / or reducing the expression of the gene PbCHS 3 and the gene PbCHS 7 and their homologous sequences in the prevention and control of the plasmodiophora of cruciferous crops, and the cruciferous crops include rape, Chinese cabbage, cabbage, mustard and radish.

[0010] The present application also provides the application of the gene PbCHS 3 and the gene PbCHS 7 and their homologous sequences in the chitin synthesis of the zoospore cysts of the plasmodiophora in the prevention and control of the plasmodiophora of cruciferous crops, and the cruciferous crops include rape, Chinese cabbage, cabbage, mustard and radish.

[0011] In the present application, the genePbCHS 3 is shown in SEQ ID NO. 1 :

[0012]

[0013] the gene PbCHS The nucleotide sequence of 7 is shown as SEQ ID NO. 2:

[0014]

[0015] Based on this, the present application also protects nucleotide sequences having at least 50% homology with SEQ ID NO. 1 and SEQ ID NO. 2;

[0016] Preferably, nucleotide sequences having at least 70% homology with SEQ ID NO. 1 and SEQ ID NO. 2;

[0017] Further preferably, nucleotide sequences having at least 80% homology with SEQ ID NO. 1 and SEQ ID NO. 2;

[0018] Further preferably, nucleotide sequences having at least 85% homology with SEQ ID NO. 1 and SEQ ID NO. 2;

[0019] More preferably, nucleotide sequences having at least 90% homology with SEQ ID NO. 1 and SEQ ID NO. 2;

[0020] Most preferably, nucleotide sequences having at least 95% homology with SEQ ID NO. 1 and SEQ ID NO. 2.

[0021] The present application also provides a kit for preventing and controlling clubroot of cruciferous crops, the kit comprising primers for detecting genes PbCHS 3 and gene PbCHS 7, or interfering nucleotide fragments targeting genes PbCHS 3 and PbCHS 7 of Plasmodiophora brassicae:

[0022] The primers for detecting gene PbCHS 3 are as shown in SEQ ID NO. 3: CCAAGTACCCGAAGAAGCGT;

[0023] and SEQ ID NO. 4: CGTAGTCAGGATCCGGGTTG;

[0024] The primers for detecting gene PbCHS 7 are as shown in SEQ ID NO. 5: AGCGGAACTCGGAGGACTAT;

[0025] and SEQ ID NO. 6: CATGATCAGGTGCGTCAGGT;

[0026] The interfering nucleotide fragments targeting genes PbCHS 3 and PbCHS 7 of Plasmodiophora brassicae are as shown in SEQ ID NO. 7:

[0027] CAGCGCACCTACAAGTCGATGCCGACGAAGCCATTGCTCCTGTTCATCGATTCCGACATTGAGCTGGACGAGACCGCCATGGCGCACTTCGTGTACGACATGAACAGGAACAAGGGCGTGACGCGCGAGGCGCTGACGGGCCTGATCACGTGCAAGACGGCCGGCACGTACAGCTTCTACAAGCTGATGCAGGACAGCGAGTATATCGAGTCGCAGATGTTGCAGAGGAACACGGAGGATTACCTCGGGGCGGTGTCCTGCCTGCCCGGTGCGCTGACCATGGTGCGGTTCGAGGCGCTGGAGGCGGTCGCGCCGACCTACTTTGGGAAGATGACCGCCGAGGACAACTTCGACTTCAACAGGACGCACCTGGGCGAGGACCGGTACCTGACGCACCTGCTGATGGAATCACGCACCGTCAAGTACCGG.

[0028] In the present application, the above-mentioned kit can further comprise a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacteria.

[0029] The present application also provides a method for preventing and controlling clubroot of cruciferous crops, which comprises: reducing the expression of genes PbCHS 3 and genes PbCHS 7 by externally applying dsRNA of genes PbCHS 3 and genes PbCHS 7, so that the biomass of Plasmodiophora brassicae is reduced.

[0030] The primer of the dsRNA is as shown in SEQ ID NO. 8:

[0031] TAATACGACTCACTATAGGGCAGCGCACCTACAAGTCGATGC;

[0032] and SEQ ID NO. 9:

[0033] CCCTATAGTGAGTCGTATTACCGGTACTTGACGGTGCGTGAT.

[0034] The application further provides a biological prevention and control method for the clubroot of cruciferous crops, which comprises the following steps: connecting a nucleotide fragment for host-induced gene silencing into a silencing expression vector to obtain a host silencing vector, transforming the host silencing vector into Agrobacterium, transforming a plant by using a inflorescence dipping method, and obtaining a transgenic plant with decreased expression of genes PbCHS 3 and genes PbCHS 7.

[0035] The nucleotide fragment for host-induced gene silencing is shown in SEQ ID NO. 7.

[0036] The application provides an application of polyoxin in interfering with the biosynthesis of chitin in the cell wall of the clubroot pathogen of cruciferous crops.

[0037] The application further provides an application of polyoxin in preventing and controlling the clubroot of cruciferous crops.

[0038] The application further provides a chemical prevention and control method for the clubroot of cruciferous crops, which comprises the following step: externally applying polyoxin to destroy chitin synthesis, so that the disease index of the clubroot is reduced.

[0039] Compared with the prior art, the application has the following beneficial effects:

[0040] The application identifies that the zoosporangium, a key infection structure for the initial infection of the clubroot pathogen Plasmodiophora brassicae, contains chitin, and it is clear that the chitin is synthesized by genes PbCHS 3 and PbCHS 7, which not only enriches the theoretical understanding of the biology of the clubroot pathogen, but also provides a theoretical basis for the research and development of precise prevention and control technologies for the clubroot.

[0041] The application provides various improved technologies for the clubroot resistance of cruciferous crops, i.e., the chitin synthesis of the zoosporangium of the clubroot pathogen is inhibited by externally applying exogenous dsRNA, host-induced gene silencing and externally applying polyoxin, the initial infection of the clubroot pathogen is blocked, and the persistent and efficient clubroot resistance of cruciferous crops is achieved, which provides a brand-new approach for the improvement of the clubroot resistance of cruciferous crops and has a broad application prospect.

[0042] The application creates the cruciferous crops for targeting silencing Figure 1 3 and Figure 2 7, which has broad-spectrum resistance to different races of the clubroot pathogen and is resistant to the clubroot in a persistent and efficient manner, and provides key germplasm resources for the improvement of the clubroot resistance of cruciferous crops, and has great application potential, economic benefits and social benefits. BRIEF DESCRIPTION OF DRAWINGS

[0043] PbCHSConfocal microscopy images of dormant spores in Arabidopsis cortical cells 25 days after inoculation and zoosporangia in root hair cells of Arabidopsis 8 days after inoculation; white arrows indicate the fluorescence signal of zoosporangia, scale bar is 10 µm;

[0044] PbCHS For the identification and characterization of chitin synthases in *Plasmodiophora*; A. Evolutionary analysis of chitin synthases in *Plasmodiophora*; B. Expression and functional domain analysis of chitin synthases in *Plasmodiophora*; C. PbCHS 3 and PbCHS 7. Quantitative analysis of gene expression; D. Tertiary structure analysis of PbCHS3 and PbCHS7 proteins; E. Figure 3 3 and PbCHS 7-gene multiple sequence expression analysis;

[0045] PbCHS External targeted silencing PbCHS 3 and PbCHS A survey of diseases in Arabidopsis plants with dsRNA levels of 7; A. Figure 4 3 and PbCHS 7. Expression level analysis; B. Investigation of Arabidopsis root swelling; C. Disease index investigation; D. Biomass of Plasmodium falciparum; E. Analysis of the number of zoosporangia per centimeter in Arabidopsis root tissue;

[0046] PbCHS For targeted silencing based on HIGS technology PbCHS 3 and PbCHS Disease survey of transgenic Arabidopsis thaliana after inoculation with different physiological races; A. Silent vector construction strategy; B. Figure 5 3 and PbCHS 7. Expression level analysis; C. Investigation of Arabidopsis root swelling; D. Disease index investigation; E. Investigation of clubroot biomass;

[0047] Root phenotypes of various Arabidopsis thaliana strains 25 days after inoculation with different physiological races of Plasmodium falciparum, with a scale bar of 1 cm;

[0048] PbCHS Targeted silencing based on HIGS technology PbCHS 3 and PbCHS A survey on clubroot resistance in genetically modified rapeseed; A. Figure 1 3 and Figure 2 7. Expression level analysis; B. Investigation of rapeseed root swelling; C. Disease index investigation; D. Investigation of clubroot biomass. Detailed Implementation

[0049] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0050] Example 1

[0051] The zoosporangium wall of *Plasmodiophora stearothermiae* is composed of chitin.

[0052] By labeling lipid droplets in *Plasmodiophora* with Nile Red (NR) and chitin with Calcofluor white (CFW) and Wheat Germ Agglutinin (WGA), the structure of dormant spores and zoosporangia of *Plasmodiophora* was successfully observed in the cortical cells of *Arabidopsis thaliana*. PbCHS Under confocal microscopy, dormant spores showed solid circular fluorescence in the NR channel, while exhibiting strong ring fluorescence in the CFW and WGA channels, indicating the presence of chitin in their walls. For zoosporangia, secondary zoospores in the formation stage showed irregular solid fluorescence in the NR channel, with the fluorescence signal weakening after release at maturity. The fluorescence signals of CFW and WGA highly overlapped in the merged image, confirming that chitin is a common component of both the dormant spore wall and the zoosporangia wall. This discovery provides an important target for understanding the biological characteristics of *Plasmodiophora* and developing new control strategies.

[0053] Example 2

[0054] Identification of chitin-synthetic genes in zoosporangia of *Plasmodiophora*

[0055] In organisms, the most crucial and final step in chitin synthesis is completed by chitin synthase (CHS). For a long time, CHS has been considered an ideal target for antifungal drugs, insecticides, and acaricides. Using homology comparison and a hidden Markov model, 16 CHSs (PbCHS1-PbCHS16) were identified in the *Plasmodiophora* genome. Phylogenetic tree construction using IQ-TREE revealed species-specific evolutionary events in *Plasmodiophora* CHS, indicating that they do not belong to the previously reported classes I-VII (…). PbCHS A). Using Pfam and TMHMM for domain prediction, all 16 CHSs of *Plasmophyton floccosum* contained typical CHS domains. Expression analysis revealed that, in addition to PbCHS 1. Figure 2 3 and PbCHS 7. Most genes are expressed at low levels during the dormant spore and infection stages. PbCHS C), where Figure 2 3 and PbCHS 7. Significantly upregulated expression during zoosporangium development ( PbCHS D). Predicting protein tertiary structure using AlphaFold. Candida albicans 3 and Figure 27Structure is similar to the reported and clearly functional Candida albicans (C. PbCHS ) Chitin synthase CaChs2, and the core region contains QXXEY, EDX, QRXRW motifs necessary for enzyme activity (D). PbCHS 3and Figure 2 7sequence similarity is 68.72% (E). These show that PbCHS 3and PbCHS 7are the key genes of chitin synthesis of Plasmodiophora paeoniae zoospore cysts. PbCHS 3and PbCHS 7are the key genes of chitin synthesis of Plasmodiophora paeoniae zoospore cysts.

[0056] PbCHS 3and PbCHS 7nucleotide sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.

[0057] The primers for detecting PbCHS 3gene expression are as follows:

[0058] SEQ ID NO. 3: CCAAGTACCCGAAGAAGCGT;

[0059] SEQ ID NO. 4: CGTAGTCAGGATCCGGGTTG;

[0060] The primers for detecting PbCHS 7gene expression are as follows:

[0061] SEQ ID NO. 5: AGCGGAACTCGGAGGACTAT;

[0062] SEQ ID NO. 6: CATGATCAGGTGCGTCAGGT.

[0063] Example 3

[0064] Evaluation of the effect of exogenous dsRNA silencing PbCHS3 3and PbCHS7 7on the control of plant galls

[0065] The dsRNA of the nucleotide fragment SEQ ID NO. 7 silencing PbCHS3 and PbCHS7 genes was synthesized in vitro using the T7 RNAi Transcription Kit of Nanjing Novozyme Biotech Co., Ltd. A blank control group and three test groups with dsRNA solution concentrations of 10 nmol / L, 20 nmol / L and 40 nmol / L were set up. The Plasmodiophora paeoniae strain used was No. 4 physiological race collected from Jishou City, Hunan Province. Two-week-old plants were used for Plasmodiophora paeoniae inoculation, and the inoculation amount was 106 Spores / strain were inoculated using a suspension of dormant spores of *Plasmodiophora*. dsRNA solution was applied at 2, 4, and 6 days post-inoculation. Eight days after inoculation, compared to the control, the *Plasmodiophora* spores in each treatment group... Figure 3 and Figure 3 The expression levels of these substances decreased significantly, with reductions of up to 82.18% and 75.58%, respectively. Figure 3 A). 25 days after inoculation, compared with the control, the degree of root swelling in each treatment group was ( Figure 3 B) Disease index ( Figure 3 C) and the biomass of root-knot bacteria decreased significantly ( PbCHS3 D), where the control efficacy was 9.67% in the 10 nmol / L treatment group, 32.26% in the 20 nmol / L treatment group, and 51.61% in the 40 nmol / L treatment group. Further research revealed that 8 days after inoculation, the number of zoosporangia in the 40 nmol / L treatment group was reduced by 60.49% compared to the control group ( PbCHS7 E). The above research results indicate that, PbCHS3 and PbCHS7 It is a key gene for the development of zoosporangia in *Plasmodiophora*, and its exogenous application can silence it. PbCHS and PbCHS The dsRNA has a good effect on the prevention and control of clubroot disease.

[0066] The primers for synthesizing dsRNA are as follows:

[0067] SEQ ID NO.8: TAATACGACTCACTATAGGGCAGCGCACCTACAAGTCGATGC;

[0068] SEQ ID NO.9: CCCTATAGTGAGTCGTATTACCGGTACTTGACGGTGCGTGAT.

[0069] Example 4

[0070] Host-Induced Gene Silencing (HIGS) technology for targeted silencing Figure 4 3 and Figure 4 Evaluation of the control efficacy of transgenic plants against clubroot disease

[0071] The nucleotide fragment used for host-induced gene silencing was ligated into the PBI121-RNAi-Bar silencing expression vector. Figure 4After sequencing confirmed to be correct, the vector was transformed into Agrobacterium GV3101 and transformed into Columbia-0 Arabidopsis thaliana using the inflorescence immersion method. Transgenic plants were screened based on herbicide resistance carried by the vector. Positive plants were further identified by PCR amplification. Two homozygous transgenic Arabidopsis lines, L1 and L2, were obtained. Inoculation with five different geographically sourced *Plasmodium* species showed significantly decreased expression levels of *PbCHS3* and *PbCHS7* in both transgenic lines compared to the control. Figure 4 B). A subsequent disease investigation was conducted, examining the root swelling of the two plant lines ( Figure 4 C), Disease index ( PbCHS The relative biomass of both D) and root-knot bacteria decreased ( PbCHS All samples (E) showed some resistance to clubroot disease from five different regions. These results indicate that the HIGS technology, based on targeted silencing of PbCHS3 and PbCHS7, endows plants with broad-spectrum resistance to clubroot disease.

[0072] The primers for identifying positive transgenic plants are as follows:

[0073] SEQ ID NO.10: CAGCGCACCTACAAGTCGATGC;

[0074] SEQ ID NO. 11: AACGACGGCCAGTGAATTCCC.

[0075] Example 5

[0076] Host-Induced Gene Silencing (HIGS) technology for targeted silencing PbCHS3 3 and PbCHS7 Evaluation of the control effect of genetically modified rapeseed on clubroot disease.

[0077] The constructed PBI121-RNAi-Bar silencing expression vector was used to transform the hypocotyls of rapeseed variety ZS11 using Agrobacterium-mediated transformation, resulting in two homozygous transgenic rapeseed lines, S1 and S2. The clubroot strain used was race 4 collected from Jishou City, Hunan Province. Eight days after inoculation with clubroot, compared to the control, the clubroot strain showed significantly higher levels of clubroot in the root tissues of both transgenic lines. Figure 5 and PbCHS3 The expression levels all decreased significantly. PbCHS7 A), of which the S1 strain PbCHS3 It decreased by 75.12%. PbCHS7 It decreased by 50.72%; S2 strain Figure 5 It decreased by 65.45%. Figure 5 The incidence rate decreased by 51.95%. A disease survey was conducted 25 days after inoculation, examining the root swelling of the two transgenic rapeseed lines. Figure 5 B) Disease index (​ C) and the biomass of P. thomsonii were significantly decreased (D), both of which showed medium-high resistance level to clubroot. The above results indicated that HIGS technology based on the targeted silencing of PbCHS3 and PbCHS7 conferred resistance to clubroot in Brassica napus. ​ D), both of which showed medium-high resistance level to clubroot. The above results indicated that HIGS technology based on the targeted silencing of PbCHS3 and PbCHS7 conferred resistance to clubroot in Brassica napus.

[0078] Example 6

[0079] Investigation of resistance to clubroot in Brassica napus by exogenous application of polyoxin

[0080] Polyoxin is a broad-spectrum antibiotic fungicide produced by Streptomyces achromogenes. It has good systemic translocation and mainly plays a role by interfering with the biosynthesis of chitin in the cell wall of the pathogen. Polyoxin is a safe pesticide with high efficiency, low toxicity and no environmental pollution, so it is widely used in the prevention and control of important diseases of food crops, special crops, fruits and vegetables. There is no report on the prevention and control of clubroot. Polyoxin 10% wettable powder produced by Japan Scientific Research Pharmaceutical Co., Ltd. was ordered and prepared into 500-fold and 1000-fold liquid, respectively. ZS11 rape was treated by root irrigation on the day of planting. ZS11 rape was inoculated with Plasmodiophora brassicae spore suspension of Hunan Jishou No. 4 physiological race 30 days after planting, and the concentration of the spore suspension was 1 x 10 6 / mL. Disease investigation was carried out 30 days after inoculation. The results showed that compared with the control, the root swelling of rape treated by root irrigation with 500-fold liquid was not obvious, and the disease index was significantly reduced. The above research results showed that exogenous irrigation of pesticides that destroy chitin synthesis had good effect on the prevention and control of clubroot.

[0081] The above only describes the preferred embodiments of the present application, and it should be noted that for ordinary skilled persons in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. The use of a nucleotide fragment in the preparation of a medicament for the prevention and control of clubroot of Brassica, characterized in that, The nucleotide sequence of the nucleotide fragment is shown as SEQ ID NO.

7.

2. A kit for the control of clubroot of Brassica napus, characterized in that, The kit comprises the nucleotide fragment of claim 1; The nucleotide sequence of the nucleotide fragment is shown as SEQ ID NO.

7.

3. A method for the control of clubroot of oilseed rape, characterized in that The prevention and control method is: by externally applying nucleotide fragments of silencing genes PbCHS 3 and genes PbCHS 7 to reduce the expression amount of genes PbCHS 3 and genes PbCHS 7, so that the biomass of the plasmodiophora biomass is reduced. The nucleotide sequence of the nucleotide fragment is shown as SEQ ID NO.

7. The gene PbCHS 3 is shown in SEQ ID NO. 1 ; The nucleotide sequence of the gene PbCHS7 is shown as SEQ ID NO.

2.

4. A method for biological control of clubroot of oilseed rape, characterized in that, The biological prevention and control method is as follows: connecting a nucleotide fragment for host-induced gene silencing into a silencing expression vector to obtain a host silencing vector, transforming the host silencing vector into Agrobacterium, transforming a plant by using a inflorescence immersion method, and obtaining a transgenic plant with decreased expression of genes PbCHS 3 and genes PbCHS 7. The nucleotide fragment for host-induced gene silencing is shown as SEQ ID NO.

7. the gene PbCHS 3 is shown in SEQ ID NO. 1 ; The nucleotide sequence of the gene PbCHS7 is shown as SEQ ID NO. 2.

Images