Complex, capped RNA co-transcription synthesis method, transcription reaction system and kit

Abstract

The invention discloses a complex, a capped RNA co-transcription synthesis method, a transcription reaction system and a kit, and relates to the technical field of chemical and biological engineering. Compared with the prior art, the method has the advantages that under the same NTP and cap analogue concentration condition, the mRNA obtained through transcription has a higher cap adding rate, and the high cap adding rate of a wider-spectrum cap analogue can be met. Especially for transcription of cap analogues with complex structures, the method has high cap adding rate and wide application prospects.

Description

Technical Field

[0001] The present invention relates to the field of chemical and bioengineering technology, and in particular to a complex, a capped RNA co-transcription synthesis method, a transcription reaction system and a kit. Background Art

[0002] The discovery of the central dogma confirmed the role of RNA as a bridge between DNA and protein. In the 1990s, researchers successfully expressed in vitro transcribed RNA in mice, and subsequently conducted a lot of research on the application of mRNA. In the fields of drugs and vaccines, especially in the prevention and treatment of cancer, mRNA is considered to have great potential. With the successful application of the new coronavirus mRNA vaccine, a wave of research on mRNA has been set off.

[0003] mRNA cap refers to the endogenous mRNA of eukaryotic organisms that is protected by a highly conserved 5' cap structure containing N7-methylguanosine triphosphate (m 7 Gppp / Cap0). It can be recognized by eukaryotic translation initiation factor 4E (eIF4E). In higher eukaryotic cells, the cap of mRNA is further modified with a methoxy group at the 2' position of the ribose of the first nucleotide proximal to the cap to form a cap 1 structure, i.e., Cap1, which can be described as m 7 Gppp N 1 mp N 2 The corresponding mRNA can be described as Cap1-mRNA or m 7 Gppp N 1 mp N 2 -mRNA. Sometimes, in higher eukaryotic cells, the Cap1 cap of mRNA can be further modified with a methoxy group at the 2' position of the ribose of the second nucleotide proximal to the cap to form a Cap2 structure, which can be described as m 7 Gppp 1 mxD 2 m. The corresponding mRNA can be described as Cap2-mRNA or m 7 Gppp 1 mxD 2 m-mRNA. The first nucleotide near the mRNA cap can be referred to as N1; the second nucleotide near the mRNA cap can be referred to as N2; N1 and N2 can be nucleotides of any base.

[0004] The complexity of the formation of the cap structure of eukaryotic organisms shows that the higher the degree of biological evolution, the more complex its cap structure. The importance of the 5-end cap structure of eukaryotic mRNA is that it is a necessary structure for mRNA to start translation, providing a signal for ribosomes to recognize mRNA. This cap structure may also increase the stability of mRNA and protect mRNA from attack by 5-end exonucleases.

[0005] Among the existing methods for synthesizing RNA with cap structure in vitro, enzymatic capping is a commonly used method. RNA is first obtained by in vitro transcription (IVT, In Vitro Transcription). At this time, the RNA obtained is 5'-pppRNA, which needs to undergo several steps of enzymatic reactions to obtain mRNA with Cap0 cap structure. These enzymatic reactions can be divided into three steps: 1. RNA triphosphatase (RTPase) converts the 5' triphosphate of RNA into 5' diphosphate; 2. RNA guanylyl transferase (GTase) transfers GMP from GTP to 5'-diphosphate RNA to form G(5')ppp(5')RNA; 3. Cap-specific RNA (guanine-N7) methyltransferase (MTase) transfers the methyl group from AdoMet (S-adenosyl-methionine) to the N7 position of guanine to form mRNA with Cap0 cap structure. 7 G(5')ppp(5')RNA structure, i.e., Cap0 structure. Then, a methyl group is added to the 2'-O position of the first nucleotide adjacent to the cap structure at the 5' end of the RNA by mRNA Cap 2'-O-methyltransferase, which uses S-adenosylmethionine (SAM) as a methyl donor to methylate Cap0-RNA, thereby forming a cap1 structure.

[0006] So far, capping enzymes from many different sources have been identified and purified by column chromatography and other methods. In the field of mRNA synthesis, capping enzymes (such as vaccinia virus mRNA capping enzymes) have been successfully applied. The enzymatic capping method can obtain RNA with natural Cap0 or Cap1 cap structures.

[0007] Another method for synthesizing RNA with a cap structure in vitro is co-transcriptional capping, which uses cap analogs to directly transcribe in vitro to generate mRNA with a cap structure. The process is simple and can quickly increase the production capacity of mRNA vaccines and drugs. Based on the development of chemical synthesis technology, the structure of cap analogs has gradually evolved from the first generation of mCap to the second generation of ARCA and the third generation of Cap 1 analogs (CleanCap).

[0008] Prior art CN 116751827 B of Trilink describes a process of hybridizing a trimerized nucleoside cap analog with the template transcription start site at the +1 and +2 positions to initiate transcription, and a process of hybridizing a tetramerized nucleoside cap analog with the template transcription start site at the +1, +2 and +3 positions to initiate transcription. 7 GpppA 2’O-me Under the condition that the NTP ratio is not reduced, that is, even if the concentrations of NTP and cap analogs are the same or similar, the transcription product of pG can still obtain a high capping efficiency. m7 G 3’O-me pppA 2’O-me pG 2’O-me pG, in Example 13 of CN 116751827B, 6 mM cap analog was used, but when the GTP concentration was reduced to 1.5 mM, the capping rate was 50%. This shows that for the transcription of cap analogs with complex structures, the technology of patent CN116751827B cannot achieve a better capping rate.

[0009] Nowadays, many new structures of hats have appeared, such as Trilink Reagent M6[CleanCap m6AG(3′OMe)]. The modification of m6A can achieve better translation efficiency. However, even if the technology in CN116751827 B is used and the template +1 and +2 positions are complementary, and the concentrations of NTP and cap analogs are the same, the capping efficiency of the transcription product is still not high, only 70% to 93%. It needs to be improved. The dosage of Reagent M6[CleanCap m6AG(3′OMe)] is twice that of ordinary NTP, and the capping rate can be about 95%. Alternatively, the NTP feed addition method can be used to maintain the concentration of the cap analog in the reaction liquid not less than twice the amount of NTP.

[0010] In addition, patent CN113603739A m7 G 3’O-me pppA 2’O-ethyl pG, m7 GpppA 2’O-methoxyethyl pG, and m7 Gppp m6 A 2’O-me pA 2’O-me Cap analogs such as pG have better translation effects in vivo and in vitro; however, there is also the problem of low capping rate.

[0011] In view of this, the present invention is proposed. Summary of the invention

[0012] The object of the present invention is to provide a complex, a method for co-transcriptional synthesis of capped RNA, a transcription reaction system and a kit to solve the above-mentioned technical problems. Compared with the prior art, under the same NTP and cap analog concentration conditions, the mRNA obtained by transcription has a higher capping rate, meeting the high capping rate of a wider spectrum of cap analogs.

[0013] The present invention is achieved in that:

[0014] In a first aspect, the present invention provides a complex comprising: a cap analog and a DNA template, wherein the structure of the cap analog is selected from a trimerized nucleoside cap analog or a tetramerized nucleoside cap analog, wherein the structure of the trimerized nucleoside cap analog is as follows:

[0015]

[0016] in:

[0017] B1 and B2 are each independently a natural or modified nucleoside base;

[0018] R1 and R2 are each independently H, OH, O-methyl, alkyl, O-alkyl or halo;

[0019] R3 is hydrogen, hydroxyl or O-R5-R6;

[0020] R5 is C1-C5 alkylene;

[0021] R6 is O-alkyl, S-alkyl, NH-alkyl, N-dialkyl, O-aryl, S-aryl, NH-aryl or H;

[0022] Among them, the structure of the tetrameric nucleoside cap analog is as follows:

[0023]

[0024] in:

[0025] B1, B2, and B3 are each independently a natural or modified nucleoside base;

[0026] R1 and R2 are each independently H, OH, O-methyl, alkyl, O-alkyl or halo;

[0027] R3 and R4 are each independently hydrogen, hydroxyl or O-R5-R6;

[0028] R5 is C1-C5 alkylene;

[0029] R6 is O-alkyl, S-alkyl, NH-alkyl, N-dialkyl, O-aryl, S-aryl, NH-aryl or H;

[0030] The DNA template comprises a T7 RNA polymerase transcription promoter region, and the nucleoside base at the -2 position of the transcription promoter region on the template strand is T, that is, the nucleoside base at the -2 position of the transcription promoter region on the sense strand is A; when the cap analog contains B1 and B2, B1 and B2 hybridize and complement with the nucleoside bases at the -1 and +1 positions of the template strand of the transcription promoter region of the DNA template;

[0031] When the cap analog contains B1, B2 and B3, at least two bases of B1, B2 and B3 are hybridized and complementary to the +1 and +2 positions, -1 and +1 positions of the template chain of the transcription promoter region of the DNA template, or the three bases of B1, B2 and B3 are hybridized and complementary to the nucleoside bases of the -1, +1 and +2 positions of the template chain of the DNA template in the transcription promoter region.

[0032] In a second aspect, the present invention further provides a method for co-transcriptional synthesis of 5' capped RNA, comprising: incubating the above complex.

[0033] In a third aspect, the present invention also provides a capping RNA transcription reaction system, which comprises the above-mentioned complex, NTPs and RNA polymerase.

[0034] In a fourth aspect, the present invention further provides a capped RNA, which is prepared by the above-mentioned co-transcriptional synthesis method of 5' capped RNA, and a cap analog is connected to the 5' of the RNA fragment.

[0035] In a fifth aspect, the present invention also provides a method for synthesizing protein, comprising the following steps: translating using the above-mentioned capped RNA as a template.

[0036] In a sixth aspect, the present invention also provides a protein synthesized by the above-mentioned method for synthesizing protein.

[0037] The present invention has the following beneficial effects:

[0038] The present invention provides a complex, which can improve the capping efficiency by setting the base at the -2 position of the transcription promoter region on the positive strand of the DNA template to mutate from T to A, and making the cap analog hybridize and complement the nucleoside base at the +1 position of the template strand of the transcription promoter region of the DNA template and at least one position selected from the -1 position, +2 position, and +3 position. Compared with the prior art, under the same NTP and cap analog concentration conditions, the mRNA transcribed by the present invention has a higher capping rate, which can meet the high capping rate of a wider spectrum of cap analogs. In particular, for the transcription of cap analogs with complex structures, it has a higher capping rate and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0040] Figure 1 Cap structure analog m7 GpppA 2’O-me pG(A), m7 G 3’O-me pppA 2’O-ethyl pG(B) and m7 Gppp m6 A 2’O- me pA 2’O-me Structural diagram of pG(C);

[0041] Figure 2 Cap structure analog m7 G 3’O-me ppp m6 A 2’O-me pG(A), m7 G 3’O-me ppp m6 A 2’O-me pA 2’O-me pG(B), m7 Gppp m6 A 2’O-ethyl pA 2’O-me Structural diagram of pG(C);

[0042] Figure 3 Cap structure analog m7 G 3’O-me ppp m6 A 2’O-ethyl pA 2’O-me pG(A), m7 G 3’O-me pppA 2’O- ethyl pApG(B) and m7 G 3’O-me ppp m6 A 2’O-ethyl Structural diagram of pApG (C);

[0043] Figure 4 For the trimeric nucleoside cap analog ( m7 GpppA 2’O-mepG) using a final concentration of 1 mM, on a linear DNA template with a promoter template sense strand sequence of TAATACGACTCACTATAGAA / TAAAGAA, MS data analysis of molecular weight percentage after incubation at 37°C; Figure 4 A) The molecular weight percentage of the in vitro transcription product RNA (pH 7.5 reaction buffer system) of the template positive strand TAATACGACTCACTATAGAA is analyzed by MS data, Figure 4 B) Molecular weight percentage analysis of the MS data of the in vitro transcribed RNA (pH 6.5 reaction buffer system) whose template positive strand is TAATACGACTCACTATAGAA. Figure 4 C) Molecular weight percentage analysis of the MS data of the in vitro transcribed RNA (pH 7.5 reaction buffer system) whose template positive strand is TAATACGACTCACTAAAGAA. Figure 4 D) Molecular weight percentage analysis of the MS data of the in vitro transcribed RNA (pH 6.5 reaction buffer system) whose template positive strand is TAATACGACTCACTAAAGAA.

[0044] Figure 5 For the trimeric nucleoside cap analog ( m7 G 3’O-me pppA 2’O-ethyl pG) using a final concentration of 5 mM, on a linear DNA template with a promoter template sense strand sequence of TAATACGACTCACTATAGAA / TAAAGAA, MS data analysis of molecular weight percentage after incubation at 37°C; Figure 5 A) The molecular weight percentage of the MS data analysis of the in vitro transcription product RNA (pH 7.5 reaction buffer system) whose template positive strand is TAATACGACTCACTATAGAA, Figure 5 B) Molecular weight percentage analysis of the MS data of the in vitro transcribed RNA (pH 6.5 reaction buffer system) whose template positive strand is TAATACGACTCACTATAGAA. Figure 5 C) Molecular weight percentage analysis of the MS data of the in vitro transcribed RNA (pH 7.5 reaction buffer system) whose template positive strand is TAATACGACTCACTAAAGAA. Figure 5 D) Molecular weight percentage analysis of MS data of in vitro transcription product RNA (pH 6.5 reaction buffer system) with the positive strand of the template being TAATACGACTCACTAAAGAA;

[0045] Figure 6 Tetrameric nucleoside cap analogs ( m7 Gpppm6 A 2’O-me pA 2’O-me pG) using a final concentration of 5 mM, on a linear DNA template with a promoter template sense strand sequence of TAATACGACTCACTATAAGG / TAAAAGG, MS data analysis of molecular weight percentage after incubation at 37°C; Figure 6 A) The molecular weight percentage of the in vitro transcription product RNA (pH 7.5 reaction buffer system) of the template positive strand TAATACGACTCACTATAAGG is analyzed by MS data, Figure 6 B) Molecular weight percentage analysis of the MS data of the in vitro transcribed RNA (pH 6.5 reaction buffer system) with the positive strand of the template being TAATACGACTCACTATAAGG; Figure 6 C) Molecular weight percentage analysis of the MS data of the in vitro transcribed RNA (pH 7.5 reaction buffer system) with the positive strand of the template being TAATACGACTCACTAAAAGG; Figure 6 D) Molecular weight percentage analysis of MS data of in vitro transcription product RNA (pH 6.5 reaction buffer system) with the positive strand of the template being TAATACGACTCACTAAAAGG;

[0046] Figure 7 It is the total ion peak diagram of Biotin Capture strand, Capped mRNA and Uncapped mRNA mass spectra;

[0047] Figure 8 This is the total ion peak diagram of the mass spectrum at 6min-9.0min. DETAILED DESCRIPTION

[0048] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0049] "Alkyl" refers to an aliphatic hydrocarbon radical. The alkyl portion may be a saturated alkyl (meaning that it does not contain any unsaturated units, such as carbon-carbon double bonds or carbon-carbon triple bonds) or an unsaturated alkyl (meaning that it contains at least one unsaturated unit). The alkyl portion, whether saturated or unsaturated, may be branched or straight chain. There may be 1 to 8 carbon atoms (whenever it appears herein, a numerical range such as "1 to 8" refers to each integer in the given range, such as "1 to 8 carbon atoms" refers to an alkyl group that may contain 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc. up to and including 8 carbon atoms, although the current definition also includes the occurrence of the term "alkyl" without specifying a numerical range). Typical alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, etc. "Halogen" refers to fluorine, chlorine, bromine, and iodine.

[0050] In the present invention, alkoxy refers to: -OR, wherein R can be the aforementioned alkyl or the aforementioned -OR; as an example, the alkoxy can be a methoxy group (i.e., -OCH 3 , abbreviated as Ome), ethoxy (i.e. -OCH 2 CH 3 , abbreviated as O-ethyl), methoxyethoxy (i.e. -OCH 2 CH 2 OCH 3 , abbreviated as O-methoxyethyl in English).

[0051] In the present invention, the term "RNA promoter" or "promoter sequence" or "promoter" refers to a dsDNA sequence that RNA polymerase recognizes, binds to and starts transcribing, and can be a naturally occurring or artificially modified sequence that can be recognized by RNA polymerase. In a DNA sequence, the position of the first nucleotide transcribed in the de novo synthesis stage is called the +1 position, the second transcribed nucleotide is called the +2 position, the first nucleotide position immediately upstream of the +1 position is called the -1 position, the first nucleotide position immediately upstream of the -1 position is called the -2 position, and so on. The transcribed template strand is called the antisense strand, and the other strand that is complementary to the base pairing is called the sense strand. The T7 promoter variant sequence described herein is as described above, and the position of the first nucleotide transcribed in the de novo synthesis stage is called the +1 position. The T7 variant promoter sequence and the ordinary T7 promoter are listed below.

[0052]

[0053] In the present invention, the RNA polymerase variant promoter sequence is different from the commonly known RNA polymerase promoter in that the -2 base on the promoter template strand is T, and the base on the complementary sense strand is A.

[0054] In the present invention, the term "base complementary pairing" refers to the Watson / Crick base pairing rules, where the bases of each nucleotide residue in a nucleic acid molecule are A with T, A with U, 6m A and T, G and C, etc. are connected to each other by hydrogen bonds.

[0055] In the present invention, the term "hybridization" or "hybridization complementation" refers to the hybridization complementation of a nucleotide or oligonucleotide with DNA according to the principle of complementary base pairing during a transcription reaction.

[0056] In the present invention, the term "ATP, CTP, GTP, UTP or analogs corresponding to each nucleotide" refers to natural or non-natural nucleotides and their analogs, including but not limited to base or sugar modified nucleotides, such as N1-Me-pseudoUTP, 2'-OMe-GTP, pseudoUTP, 2'-F-dUTP. All of them are triphosphates that can be recognized by RNA polymerase and can be used for IVT.

[0057] In the present invention, the term "RNA polymerase" refers to a bacteriophage-derived RNA polymerase using DNA as a template, and the polymerase can be selected from but not limited to T7 RNA polymerase and mutant polymerases, such as but not limited to polymerases capable of incorporating polynucleotides (e.g., modified nucleic acids).

[0058] In the present invention, the term "DNA template" refers to a DNA sequence containing an RNA promoter, and its source includes but is not limited to PCR and plasmid DNA. In some embodiments herein, the DNA template is obtained entirely by PCR. The DNA template used for transcription in the art can be double-stranded or single-stranded.

[0059] In the present invention, the term "capping efficiency" or "capping rate" refers to the percentage of RNA containing a cap structure in the total RNA after the in vitro transcription reaction is completed.

[0060] In the present invention, "transcription" and "in vitro transcription" refer to the process of synthesizing RNA under the catalysis of RNA polymerase using a determined strand of double-stranded DNA (the template strand is used for transcription, and the sense strand is not used for transcription) as a template and four ribonucleotides or analogs of A, U, C, and G as raw materials.

[0061] In the present invention, the term "sense strand": the strand on DNA that carries the nucleotide sequence encoding protein amino acid information is called the sense strand, also known as the coding strand, non-template strand, meaningful strand or positive strand (+ strand).

[0062] The term "antisense strand" refers to the nucleotide sequence of another strand that is complementary to the sense strand, also known as the template strand or non-coding strand. The strand that has the same nucleotide sequence as the mRNA (U replaces T) is called the sense strand.

[0063] In the present invention, the terms "Cap1" and "Cap2" are described as follows: The mRNA cap structure refers to a special structure at the 5' end of the mature mRNA formed by post-transcriptional modification in eukaryotic organisms, i.e. m7 Gppp structure, also known as methylguanosine cap. Guanosine is linked to the 5' end of the primary transcript via a 5'-5' pyrophosphate bond. When the 7th carbon atom on guanosine is methylated, it forms m7 Gppp 1 pN 2 When , the cap formed at this time is called "cap 0". m7 Gppp 1 pN 2 The N1 position of the ribose is also methylated on the carbon number "2", forming m7 Gppp 1 mxD 2 , called "cap 1", if the 5' end N 1 and N 2 Both ribose sugars in m7 Gppp 1 mxD 2 m, called "Cap 2".

[0064] In mRNA, the first nucleotide close to the cap structure refers to the first nucleotide close to the cap structure along the 5' end to 3' end of the mRNA chain, which can be abbreviated as N 1 ; "The second nucleotide close to the cap structure in mRNA" means: the second nucleotide close to the cap structure along the 5' end to the 3' end of the mRNA chain, which can be abbreviated as N 2 .

[0065] The cap structure contains 7-methylguanosine, which is located at the 5' end of the mRNA. If the 2' and 3' positions of the ribose in the 7-methylguanosine in the cap structure are both hydroxyl groups, then the 7-methylguanosine is expressed as m7 G; If the 2' position of the ribose in the cap structure of 7-methylguanosine is a methoxy group and the 3' position is a hydroxyl group, then 7-methylguanosine is represented by m7 G 2’Ome ; If the 2' position of the ribose in the cap structure of 7-methylguanosine is a hydroxyl group and the 3' position is a methoxy group, then 7-methylguanosine is represented by m7 G 3’Ome .

[0066] In the present invention, the 2' position of ribose refers to: the group connected to the "2" carbon atom on the ribose; the 3' position of ribose refers to: the group connected to the "3" carbon atom on the ribose; as an example, when the 2' position of ribose is Ome, it is abbreviated as 2'O-me or m; when the 3' position of ribose is Ome, it is abbreviated as 3'O-me; when the 2' position of ribose is O-ethyl, it is abbreviated as 2'O-ethyl; when the 2' position of ribose is O-methoxyethyl, it is abbreviated as 2'O-methoxyethyl.

[0067] In the present invention, the terms "dimeric nucleoside cap analogs", "trimeric nucleoside cap analogs" and "tetrameric nucleoside cap analogs" are described as follows: mRNA cap structure refers to a special structure at the 5' end of mature mRNA formed by post-transcriptional modification in eukaryotic organisms, i.e., m 7 The Gppp structure is also called the methylguanosine cap. This special structure similar to that in eukaryotes is artificially synthesized and is called a cap analog. Cap analogs can be divided into dimeric nucleoside cap analogs, trimeric nucleoside cap analogs, tetrameric nucleoside cap analogs and other polynucleoside cap analogs according to the number of nucleotides they consist of.

[0068] In the present invention, de novo synthesis means that RNA polymerase recognizes the promoter sequence of the DNA template, binds to it, unwinds the DNA in the promoter region or the vicinity, exposes the template strand for nucleotide hybridization and pairing, forms a transcription bubble, and then catalyzes the first pair of nucleotide triphosphates complementary to the template bases at positions +1 and +2 of the template strand to form a phosphodiester bond to form a dinucleotide, and then initiates transcription. (J.Mol.Biol.370:256-268(2007))

[0069] For T7 RNA polymerase, after binding to the corresponding promoter template, it unwinds the -4 to +3 region on the promoter DNA template (Communications Biology volume 3, Article number: 439(2020))

[0070] In the present invention, transcription initiated by cap analogs refers to RNA polymerase recognizing the promoter sequence of the DNA template and binding to it, unwinding the DNA in the promoter region or the vicinity, exposing the template chain for the cap analog hybridization pairing and binding, forming a transcription bubble, and then the cap analog hybridizes and complements with the template chain position -1, +1, or -1, +1, +2, or +1, +2, +3, or -1, +1, +2, +3 to form a hybrid complex of the DNA template and the cap analog, wherein the cap analog hybridizes with at least the +1 position of the template. Although this hybrid complex exists for a short time (Molecular Biology of the Cell 5th_0334, figure 6-8), once formed, it can be recognized by RNA polymerase, thereby initiating transcription.

[0071] In the transcription reaction system containing cap analogs, in addition to the cap analogs, there are also NTPs and their analogs involved in RNA transcription chain extension. NTPs and their analogs compete with cap analogs and can also bind to the +1 position of the transcription template chain to initiate transcription or only bind to the +2 position to initiate transcription (J.Biol.Chem.278:2819-2823(2003)). If it is desired to increase the capping rate of the transcription reaction, the thermal stability of the hybridization between the cap analog and the DNA template is increased, that is, the cap analog and the template produce more hybridized hydrogen bonds, and the number of hybridizable bases can be increased, that is, from a dimeric nucleotide cap analog to a trimeric nucleotide cap analog or a tetrameric nucleotide cap analog, and the maximum number of hybridizable bases is increased from 1 to 2 (Ishikawa) or 3; the template at the +1 position A can also be used to reduce the de novo synthesis initiated by GTP, because T7 RNAP shows a strong preference for GTP as the starting nucleotide (J.Biol.Chem.248:2235-2244 (1973)), so the Trilink patent uses a template at the +1 position A. The above technology can improve the capping rate without reducing the amount of GTP, that is, when the amount of GTP in the in vitro transcription reaction solution is equal to or exceeds the amount of the cap analog. In the prior art, the complex structure cap affects the translation activity and stability of mRNA, and at the same time affects the efficiency of participation in the transcription process, that is, the capping rate of the mRNA finally obtained. For existing cap analogs with complex structures, only using the above-mentioned existing technologies still has the problem of low incorporation efficiency and cannot obtain a high capping rate.

[0072] In a first aspect, the present invention provides a complex comprising: a cap analog and a DNA template, wherein the structure of the cap analog is selected from a trimerized nucleoside cap analog or a tetramerized nucleoside cap analog,

[0073] The structure of the trimeric nucleoside cap analog is as follows:

[0074]

[0075] in:

[0076] B1 and B2 are each independently a natural or modified nucleoside base;

[0077] R1 and R2 are each independently H, OH, O-methyl, alkyl, O-alkyl or halo;

[0078] R3 is hydrogen, hydroxyl or O-R5-R6;

[0079] R5 is C1-C5 alkylene;

[0080] R6 is O-alkyl, S-alkyl, NH-alkyl, N-dialkyl, O-aryl, S-aryl, NH-aryl or H;

[0081] Wherein, the structure of the tetrameric nucleoside cap analog is as follows:

[0082]

[0083] in:

[0084] B1, B2, and B3 are each independently a natural or modified nucleoside base;

[0085] R1 and R2 are each independently H, OH, O-methyl, alkyl, O-alkyl or halo;

[0086] R3 and R4 are each independently hydrogen, hydroxyl or O-R5-R6;

[0087] R5 is C1-C5 alkylene;

[0088] R6 is O-alkyl, S-alkyl, NH-alkyl, N-dialkyl, O-aryl, S-aryl, NH-aryl or H;

[0089] The DNA template comprises a T7 RNA polymerase transcription promoter region, and the nucleoside base at the -2 position of the transcription promoter region on the positive strand is A; when the cap analog contains B1 and B2, B1 and B2 hybridize complementary with the nucleoside bases at the -1 and +1 positions of the template strand of the transcription promoter region of the DNA template;

[0090] When the cap analog contains B1, B2 and B3, at least two bases of B1, B2 and B3 are hybridized and complementary to the nucleoside bases at the +1 and +2 positions or -1 and +1 positions of the template chain of the transcription promoter region of the DNA template, or the three bases of B1, B2 and B3 are hybridized and complementary to the nucleoside bases at the -1, +1 and +2 positions of the template chain of the transcription promoter region of the DNA template.

[0091] At present, during the co-transcription process of cap analogs, there has been no report on mutating the -2 position on the promoter template chain of the DNA template to T (the positive chain is A) and setting the -1 position of the promoter template chain to participate in the hybridization complementation of the first or middle base in the cap analog to improve the incorporation efficiency of the cap.

[0092] The present invention can improve the capping efficiency by mutating the base at the -2 position of the transcription promoter region on the positive strand of the DNA template from T to A, and making the cap analog hybridize and complement the nucleoside base at the +1 position of the template strand of the transcription promoter region of the DNA template and at least one position selected from the -1 position, +2 position, and +3 position. Compared with the prior art, the present invention has a higher capping rate for the mRNA transcribed under the same NTP and cap analog concentration conditions, and can achieve a higher capping rate for a wider spectrum of cap analogs. In particular, the transcription of cap analogs with complex structures has a higher capping rate, so the present invention has broad application prospects for the transcription of cap analogs.

[0093] In a preferred embodiment of the present invention, the natural nucleoside base is selected from any one of adenine, uraine, guanine, hypoxanthine, cytosine, thymine, adenine derivatives, uraine derivatives, guanine derivatives, cytosine derivatives, and thymine derivatives.

[0094] The modified nucleoside base is selected from N 6 -methyladenine, N 1 -methyladenine, N 6 -2'-ON dimethyladenosine, pseudouracil, N 1 -methyl pseudouracil, 5-iodouracil, 4-thiouracil, 2-thiouracil, 5-methyluracil, 5-oxymethyluracil, pseudoisocytosine, 5-methoxycytosine, 2-thiocytosine, 5-hydroxycytosine, N 1 -methylcytosine, 5-hydroxymethylcytosine, hypoxanthine, N 1 -Methylguanine, isoguanine.

[0095] In a preferred embodiment of the present invention, at least one of B1 and B2 is a natural or modified purine.

[0096] In a preferred embodiment of the present invention, at least one of B1 and B2 is a natural or methylated purine;

[0097] In a preferred embodiment of the present invention, at least one of B1 and B2 is a natural or methylated adenine;

[0098] In a preferred embodiment of the present invention, at least one of B1 and B2 is N 6-methyladenine;

[0099] In a preferred embodiment of the present invention, B1 is natural or methylated adenine;

[0100] In a preferred embodiment of the present invention, B1 is natural adenine or N 6 -methyladenine;

[0101] In a preferred embodiment of the present invention, B2 is natural or modified purine, cytosine or uracil;

[0102] In a preferred embodiment of the present invention, B2 is natural or modified adenine or guanine;

[0103] In a preferred embodiment of the present invention, B1 is N 6 -methyladenine, B2 is guanine; or, B1 is adenine, B2 is guanine;

[0104] In a preferred embodiment of the present invention, B3 is guanine.

[0105] In a preferred embodiment of the present invention, at least one of R1 and R2 is O-methyl;

[0106] In a preferred embodiment of the present invention, R3 and R4 are independently OH, O-methyl, O-ethyl, O-methylene-O-ethyl, O-ethylene-O-methyl.

[0107] In a preferred embodiment of the present invention, R5 is C1-C5 alkylene; such as C1-C3 alkylene.

[0108] In a preferred embodiment of the present invention, the cap analog is selected from m7 GpppA 2’O-me pG

[0109] m7 G 3’O-me pppA 2’O-ethyl pG m7 G 3’O-me pppA 2’O-me pG, m7 G 3’O-me ppp m6 A 2’O-me pG m7 GpppA 2’O-ethylp.g. m7 G 3’O-me ppp m6 A 2’O-ethyl p.g. m7 GpppA 2’O-methoxyethyl pApG, m7 G 3’O- me pppA 2’O-methoxyethyl p.g. m7 G 3’O-me ppp m6 A 2’O-methoxyethyl p.g. m7 Gppp m6 A 2’O-me pA 2’O-me p.g.

[0110]

[0111] m7 G 3’O-me pppA 2’O-ethyl pApG

[0112] m7 G 3’O-me ppp m6 A 2’O-ethyl pApG m7 GpppA 2’O-me pA 2’O-me p.g. m7 GpppA 2’O-me p.g. 2’O-me p.g. m7 GpppA 2’O-me for 2’O-me p.g. m7 G 3’O- me pppA 2’O-me pA 2’O-me p.g. m7 G 3’O-me pppA 2’O-me p.g. 2’O-me p.g. m7 G 3’O-me pppA 2’O-me for 2’O-me p.g. m7 Gppp m6 A 2’O- me pA 2’O-me p.g. m7 GpppA 2’O-me pm6 A 2’O-me pG、 m7 Gppp m6 A 2’O-me pG 2’O-me pG、 m7 Gppp m6 A 2’O-me pU 2’O-me pG、 m7 G 3’O-me ppp m6 A 2’O-me pA 2’O-me pG m7 G 3’O-me ppp m6 A 2’O-me pG 2’O-me pG、 m7 G 3’O-me ppp m6 A 2’O-me pU 2’O-me pG、 m7 GpppA 2’O-ethyl pA 2’O- me pG、 m7 GpppA 2’O-ethyl pG 2’O-me pG、 m7 GpppA 2’O-ethyl pU 2’O-me pG、 m7 G 3’O-me pppA 2’O-ethyl pA 2’O-me pG、 m7 G 3’O-me pppA 2’O-ethyl pG 2’O-me pG、 m7 G 3’O-me pppA 2’O-ethyl pU 2’O-me pG、 m7 GpppA 2’O-ethyl p m6 A 2’O-me pG、 m7 Gppp m6 A 2’O-ethyl pG 2’O-me pG、 m7 Gppp m6 A 2’O-ethyl pU 2’O-me pG、 m7 G 3’O-me ppp m6 A2’O-ethyl pA 2’O-me pG, m7 G 3’O-me ppp m6 A 2’O-ethyl pG 2’O-me pG, m7 G 3’O-me ppp m6 A 2’O-ethyl pU 2’O-me pG, m7 Gppp m6 A 2’O-ethyl pA 2’O-me pG

[0113] or m7 G 3’O-me ppp m6 A 2’O-ethyl pA 2’O-me pG

[0114]

[0115] In a preferred embodiment of the present invention, the cap analog is selected from m7 Gppp m6 A 2’O-me pA 2’O-me pG, m7 G 3’O- me ppp m6 A 2’O-ethyl pA 2’O-me pG or m7 G 3’O-me pppA 2’O-ethyl When the cap analog is selected from the above, it has a higher capping efficiency, which can reach a capping efficiency of more than 95%.

[0116] In a preferred embodiment of the present invention, the transcription promoter region is a T7 transcription promoter region;

[0117] When the cap analog contains B1 and B2, B1 and B2 hybridize complementary to the nucleoside bases at the -1 and +1 positions of the template strand in the transcription promoter region of the DNA template;

[0118] When the cap analog contains B1, B2 and B3, at least two bases among B1, B2 and B3 hybridize complementary to two nucleoside bases of the DNA template at positions -1, +1 and +2 of the template strand in the transcription promoter region.

[0119] In a preferred embodiment of the present invention, the transcription promoter region is a T7 transcription promoter region.

[0120] In a preferred embodiment of the present invention, the sequence of the T7 transcription promoter region includes any one of the following (1)-(3):

[0121] (1) positive strand 5'-TAATACGACTCACTAAAGAA (SEQ ID NO: 1) or 5'-TAATACGACTCACTAAAGAG (SEQ ID NO: 2); the first nucleotide at the 5' end of the positive strand is position -17, and the first nucleotide at the 3' end is position +3;

[0122] (2) positive strand 5'-TAATACGACTCACTAAAT (SEQ ID NO: 3); the first nucleotide at the 5' end of the positive strand is position -17, and the first nucleotide at the 3' end is position +1;

[0123] (3) Sense strand 5'-TAATACGACTCACTAAAAGG (SEQ ID NO: 4) or TAATACGACTCACTAAAAGA (SEQ ID NO: 5); the first nucleotide at the 5' end of the sense strand is position -17, and the first nucleotide at the 3' end is position +3.

[0124] In the above (1), when the concentrations of NTP and cap analog are the same or the concentration of cap analog is lower than that of NTP, and the +1, +2, and +3 positions of the positive strand are GAA respectively, the capping efficiency on the linearized template is higher.

[0125] In the above (3), when the concentrations of NTP and cap analog are the same, the tetrameric cap analog has a higher capping efficiency on the linearized template containing TAATACGACTCACTAAAAGG / GA (T7 variant promoter, whose template positive chain position -2 is A, +1, +2, +3 positions are AGG / AGA respectively).

[0126] In addition to the sense strand defined in (1) above, N nucleotides may be provided at the 3' end of the sense strand, where N is 1 to 10, corresponding to positions +4 ... +13, respectively.

[0127] In addition to the sense strand defined in (2) above, N nucleotides may be provided at the 3' end of the sense strand, where N is 1 to 10, corresponding to positions +2, +3, ..., +11, respectively.

[0128] In addition to the sense strand defined in (3) above, N nucleotides may be provided at the 3' end of the sense strand, where N is 1 to 10, corresponding to positions +4, +5, ..., +13, respectively.

[0129] In the present invention, the complex is formed in such a way that an in vitro transcription reaction solution contains RNA polymerase, a cap analog and a DNA template containing a variant promoter sequence, and the nucleoside base at the -2 position of the promoter region on the sense strand is A, and that on the template strand is T. The RNA polymerase recognizes the promoter sequence of the DNA template and binds to it, unwinds the DNA in the promoter region or the vicinity, and exposes the template strand for the cap analog to hybridize and pair with, forming a transcription bubble, and then the cap analog hybridizes and complements with the template strand at positions -1, +1, or -1, +1, +2, or +1, +2, or +1, +2, +3, or -1, +1, +2, +3, to form a hybrid complex of the DNA template and the cap analog, wherein the cap analog needs to hybridize with at least the +1 position of the template.

[0130] Although this hybrid complex exists for a very short time, once formed it can be recognized by RNA polymerase, thereby initiating transcription.

[0131] In a second aspect, the present invention further provides a method for co-transcriptional synthesis of 5' capped RNA, comprising: incubating the above complex.

[0132] In a preferred embodiment of the present invention, the complex is co-incubated with NTPs, RNA polymerase and a solution containing magnesium ions to obtain 5' capped RNA;

[0133] In a preferred embodiment of the present invention, the incubation is carried out under a pH of 5 to 9; under the above incubation conditions, good capping efficiency is exhibited. The above pH is, for example, 5, 5.5, 6, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.5 or 9.0.

[0134] In a preferred embodiment of the present invention, the incubation is carried out under a pH of 6.0 to 7.0; under the above incubation conditions, a higher capping efficiency is exhibited, especially at a pH of 6.5. The above pH is, for example, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9 or 7.0. According to different cap analogs, those skilled in the art can adaptively adjust the reaction conditions.

[0135] In a preferred embodiment of the present invention, the incubation temperature is 16°C to 50°C for no more than 24 hours. For example, the incubation temperature is 16°C to 37°C, or 25°C to 37°C, or 30°C to 37°C, or 36°C to 40°C, or 37°C to 45°C, or 37°C to 50°C. Depending on the different cap analogs, those skilled in the art can adaptively adjust the reaction conditions to achieve higher capping efficiency.

[0136] In a third aspect, the present invention also provides a capping RNA transcription reaction system, which comprises the above-mentioned complex, NTPs and RNA polymerase.

[0137] The capped RNA transcription reaction system, which may also be referred to as the capped RNA transcription system, is a co-transcription reaction system including a complex, NTPs and RNA polymerase, and can be used for capped RNA transcription reaction.

[0138] There is no limitation on the molar concentration ratio of the cap analog to the NTPs in the complex, and those skilled in the art can adjust it as needed, for example, it can be 1:1-5, or 1:0.5-10.

[0139] The RNA polymerase is, for example, selected from the single-subunit phage polymerase of T7 phage.

[0140] In another preferred embodiment, the RNA polymerase can be a mutant of RNA polymerase derived from bacteriophage, having at least 80%, 90%, 95%, 96%, 97%, 98%, 99% amino acid sequence identity with the natural sequence.

[0141] In a preferred embodiment of the present invention, the transcription reaction system further comprises one or a combination of at least two of the following: RNase inhibitor, inorganic pyrophosphatase, Mg2+, organic acid or its salt, buffer.

[0142] The organic acid or its salt is selected from citric acid or its salt, isocitric acid or its salt, oxalic acid or its salt, malic acid or its salt, tartaric acid or its salt, fumaric acid or its salt, succinic acid or its salt, and maleic acid or its salt.

[0143] The buffer is selected from Tris base, HEPES, Tris-HCl or MOPS.

[0144] In a fourth aspect, the present invention further provides a capped RNA, which is prepared by the above-mentioned co-transcriptional synthesis method of 5' capped RNA, and a cap analog is connected to the 5' of the RNA fragment.

[0145] The 5' linker of the RNA fragment has a cap analog, which helps to improve the stability of the capped RNA, making it less susceptible to degradation in the body and also more efficient in translating proteins.

[0146] In a fifth aspect, the present invention also provides a method for synthesizing protein, comprising the following steps: translating using the above-mentioned capped RNA as a template.

[0147] In a sixth aspect, the present invention also provides a protein synthesized by the above-mentioned method for synthesizing protein.

[0148] The features and properties of the present invention are further described in detail below in conjunction with the examples, which are given only to illustrate the present invention, not to limit the scope of the present invention. If not specifically noted in the examples, the T7 RNA Polymerase used for the 37°C reaction can be a common enzyme with no mutation and natural amino acid sequence, or a commercial T7 RNA Polymerase containing amino acid mutations, including Hi-T7 RNA polymerase (NEB) and Thermostable T7 RNA polymerase (TOYOBO), regardless of which specific commercial variety is used.

[0149] Example 1

[0150] This embodiment provides a variety of cap analogs, specifically including: Figure 1 A) m7 GpppA 2’O-me pG, Figure 1 B) m7 G 3’O-me pppA 2’O-ethyl pG, Figure 1 C) m7 Gppp m6 A 2’O-me pA 2’O-me pG, Figure 2 A) m7 G 3’O-me ppp m6 A 2’O- me pG, Figure 2 B) m7 G 3’O-me ppp m6 A 2’O-me pA 2’O-me pG, Figure 2 C) m7 Gppp m6 A 2’O-ethyl pA 2’O-me pG, Figure 3 A) m7 G 3’O-me ppp m6 A 2’O-ethyl pA 2’O-me pG, Figure 3 B) m7 G 3’O-me pppA 2’O-ethyl pApG, Figure 3 C) m7 G 3’O-me ppp m6 A 2’O-ethyl pApG.

[0151] Example 2

[0152] This embodiment provides a complex, including a DNA template and a cap analog, wherein the DNA template (i.e., co-transcription template) is a linear DNA template obtained by PCR. The obtained linearized DNA template is purified using a common DNA purification kit (Tiangen Biochemical Technology DP204) according to the manufacturer's instructions.

[0153] The solution conditions for complex formation can be as follows: 1000 ng DNA template, 40 mM Tris-HCl (pH 7.5 or pH 6.5), 30 mM MgCl 2 , 2 mM spermidine, 10 mM DTT, 0.01% Triton X-100, 1 mM cap analog, 500 U T7 RNA polymerase (native sequence, no mutation), reaction volume 20 μL. After mixing according to the above configuration, a complex was obtained.

[0154] Example 3

[0155] This embodiment provides a capped RNA transcription reaction system (or capped RNA transcription system) and a co-transcriptional synthesis method of 5' capped RNA:

[0156] 1000ng DNA template, 40mM Tris-HCl (pH 7.5), 30mM MgCl 2 , 2mM spermidine, 10mM DTT, 0.01% Triton X-100, 5mM ATP, 5mM CTP, 5mM UTP, 5mM GTP, 1mM cap analog, 500U T7 RNApolymerase (native sequence, no mutation), 0.05U inorganic pyrophosphatase, 25U nuclease inhibitor, reaction volume 20μL.

[0157] The mixture was mixed and incubated at 37°C for 3 hours.

[0158] 5' capped RNA purification method: add 1 μL of 1U / μL DNaseI to supplement the reaction and incubate at 37°C for 30 minutes. Add 10.5 μL of 7.5M LiCl solution, let stand at -20°C for 20 minutes, centrifuge at 11000rpm at 4°C for 20 minutes, and rinse the RNA precipitate with 75% ethanol twice. Dissolve the RNA precipitate in water to obtain pure RNA.

[0159] Example 4

[0160] This embodiment provides a capped RNA transcription reaction system (or capped RNA transcription system):

[0161] 1000ng DNA template, 40mM Tris-HCl (pH 6.5), 30mM MgCl 2 , 2mM spermidine, 10mM DTT, 0.01% Triton X-100, 5mM ATP, 5mM CTP, 5mM UTP, 5mM GTP, 1mM cap analog, 500U T7 RNApolymerase (native sequence, no mutation), 0.05U inorganic pyrophosphatase, 25U nuclease inhibitor, reaction volume 20μL.

[0162] The method for purifying 5' capped RNA is the same as in Example 3.

[0163] Example 5

[0164] This example provides a capped RNA transcription reaction system (or capped RNA transcription system). Compared with Example 3, the only difference is that 5 mM cap analog is added.

[0165] Example 6

[0166] This example provides a capped RNA transcription reaction system (or capped RNA transcription system). Compared with Example 4, the only difference is that 5 mM cap analog is added.

[0167] Example 7

[0168] According to the capping RNA transcription reaction system of Example 3 (pH 7.5) and Example 4 (pH 6.5), the trimeric nucleoside cap analog ( m7 GpppA 2’O-me As a control, a DNA template containing a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0169] The following detection method is used to detect the RNA capping efficiency of the IVT (co-transcription) reaction product:

[0170] RNase H (ribonuclease H) is an endoribonuclease. When RNA and DNA are hybridized, RNase H will specifically hydrolyze the phosphodiester bond of RNA at the hybridization site. Using this feature, the specific biotin probe and IVT product RNA are complementary paired through annealing bases, and RNase H cleaves the specific site of RNA to obtain a small RNA fragment with uniform 5'-end. Then, the small RNA fragment is purified using biotin affinity magnetic beads; finally, the molecular weight of the 5'-end small RNA fragment is analyzed by liquid chromatography and LC-MS to determine the capping status, that is, the capping status of the RNA obtained by the in vitro transcription reaction.

[0171] A linear DNA template containing TAATACGACTCACTATAGAG (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are GAG) and a linear DNA template containing TAATACGACTCACTAAAGAG (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are GAG) were prepared, and the co-transcription method in Examples 3 and 4 was used. 1 mM m7 GpppA 2’O-me Finally, the capping efficiency of the IVT product RNA was detected using the method of this example.

[0172] The data results are shown in Table 1 below:

[0173] Table 1 Statistical results of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0174]

[0175]

[0176] Example 8

[0177] According to the capping RNA transcription reaction system of Example 3 (pH 7.5) and Example 4 (pH 6.5), the trimeric nucleoside cap analog ( m7 GpppA 2’O-me As a control, a DNA template containing a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0178] A linear DNA template containing TAATACGACTCACTATAGAA (a common T7 promoter sequence, where the +1, +2, and +3 positions are GAA) and a linear DNA template containing TAATACGACTCACTAAAGAA (a T7 variant promoter, where the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are GAA) were prepared, and the co-transcription method in Examples 3 and 4 was used. 1 mM m7 GpppA 2’O-me pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was detected according to the method of Example 7.

[0179] by Figure 4 Taking Figure A in as an example, the following is the data analysis of capping efficiency:

[0180] The method for detecting the capping efficiency described in Example 7 was used to obtain small mRNA fragments, and the molecular weight of the 5'-end small RNA fragments was analyzed by liquid chromatography and LC-MS. The molecular weights were compared based on the HPLC peaks:

[0181] Biotin Capture strand, Capped mRNA and Uncapped mRNA mass spectrometry total ion peak diagram, refer to Figure 7 As shown, the total ion peak of the mass spectrum from 6min to 9.0min is selected ( Figure 8 As shown), the deconvolution result diagram obtained by selecting 6min-9.0min for m / z analysis (refer to Figure 4 As shown in A):

[0182] Measured molecular weight and result table:

[0183]

[0184] Capping efficiency calculation:

[0185] Capping efficiency = Fractional Abundance (Cap1) / (Fractional Abundance (Cap1) +Fractional Abundance (Uncapped) )=69.8456429 / 87.89714934=79.46%. Figure 4 The capping efficiency of the cap analog in Figure A is calculated in the same way for other cap analogs.

[0186] Figure 4 Capping efficiency calculation in Figure B: Measured molecular weight and result table:

[0187]

[0188]

[0189] Capping efficiency = Fractional Abundance (Cap1) / (Fractional Abundance (Cap1) +Fractional Abundance (Uncapped) )=76.5678166874686 / 88.4823582157789=86.53%

[0190] Figure 4 Capping efficiency calculation in Figure C: Measured molecular weight and result table:

[0191]

[0192] Capping efficiency = Fractional Abundance (Cap1) / (Fractional Abundance (Cap1) +Fractional Abundance (Uncapped) )=73.9784460114468 / 80.0449397551533=92.42%

[0193] Figure 4 Capping efficiency calculation in Figure D: Measured molecular weight and result table:

[0194]

[0195] Capping efficiency = Fractional Abundance (Cap1) / (Fractional Abundance (Cap1) +Fractional Abundance (Uncapped) )=80.7318958355942 / 84.3996247859094=95.65%

[0196] The data results are shown in Table 2 below:

[0197] Table 2 Statistical results of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0198]

[0199] Example 9

[0200] According to the capping RNA transcription reaction system of Example 3 (pH 7.5) and Example 4 (pH 6.5), the trimeric nucleoside cap analog ( m7 GpppA 2’O-me As a control, a DNA template containing a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0201] A linear DNA template containing TAATACGACTCACTATAAGG (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are AGG) and a linear DNA template containing TAATACGACTCACTAAAAGG (a T7 variant promoter, wherein the -2 position of the positive strand of the template is A, and the +1, +2, and +3 positions are AGG) were prepared, and the co-transcription method in Examples 3 and 4 was used. 1 mM m7 GpppA 2’O-mepG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 3 below:

[0202] Table 3 Statistical results of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0203]

[0204] Example 10

[0205] According to the capping RNA transcription reaction system of Example 3 (pH 7.5) and Example 4 (pH 6.5), the trimeric nucleoside cap analog ( m7 GpppA 2’O-me As a control, a DNA template containing a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0206] A linear DNA template containing TAATACGACTCACTATAAGA (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are AGA) and a linear DNA template containing TAATACGACTCACTAAAAGA (a T7 variant promoter, wherein the -2 position of the positive strand of the template is A, and the +1, +2, and +3 positions are AGA) were prepared, and the co-transcription method in Examples 3 and 4 was used. 1 mM m7 GpppA 2’O-me pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 4 below:

[0207] Table 4 Statistical results of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0208]

[0209] Table 5 Data summary of Examples 7 to 10

[0210]

[0211] The results in Table 5 show that by exploring the different bases at the +1, +2, and +3 positions of the T7 template promoter, the final concentration of 1 mM m7 GpppA 2’O-mepG, when the T7 variant promoter sequence (A at position -2 of the sense strand) is used, and any bases are at positions +1, +2, and +3, that is, when the cap analog is combined with the template strand (antisense strand) at positions -1 and +1 (Examples 7-8), the capping efficiency is greatly improved. The above examples also show that the case where the sense strand is A at position -2 is significantly better than the case where the sense strand is T at position -2.

[0212] In addition, whether it is the conventional T7 promoter or the T7 variant promoter sequence described in this article, the pH value of the reaction system has a great influence on the capping efficiency. Under acidic conditions, the capping efficiency is higher. When the +1 and +2 positions shown in the Trilink patent are AG, at 1mM m7 GpppA 2’O-me When pG is used at a final concentration, the capping efficiency can only reach 92.26% at most. However, the results of the examples provided by the present invention show that it can reach more than 95%. Therefore, the following examples provide the capping efficiency results of different cap analogs.

[0213] Embodiment 11

[0214] The trimeric nucleoside cap analog was added according to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5). m7 G 3’O-me pppA 2’O-ethyl pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0215] A linear DNA template containing TAATACGACTCACTATAGAG (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are GAG) and a linear DNA template containing TAATACGACTCACTAAAGAG (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are GAG) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 G 3’O- me pppA 2’O-ethyl pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 6 below:

[0216] Table 6 Statistical results of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0217]

[0218] Example 12

[0219] The trimeric nucleoside cap analog was added according to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5). m7 G 3’O-me pppA 2’O-ethyl pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0220] A linear DNA template containing TAATACGACTCACTATAGAA (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are GAA) and a linear DNA template containing TAATACGACTCACTAAAGAA (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are GAA) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 G 3’O- me pppA 2’O-ethyl pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was detected according to the method of Example 7.

[0221] Figure 5 Capping efficiency calculation in Figure A: Measured molecular weight and result table:

[0222]

[0223] Capping efficiency = Fractional Abundance (Cap1) / (Fractional Abundance (Cap1) +Fractional Abundance (Uncapped) )=68.9944100010523 / 88.099707565308=78.31% Figure 5 Capping efficiency calculation in Figure B: Measured molecular weight and result table:

[0224]

[0225] Capping efficiency = Fractional Abundance (Cap1) / (Fractional Abundance (Cap1) +Fractional Abundance (Uncapped) )=80.4396443802836 / 91.7325136303836=87.69% Figure 5 Capping efficiency calculation in Figure C: Measured molecular weight and result table:

[0226]

[0227]

[0228] Capping efficiency = Fractional Abundance (Cap1) / (Fractional Abundance (Cap1) +Fractional Abundance (Uncapped) )=76.2138349196435 / 86.0145619894637=88.61%

[0229] Figure 5 Capping efficiency calculation in Figure D: Measured molecular weight and result table:

[0230]

[0231] Capping efficiency = Fractional Abundance (Cap1) / (Fractional Abundance (Cap1) +Fractional Abundance (Uncapped) )=83.6321191964777 / 88.3935841240948=94.61%.

[0232] The data results are shown in Table 7 below:

[0233] Table 7 Statistical results of the yield and capping efficiency of RNA products co-incubated with cap analogs and linear DNA templates

[0234]

[0235] Embodiment 13

[0236] The trimeric nucleoside cap analog was added according to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5). m7 G 3’O-me pppA 2’O-ethyl pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0237] A linear DNA template containing TAATACGACTCACTATAAGG (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are AGG) and a linear DNA template containing TAATACGACTCACTAAAAGG (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are AGG) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 G 3’O- me pppA 2’O-ethyl pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 8 below:

[0238] Table 8 Statistics of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0239]

[0240] Embodiment 14

[0241] The trimeric nucleoside cap analog was added according to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5). m7 G 3’O-me pppA 2’O-ethyl pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0242] A linear DNA template containing TAATACGACTCACTATAAGA (a common T7 promoter sequence, in which the +1, +2, and +3 positions are AGA) and a linear DNA template containing TAATACGACTCACTAAAAGA (a T7 variant promoter, in which the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are AGA) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 G 3’O- me pppA 2’O-ethyl pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 9 below:

[0243] Table 9 Statistics of the yield and capping efficiency of RNA products co-incubated with cap analogs and linear DNA templates

[0244]

[0245] Table 10: Summary of data results of Examples 11 to 14

[0246]

[0247] Table 10 shows that the use of a final concentration of 5 mM containing a special modification m7 G 3’O-me pppA 2’O-ethyl pG, the pH value of the reaction system has a great influence on the capping efficiency. Under acidic conditions, the capping efficiency is higher. When a T7 variant promoter sequence is used (the -2 position of the sense chain is A), and its +1, +2, and +3 positions are GAG ​​and GAA, the capping efficiency is significantly improved, and the RNA yield is also improved compared to the ordinary T7 promoter sequence (the -2 position of the sense chain is T). When a T7 variant promoter sequence is used (the -2 position of the sense chain is A), and its +1, +2, and +3 positions are AGG and AGA, the capping efficiency is basically the same, but compared with the Trilink patent, the highest capping efficiency that can be achieved when the +1 and +2 positions are AG is only 92.21%, and the capping results of the embodiment of the present invention show that the use of a final concentration of 5mM containing a special modification m7 G 3’O-me pppA 2’O-ethyl The capping efficiency of mRNA prepared by pG can reach about 95%. It is found that when the nucleoside base at the -2 position of the transcription promoter region on the sense strand is A; when the two bases in the trimer nucleoside cap analog hybridize and complement with the nucleoside bases at the -1 and +1 positions of the template strand of the DNA template transcription promoter region, the capping efficiency is significantly improved compared with the ordinary T7 promoter sequence.

[0248] Embodiment 15

[0249] According to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5), the tetrameric nucleoside cap analog was added. m7 Gppp m6 A 2’O-me pA 2’O-me pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0250] A linear DNA template containing TAATACGACTCACTATAGAG (a common T7 promoter sequence, where the +1, +2, and +3 positions are GAG) and a linear DNA template containing TAATACGACTCACTAAAGAG (a T7 variant promoter, where the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are AGA) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 Gppp m6 A 2’O-me pA2’O-me pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 11 below:

[0251] Table 11 Statistics of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0252]

[0253] Example 16

[0254] According to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5), the tetrameric nucleoside cap analog was added. m7 Gppp m6 A 2’O-me pA 2’O-me pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0255] A linear DNA template containing TAATACGACTCACTATAGAA (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are GAA) and a linear DNA template containing TAATACGACTCACTAAAGAA (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are GAA) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 Gppp m6 A 2’O-me pA 2’O-me pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 12 below:

[0256] Table 12 Statistics of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0257]

[0258] Embodiment 17

[0259] According to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5), the tetrameric nucleoside cap analog was added. m7 Gppp m6 A 2’O-me pA 2’O-me pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0260] A linear DNA template containing TAATACGACTCACTATAAGG (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are AGG) and a linear DNA template containing TAATACGACTCACTAAAAGG (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are AGG) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 Gppp m6 A 2’O-me pA 2’O-me pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was detected according to the method of Example 7.

[0261] Figure 6 Capping efficiency calculation in Figure A: Measured molecular weight and result table:

[0262]

[0263]

[0264] Capping efficiency = Fractional Abundance (Cap2) / (Fractional Abundance (Cap2) +Fractional Abundance (Uncapped) )=82.613483137401 / 89.5344529744742=92.27% Figure 6 Capping efficiency calculation in Figure B: Measured molecular weight and result table:

[0265]

[0266] Capping efficiency = Fractional Abundance (Cap2) / (Fractional Abundance (Cap2) +Fractional Abundance (Uncapped) )=84.9206366479721 / 89.567812278578=94.81% Figure 6 Capping efficiency calculation in Figure C: Measured molecular weight and result table:

[0267]

[0268]

[0269] Capping efficiency = Fractional Abundance (Cap2) / (Fractional Abundance (Cap2) +Fractional Abundance (Uncapped) )=84.2340938495561 / 87.7042300423681=96.04%

[0270] Figure 6 Capping efficiency calculation in Figure D: Measured molecular weight and result table:

[0271]

[0272] Capping efficiency = Fractional Abundance (Cap2) / (Fractional Abundance (Cap2) +Fractional Abundance (Uncapped) )=81.7448404343651 / 84.5389767624113=96.69%

[0273] The data results are shown in Table 13 below:

[0274] Table 13 Statistics of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0275] Embodiment 18

[0276] According to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5), the tetrameric nucleoside cap analog was added. m7 Gppp m6 A 2’O-me pA 2’O-me pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0277] A linear DNA template containing TAATACGACTCACTATAAGA (a common T7 promoter sequence, in which the +1, +2, and +3 positions are AGA) and a linear DNA template containing TAATACGACTCACTAAAAGA (a T7 variant promoter, in which the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are AGA) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 Gppp m6 A 2’O-me pA 2’O-mepG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 14 below:

[0278] Table 14 Statistics of the yield and capping efficiency of RNA products co-incubated with cap analogs and linear DNA templates

[0279]

[0280] Table 15 Summary of data results of Examples 15 to 18

[0281]

[0282]

[0283] Table 15 shows that the final concentration of 5 mM of tetrameric nucleoside cap analogs containing specific modifications m7 Gppp m6 A 2’O- me pA 2’O-me When pG was co-incubated with a T7 template including different bases at the +1, +2, and +3 positions of the promoter, when a T7 variant promoter sequence (the -2 position of the template sense strand is A) with arbitrary bases at the +1, +2, and +3 positions was used, the capping efficiency was significantly improved, and the RNA yield was also improved compared to the ordinary T7 promoter sequence (the -2 position of the sense strand is T).

[0284] The pH value of the reaction system has a great influence on the capping efficiency. Under acidic conditions, the capping efficiency is higher. The present invention sets the nucleoside base at the -2 position of the transcription promoter region on the sense chain to be A; the cap analog hybridizes and complements with the nucleoside bases at the +1 and +2 positions of the DNA template in the template chain of the transcription promoter region. The capping efficiency results of the embodiment show that it can reach about 97%, and the capping efficiency has been greatly improved. Finally, when at least two bases of its tetrameric nucleoside cap analog hybridize and complement with the DNA template at the +1 and +2 positions, -1 and +1 positions of the template chain in the transcription promoter region, or three bases hybridize and complement with the nucleoside bases at the -1, +1 and +2 positions of the DNA template in the template chain of the transcription promoter region, the T7 variant promoter (the template sense chain -2 position is A) can be significantly improved relative to the ordinary T7 promoter (the template sense chain is T) The capping efficiency can be significantly improved.

[0285] The above Examples 3 to 18 show that when the concentrations of NTP and cap analog are the same or the concentration of cap analog is lower than that of NTP, the capping efficiency of the trimer cap analog is the highest on a linearized template containing TAATACGACTCACTAAAGAA (T7 variant promoter, in which the -2 position of the template sense strand is A, and the +1, +2, and +3 positions of the sense strand are GAA respectively).

[0286] When the concentrations of NTP and cap analog are the same, the capping efficiency of the tetrameric cap analog is highest on the linearized template containing TAATACGACTCACTAAAAGG / AGA (T7 variant promoter, whose template positive strand has A at -2 position, AGG / AGA at +1, +2, and +3 positions respectively).

[0287] The following examples are used to perform capping reactions on other cap analogs.

[0288] Embodiment 19

[0289] The trimeric nucleoside cap analog was added according to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5). m7 G 3’O-me ppp m6 A 2’O-me pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0290] A linear DNA template containing TAATACGACTCACTATAGAA (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are GAA) and a linear DNA template containing TAATACGACTCACTAAAGAA (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are GAA) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 G 3’O-me ppp m6 A 2’O-me pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 16 below:

[0291] Table 16 Statistics of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0292]

[0293] Embodiment 20

[0294] According to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5), the tetrameric nucleoside cap analog was added. m7 G 3’O-me ppp m6 A 2’O-me pA 2’O-mepG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0295] A linear DNA template containing TAATACGACTCACTATAAGG (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are AGG) and a linear DNA template containing TAATACGACTCACTAAAAGG (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are AGG) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 G 3’O- me ppp m6 A 2’O-me pA 2’O-me pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 17 below:

[0296] Table 17 Statistics of RNA product yield and capping efficiency of cap analogs co-incubated with linear DNA templates

[0297]

[0298] Embodiment 21

[0299] According to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5), the tetrameric nucleoside cap analog was added. m7 Gppp m6 A 2’O-ethyl pA 2’O-me pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0300] A linear DNA template containing TAATACGACTCACTATAAGG (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are AGG) and a linear DNA template containing TAATACGACTCACTAAAAGG (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are AGG) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 Gppp m6 A 2’O-ethyl pA 2’O-me pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 18 below:

[0301] Table 18 Statistics of the yield and capping efficiency of RNA products co-incubated with cap analogs and linear DNA templates

[0302]

[0303] Embodiment 22

[0304] According to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5), the tetrameric nucleoside cap analog was added. m7 G 3’O-me ppp m6 A 2’O-ethyl pA 2’O-me pG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0305] A linear DNA template containing TAATACGACTCACTATAAGG (a common T7 promoter sequence, in which the +1, +2, and +3 positions are AGG, respectively) and a linear DNA template containing TAATACGACTCACTATAAGG (a T7 variant promoter, in which the -2 position of the positive strand of the template is A, and the +1, +2, and +3 positions are AGG, respectively) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 G 3’O-me ppp m6 A 2’O-ethyl pA 2’O-me pG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 19 below:

[0306] Table 19 Statistics of the yield and capping efficiency of RNA products co-incubated with cap analogs and linear DNA templates

[0307]

[0308]

[0309] Embodiment 23

[0310] According to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5), the tetrameric nucleoside cap analog was added. m7 G 3’O-me pppA 2’O-ethyl pApG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0311] A linear DNA template containing TAATACGACTCACTATAAGG (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are AGG) and a linear DNA template containing TAATACGACTCACTAAAAGG (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are AGG) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 G 3’O-me pppA 2’O-ethyl pApG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 20 below:

[0312] Table 20 Statistics of the yield and capping efficiency of RNA products co-incubated with cap analogs and linear DNA templates

[0313]

[0314] Embodiment 24

[0315] According to the capping RNA transcription reaction system of Example 5 (pH 7.5) and Example 6 (pH 6.5), the tetrameric nucleoside cap analog was added. m7 G 3’O-me ppp m6 A 2’O-ethyl pApG was co-incubated with the linear DNA template. As a control, a DNA template including a common T7 promoter was also set up and incubated at 37°C to measure the RNA yield and capping efficiency of in vitro transcription.

[0316] A linear DNA template containing TAATACGACTCACTATAAGG (a common T7 promoter sequence, wherein the +1, +2, and +3 positions are AGG) and a linear DNA template containing TAATACGACTCACTAAAAGG (a T7 variant promoter, wherein the -2 position of the template sense strand is A, and the +1, +2, and +3 positions are AGG) were prepared, and the co-transcription method in Examples 5 and 6 was used. 5 mM m7 G 3’O-me ppp m6 A 2’O-ethyl pApG, and mRNA was obtained. The capping efficiency of the IVT product RNA was tested according to the method of Example 7. The data results are shown in Table 21 below:

[0317] Table 21 Statistics of the yield and capping efficiency of RNA products co-incubated with cap analogs and linear DNA templates

[0318]

[0319] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A composite, characterized in that: The method comprises: a cap analog and a DNA template, wherein the structure of the cap analog is selected from a trimerized nucleoside cap analog or a tetramerized nucleoside cap analog; Wherein, the structure of the trimeric nucleoside cap analog is as follows: in: B1 and B2 are each independently a natural or modified nucleoside base; R1 and R2 are each independently H, OH, O-methyl, alkyl, O-alkyl or halo; R3 is hydrogen, hydroxyl or O-R5-R6; R5 is C1-C5 alkylene; R6 is O-alkyl, S-alkyl, NH-alkyl, N-dialkyl, O-aryl, S-aryl, NH-aryl or H; Wherein, the structure of the tetrameric nucleoside cap analog is as follows: in: B1, B2, and B3 are each independently a natural or modified nucleoside base; R1 and R2 are each independently H, OH, O-methyl, alkyl, O-alkyl or halo; R3 and R4 are each independently hydrogen, hydroxyl or O-R5-R6; R5 is C1-C5 alkylene; R6 is O-alkyl, S-alkyl, NH-alkyl, N-dialkyl, O-aryl, S-aryl, NH-aryl or H; The DNA template comprises a T7 RNA polymerase transcription promoter region, and the nucleoside base at position -2 of the transcription promoter region on the sense strand is A; When the cap analog contains B1 and B2, B1 and B2 hybridize and complement with the nucleoside bases at the -1 and +1 positions of the template strand of the transcription promoter region of the DNA template; When the cap analog contains B1, B2 and B3, at least two bases of B1, B2 and B3 are hybridized and complementary to the nucleoside bases at the +1 and +2 positions, or -1 and +1 positions, of the template chain of the transcription promoter region of the DNA template, or the three bases of B1, B2 and B3 are hybridized and complementary to the nucleoside bases at the -1, +1 and +2 positions of the template chain of the DNA template in the transcription promoter region.

2. The composite body according to claim 1, characterized in that The natural nucleoside base is selected from any one of adenine, uraine, guanine, hypoxanthine, cytosine, thymine, adenine derivatives, uraine derivatives, guanine derivatives, cytosine derivatives, and thymine derivatives; The modified nucleoside base is selected from N 6 -methyladenine, N 1 -methyladenine, N 6 -2'-ON dimethyladenosine, pseudouracil, N 1 -methyl pseudouracil, 5-iodouracil, 4-thiouracil, 2-thiouracil, 5-methyluracil, 5-oxymethyluracil, pseudoisocytosine, 5-methoxycytosine, 2-thiocytosine, 5-hydroxycytosine, N 1 -methylcytosine, 5-hydroxymethylcytosine, hypoxanthine, N 1 -Methylguanine, isoguanine.

3. The composite body according to claim 2, characterized in that At least one of B1 and B2 is a natural or modified purine; Preferably, at least one of B1 and B2 is a natural or methylated purine; Preferably, at least one of B1 and B2 is natural or methylated adenine; Preferably, at least one of B1 and B2 is N 6 -methyladenine; Preferably, the B1 is natural or methylated adenine; Preferably, the B1 is natural adenine or N 6 -methyladenine; Preferably, B2 is natural or modified purine, cytosine or uracil; Preferably, B2 is natural or modified adenine or guanine; Preferably, said B1 is N 6 -methyladenine, said B2 is adenine or guanine; or, B1 is adenine, said B2 is adenine or guanine; Preferably, said B3 is guanine.

4. The composite body according to claim 1, characterized in that At least one of R1 and R2 is O-methyl.

5. The composite body according to claim 1, characterized in that The R3 and R4 are independently OH, O-methyl, O-ethyl, O-methylene-O-ethyl or O-ethylene-O-methyl.

6. The composite body according to claim 1, characterized in that The cap analog is selected from m7 GpppA 2’O-me pG, m7 G 3’O-me pppA 2’O-ethyl pG, m7 G 3’O-me pppA 2’O-me pG, m7 G 3’O-me ppp m6 A 2’O-me pG, m7 GpppA 2’O-ethyl pG, m7 G 3’O- me ppp m6 A 2’O-ethyl pG, m7 GpppA 2’O-methoxyethyl pApG, m7 G 3’O-me pppA 2’O-methoxyethyl pG, m7 G 3’O-me ppp m6 A 2’O-methoxyethyl pG, m7 Gppp m6 A 2’O-me pA 2’O-me pG, m7 G 3’O-me pppA 2’O-ethyl pApG, m7 G 3’O-me ppp m6 A 2’O- ethyl pApG, m7 GpppA 2’O-me pA 2’O-me pG, m7 GpppA 2’O-me pG 2’O-me pG, m7 GpppA 2’O-me pU 2’O-me pG, m7 G 3’O- me pppA 2’O-me pA 2’O-me pG, m7 G 3’O-me pppA 2’O-me pG 2’O-me pG, m7 G 3’O-me pppA 2’O-me pU 2’O-me pG, m7 GpppA 2’O- me p m6 A 2’O-me pG、 m7 Gppp m6 A 2’O-me pG 2’O-me pG、 m7 Gppp m6 A 2’O-me pU 2’O-me pG、 m7 G 3’O-me ppp m6 A 2’O-me pA 2’O- me pG、 m7 G 3’O-me ppp m6 A 2’O-me pG 2’O-me pG、 m7 G 3’O-me ppp m6 A 2’O-me pU 2’O-me pG、 m7 GpppA 2’O-ethyl pA 2’O-me pG、 m7 GpppA 2’O-ethyl pG 2’O-me pG、 m7 GpppA 2’O-ethyl pU 2’O-me pG、 m7 G 3’O-me pppA 2’O-ethyl pA 2’O-me pG、 m7 G 3’O- me pppA 2’O-ethyl pG 2’O-me pG、 m7 G 3’O-me pppA 2’O-ethyl pU 2’O-me pG、 m7 GpppA 2’O-ethyl p m6 A 2’O-me pG、 m7 Gppp m6 A 2’O-ethyl pG 2’O-me pG、 m7 Gppp m6 A 2’O-ethyl pU 2’O-me pG、 m7 G 3’O-me ppp m6 A 2’O-ethyl pA 2’O-me pG、 m7 G 3’O-me ppp m6 A 2’O-ethyl pG 2’O-me pG m7 G 3’O-me ppp m6 A 2’O-ethyl pU 2’O-me pG.

7. The composite body according to claim 1, characterized in that The sequence of the T7 transcription promoter region is as follows: Sense strand 5′-TAATACGACTCACTAAA-3′; Preferably, the sequence of the T7 transcription promoter region includes any one of the following (1)-(3): (1) The sense strand is 5'-TAATACGACTCACTAAAGAA or 5'-TAATACGACTCACTAAAGAG; the first nucleotide at the 5' end of the sense strand is -17, and the first nucleotide at the 3' end is +3; (2) positive strand 5'-TAATACGACTCACTAAAT; the first nucleotide at the 5' end of the positive strand is -17, and the first nucleotide at the 3' end is +1; (3) The positive strand is 5'-TAATACGACTCACTAAAAGG or TAATACGACTCACTAAAAGA; the first nucleotide at the 5' end of the positive strand is -17, and the first nucleotide at the 3' end is +3.

8. A method for co-transcriptional synthesis of 5' capped RNA, characterized in that: It includes: Incubate the complex according to any one of claims 1 to 7.

9. The method for co-transcriptional synthesis of 5' capped RNA according to claim 8, characterized in that: The complex is co-incubated with NTPs, RNA polymerase and a solution containing magnesium ions to obtain 5' capped RNA; Preferably, the incubation is carried out at a pH of 5 to 9; Preferably, the incubation is carried out at a pH of 6.0 to 7.0; Preferably, the incubation temperature is 16°C to 50°C for no more than 24 hours.

10. A capped RNA transcription reaction system, characterized in that: It comprises the complex according to any one of claims 1 to 7, NTPs and RNA polymerase.

11. The capped RNA transcription reaction system according to claim 10, characterized in that: The capped RNA transcription reaction system further comprises one or a combination of at least two of the following: an RNase inhibitor, an inorganic pyrophosphatase, Mg 2+ , organic acids or their salts and buffers.

12. A capped RNA, characterized in that It is prepared by the co-transcriptional synthesis method of 5' capped RNA according to claim 8, and the 5' end of the RNA fragment is connected with the cap analog.

13. A method for synthesizing protein, characterized in that: The method comprises the following steps: translating using the capped RNA according to claim 12 as a template.

14. A protein, characterized in that It is synthesized by the method for synthesizing protein according to claim 13.

Images