Probe for detecting retinoblastoma RB1 gene mutation and application thereof

Abstract

The invention provides a probe for detecting retinoblastoma RB1 gene mutation and application of the probe, and establishes a high-throughput sequencing method of which the detection range covers RB1 gene intron deep mutation, a promoter region, upstream and downstream genes thereof and other RB patient common accompanying mutation genes by optimizing probe design and data analysis process. The probe disclosed by the invention is relatively stable in data output and high in repeatability after being used for a third-generation PB platform test, can be used for preparing a reagent and a medicine for detecting retinoblastoma RB1 gene mutation after being assembled into a kit, and has a wide application prospect and market value.

Description

Technical Field

[0001] The present invention relates to the technical field of gene sequencing, and in particular to a probe for detecting retinoblastoma RB1 gene mutation and application thereof. Background Art

[0002] Retinoblastoma (RB) is a malignant tumor that occurs in the retina of the eye. It mainly affects children and is usually found in young children under the age of five. The tumor is formed due to abnormal growth and division of cells in the retina. RB is divided into hereditary and non-hereditary types, of which hereditary RB accounts for about 45% and non-hereditary RB accounts for about 55%. Hereditary RB is usually found in both eyes, and patients may be found in the family. It is caused by mutations in the RB1 gene in germ cells and can be inherited by offspring. Non-hereditary RB is caused by somatic gene mutations, occurs after birth, and is mostly unilateral eye tumors that will not be inherited by offspring. In addition, some RB survivors, especially those with hereditary RB, often develop a second malignant tumor several years later.

[0003] RB1 is a tumor suppressor gene and also a pathogenic gene of RB, located on chromosome 13q14. RB1 gene mutations can be detected in the blood of about 95% of patients with bilateral RB, and RB1 gene mutations cannot be detected in the blood of about 5% of RB patients. Among patients with unilateral RB, about 15% have RB1 gene mutations detected in the blood; in tumor tissues, about 98% of patients with unilateral RB can be detected with RB1 gene mutations, and the remaining 2% of patients have not been detected with RB1 gene mutations, but abnormal amplification of the N-MYC gene exists. At the same time, in addition to RB1 gene mutations in RB, there may be changes in the copy number of other genes, including increased copy number of oncogenes (such as DEK, E2F3, KIF14 and MDM4) and decreased copy number of tumor suppressor genes (such as CDH11). Early detection, early diagnosis, and comprehensive treatment are important factors in determining the survival rate of RB patients. Through RB1 gene testing, it is very important to clarify the genetic type and clinical TNM stage of RB, which is very important for the precise treatment and prevention of RB patients. In addition, RB1 gene testing can assess the risk of RB in the patient's offspring or their parents' subsequent children and reduce the incidence through prenatal diagnosis or preimplantation diagnosis.

[0004] Due to the diversity and complexity of RB1 gene mutations, current detection methods are difficult to capture low-level mosaic mutations. At the same time, the difference between RB1 genotype and phenotype also increases the difficulty of diagnosis: 15% of hereditary RB only affects one eye, and 2% of non-hereditary patients have no mutation in the RB1 gene. Due to low penetrance, carriers of RB1 mutant genes may not necessarily develop the disease. Existing genetic testing methods still have their limitations. Summary of the invention

[0005] The purpose of the present invention is to provide a probe for detecting retinoblastoma RB1 gene mutation and its application. By optimizing the probe design and data analysis process, a high-throughput sequencing method is established with a detection range covering deep mutations in RB1 gene introns, promoter regions, upstream and downstream genes and other common concomitant mutation genes in RB patients. The data output is relatively stable and highly repeatable. After being assembled into a kit, it can be used to prepare reagents and drugs for detecting retinoblastoma RB1 gene mutations, and has broad application prospects.

[0006] The present invention solves the technical problem by adopting the following technical solutions.

[0007] The present invention provides a set of probes, including a plurality of probes that can specifically identify corresponding target genes, and the probes meet the following conditions: (1) The probe is designed based on the longest transcript of the target gene, and its capture interval extends 2 kb above and below the target gene interval; (2) The probe has a base number of 100 bp and a GC content of 20-80%, and has no hairpin structure; (3) The probe avoids repetitive regions on the genome; The target genes include RB1, MYCN, DEK, E2F3, KIF14, CHEK2, BCOR, CDH11, RBL2, MDM4, SYK, TP53, RPGR, and DSPP genes.

[0008] The present invention provides a kit comprising the probe.

[0009] The present invention proposes the use of the probe and / or the kit in gene mutation detection for non-diagnostic purposes.

[0010] The present invention proposes the use of the probe and / or the kit in preparing a reagent and / or a drug for detecting retinoblastoma RB1 gene mutation.

[0011] The present invention provides a method for detecting gene mutations for non-diagnostic purposes, comprising the following steps: S1. After extracting blood DNA, DNA library is constructed after DNA molecule shearing, repair, adapter ligation, purification and polymerase binding; S2, using the probe to perform hybridization capture and library amplification on the DNA library to obtain a PCR product; S3, constructing a PB library using the PCR product as a DNA template; S4. The constructed PB library is subjected to third-generation high-throughput sequencing. After being evaluated as qualified, data reading and bioinformatics analysis are performed to obtain the result of the gene mutation.

[0012] Furthermore, in a preferred embodiment of the present invention, the step of constructing a PB library using the PCR product as a DNA template is as follows: using the PCR product as a DNA template and using SMRTbell Express Template Kit 2.0 reagents to construct the PB library.

[0013] Furthermore, in a preferred embodiment of the present invention, the third-generation high-throughput sequencing is the third-generation PacBio SequelII / IIe high-throughput sequencing.

[0014] Furthermore, in a preferred embodiment of the present invention, the evaluation is performed using SMRT Link.

[0015] The beneficial effects of the probe for detecting retinoblastoma RB1 gene mutation and its application in the embodiment of the present invention are: The present invention is the first to design capture probes for the RB1 gene and its upstream and downstream gene regions, that is, to design capture probes for the full-length sequences of the RB1, MYCN, DEK, E2F3, KIF14, CHEK2, BCOR, CDH11, RBL2, MDM4, SYK, TP53, RPGR, and DSPP genes, and the probe capture interval is extended by 2kb upstream and downstream of the above gene intervals. The optimized probes are used for sequencing on the third-generation PB platform, and the data output is relatively stable and highly repeatable, which can effectively detect various pathogenic variants such as SV, SNV and InDel.

[0016] The present invention optimizes the probe design and data analysis process, and establishes a high-throughput sequencing method that covers deep mutations in the RB1 gene introns, the promoter region, its upstream and downstream genes, and other common associated variant genes in RB patients, so as to more accurately guide clinical patients for treatment and follow-up, and improve the survival rate and eye preservation rate of RB patients in my country. At the same time, a non-invasive production line screening method for the RB1 gene is created. Non-invasive prenatal genetic screening of the RB1 gene can reduce the incidence of RB, reduce the economic burden on the families of RB patients and the country, and save a lot of medical resources. DETAILED DESCRIPTION

[0017] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0018] The probe for detecting retinoblastoma RB1 gene mutation and its application according to the embodiment of the present invention are described in detail below.

[0019] Example 1 (1) Probe design In this embodiment, capture probes are designed for the full-length sequences of RB1, MYCN, DEK, E2F3, KIF14, CHEK2, BCOR, CDH11, RBL2, MDM4, SYK, TP53, RPGR, and DSPP genes. Using hg19 as the reference genome, the longest transcript of the above genes is selected to design capture probes. The full-length, coding region, and start and end position information of the above genes are shown in Table 1, which is downloaded from UCSC. The probe capture interval is extended by 2 kb upstream and downstream of the above gene interval.

[0020] Table 1 Chromosome location information of 14 genes including RB1 in tumors

[0021] (2) Capture interval and probe information Using the Hope Group's exclusive long-fragment capture sequencing technology, probes were synthesized for the RB1, MYCN, DEK, E2F3, KIF14, CHEK2, BCOR, CDH11, RBL2, MDM4, SYK, TP53, RPGR, and DSPP genes. The position information of the designed capture probes is shown in Table 2.

[0022] Table 2 Location information of 14 gene probes including RB1 in tumors

[0023] The number of probes designed in this embodiment is 1891, the number of bases of each probe is 100bp, the GC content value of a single probe is 20-80% and there is no hairpin structure. The average GC content of all probes is 41%. By further performing Blast comparison with databases such as NCBI, it is ensured that the probe avoids the repeated region on the genome. The present invention uses the above parameters to ensure the specificity of the probe. For example, the nucleotide sequences of probe 1 designed according to the regional range (48875883-48875983) of chromosome 13 (Chr13) and probe 2 designed according to the regional range (48876383-48876483) are as follows: Probe 1 (SEQ ID NO.1): TTATCAGTCATGATGCTTTCTGTTGCAAACAAGTGAAAACCTCAGCTCAGCTTAGGTCAGCTCCAGGGCTGGCCAAATCAGAGGCTCATTTATAACACTG; Probe 2 (SEQ ID NO. 2): CAAACCTTTTACACATCCTCACATATGTCATAATATGCAGATAAAAAGATAATCCCTTATACAACTTGCTGGGATAAACTCAGGAGGCTTACAGCCATGAC.

[0024] Example 2 This example tests the capture efficiency of the probe synthesized in Example 1. The specific steps are as follows: (1) Probe PB platform test Take two EDTA whole blood samples as an example, of which two EDTA whole blood samples come from Sichuan Provincial People's Hospital. After nucleic acid extraction and mixed sample library construction, the samples were sequenced using the PB platform. After the data was downloaded, it was quality controlled and split to obtain HiFi Reads for evaluating the probe capture efficiency. Finally, the statistical quantity and Reads information were calculated to evaluate the probe capture efficiency. The specific steps are as follows: (1.1) Sample processing: 5 mL of venous blood was collected using EDTA anticoagulation blood collection tubes and stored at -20°C. Blood DNA was then extracted using a blood extraction kit (Meiji Biotechnology, IVD3102-F-96).

[0025] (1.2) Library construction before hybridization capture: After the DNA molecules are broken, they are repaired, connected to adapters, purified and polymerase bound. The DNA library is then ready for sequencing. The specific steps are as follows: Take 3μg DNA sample for physical shearing. Then use Damage Repair End Preparation end repair enzyme to repair DNA. The repair system is: End Prep Buffer 5μL, End Prep Enzyme 2.5μL, DNA Damage Repair Enzyme 1.5ul, fragmented DNA 25μL, total volume 34μL. The repair procedure is: 20℃ 30min; 65℃ 20min; hot cover 105℃.

[0026] The repaired DNA was connected with a Barcode adapter. 1.5 μL (5 μM) of adapter was added to the end repair system, and then the Adapter was connected to the DNA fragment using Rapid DNA ligase. The reaction system was: Rapid Ligation buffer 212.5 μL, Rapid DNA ligase 2.5 μL, repair DNA 34 μL, and a total volume of 50.5 μL. The repair procedure was: 20°C for 60 min, with the hot lid closed.

[0027] The ligation product was purified by Agencourt AMPure XP magnetic beads (Beckman Coulter, A63882). Finally, the library was amplified, and the reaction system was: 5×GXL Buffer 10 μL, dNTP Mixture 4 μL, GXL DNA Polymerase 1 μl, Primer P21 / P7 1 μl each, Adapter DNA 10 μL, and water was added to a total volume of 50 μL. The reaction procedure is shown in Table 3: Table 3 Reaction procedure

[0028] The PCR products were purified using Ampure magnetic beads, quantified by Qubit, and detected by agarose gel electrophoresis.

[0029] (1.3) Hybridization capture and library amplification S1. Mix equal amounts of amplified products according to actual conditions. Use 500ng for single capture and 1000ng for mixed capture. You can choose to mix 1 to 5 samples for capture. Add the concentration system: Human Cot1 DNA 5ul, blcU 6ul, Barcodeblocker, place in a vacuum concentrator, and evaporate the concentration system to dryness.

[0030] S2, add hybridization system: 2× Hybridization Buffer 8.5ul, Hybridization Buffer Enhancer 2.7ul, NF H 2 The reaction program was as follows: 95°C for 11 min, 65°C for 16 h, 65°C ∞; when the reaction program reached 95°C for 10 min, 4 μL of the probe was quickly added.

[0031] S3. Add the hybridization reaction to M280 magnetic beads (Invitrogen, 60101) washed with 1× Bead Wash Buffer, incubate at 65°C for 45 min, and wash the incubation system with washing reagents Wash Buffer Ⅰ, Wash Buffer Ⅱ, Wash Buffer Ⅲ, and Stringent Wash Buffer in sequence.

[0032] S4, finally add 21 μL NF H 2 O elution, the product was divided into 7ul each tube, one tube of product was reserved as a backup, and the remaining two tubes of products were used for hybridization amplification.

[0033] S5, Post-PCR amplification system: 5×GXL Buffer 10μL, dNTP Mixture 4μL, GXL DNA Polymerase 1ul, Primer P5 / P7 1ul each, hybridization purification product 7μL, add water to a total volume of 50ul. The reaction procedure is shown in Table 4: Table 4 Reaction procedure

[0034] The final product was purified by magnetic beads, and the concentration was determined using the Qubit dsDNA HS Assay Kit and detected using a 2100 Bioanalyzer.

[0035] (1.4) PB library construction The PCR product was used as a DNA template and the SMRTbell Express Template Kit 2.0 reagent (PacBio) was used to construct a DNA library. The specific steps were as follows: Take ≤500ng of PCR product and add the following components, place in a thermal cycler and run the following program: 37°C, 30min; 4°C, ∞. The repair system is: DNA Prep Buffer 7μL, DNA Damage Repair Mix 2 μL, NAD0.6ul, purified DNA ≤47.4 μL, add water to a total volume of 57μL.

[0036] After the program is completed, add 3µL End Prep Mix, place in a thermal cycler and run the following program: 20°C, 30min; 65°C, 30min; 4°C, ∞. After the above program is completed, add the following components: Overhang Adapter V3 3μL, Ligation Mix 30μL, Ligation Enhancer 1μL, Ligation Additive 1μL, end repair product 60μL, total 95ul. Place in a thermal cycler and run the following program: 20°C, 60min; 4°C, ∞.

[0037] The final product was purified by magnetic beads, and the concentration was determined using the Qubit dsDNA HS Assay Kit and detected using a 2100 Bioanalyzer.

[0038] (1.5) Sequencing The constructed DNA library was used for third-generation PacBio Sequel II / IIe high-throughput sequencing. After the sequencing data was evaluated as qualified by SMRT Link, data reading and bioinformatics analysis were performed.

[0039] (2) Test data output and capture efficiency analysis In terms of data output, the two samples produced 95.57Mb and 128.12Mb of Raw data respectively, of which the captured interval data output was 69.79Mb and 96.47Mb respectively, and the captured interval data ratio reached 73.02% and 75.30% respectively.

[0040] From the output of reads, the number of Raw reads produced by the two samples was 20748 and 31319, of which the number of Mapped Reads was 20295 and 31259, and the alignment rates reached 99.80% and 97.81%, respectively. The number of Reads in the captured interval in Mapped Reads was 15685 and 24564, respectively, and the capture efficiency reached 77.29% and 78.58%, respectively. The average length of Reads was 4606.43bp and 4090.83bp, respectively, and the average sequencing depth of the target region was 97.17 and 103.91, respectively, the 1X coverage was 100.00% and 100.00%, respectively, and the 30X coverage was 97.49% and 97.67%, respectively. For details, see Table 5. The average sequencing depth and data details of each target region are shown in Table 6.

[0041] Table 5 Summary of the overall test data output and efficiency of the tumor RB1 probe

[0042] Table 6 Summary of test data output and efficiency for each target interval of tumor RB1 probe RB1 CNXY2400001913 CNXY2400002012 #total_reads total_base mapped_reads mapped_reads_ratio mapped_base mapped_base_ratio #total_reads total_base mapped_reads mapped_reads_ratio mapped_base mapped_base_ratio 31319 128120588 31259 99.808423 127894493 99.82352953 20748 95574309 20295 97.81665703 94848482 99.24056265 #position AverageDepth MappedReads MappedReads_ratio MappedBase MappedBase_ratio #position AverageDepth MappedReads MappedReads_ratio MappedBase MappedBase_ratio 13_48877883_49056026 105.73 4610 14.71949935 18836414 14.70209768 13_48877883_49056026 80.01 3109 14.98457683 14256501 14.91666657 2_16080683_16087129 64.25 189 0.603467544 416792 0.325312275 2_16080683_16087129 41.81 106 0.510892616 271445 0.284014609 6_18224000_18264799 93.29 1004 3.205721766 3810466 2.974124658 6_18224000_18264799 63.57 612 2.949681897 2596856 2.717106749 6_20402137_20493945 102.55 2327 7.429994572 9418026 7.350907568 6_20402137_20493945 71.82 1453 7.003084635 6595299 6.900702782 1_200520625_200589862 86.76 1551 4.952265398 6010484 4.691271008 1_200520625_200589862 70.34 1093 5.267977636 4872913 5.098559488 22_29083731_29137822 58.1 847 2.704428622 3147279 2.456497468 22_29083731_29137822 45.82 577 2.780990939 2480532 2.595396217 X_39910499_39956719 80.1 983 3.138669817 3703222 2.890419142 X_39910499_39956719 53.45 571 2.752072489 2477204 2.591914109 16_64980683_65155919 137.9 6096 19.464223 24167173 18.86283335 16_64980683_65155919 89.12 3348 16.13649508 15619441 16.34271926 16_53468351_53525560 97.1 1411 4.505252403 5556631 4.337032078 16_53468351_53525560 82.34 1093 5.267977636 4715221 4.933565358 1_204485507_204527248 85.69 923 2.947092819 3581506 2.795418017 1_204485507_204527248 61.16 606 2.920763447 2555010 2.673323016 9_93564012_93660842 109.82 2654 8.474089211 10636134 8.301658747 9_93564012_93660842 84.51 1844 8.887603624 8187394 8.566521784 17_7571720_7590868 53.1 334 1.066445289 1018584 0.795019767 17_7571720_7590868 44.04 243 1.171197224 846447 0.885642814 X_38143702_38186788 115.35 1333 4.256202305 4973700 3.882045874 X_38143702_38186788 83.58 851 4.101600154 3606404 3.773403164 4_88529681_88538025 144.49 390 1.245250487 1209045 0.943677374 4_88529681_88538025 85.59 219 1.055523424 724034 0.757561323 In summary, the data output of the probe of the present invention after being tested on the third-generation PB platform is relatively stable and highly repeatable. Under the premise of ensuring the sequencing depth and coverage of RB1, MYCN, DEK, E2F3, KIF14, CHEK2, BCOR, CDH11, RBL2, MDM4, SYK, TP53, RPGR, and DSPP genes, the average capture efficiency reaches 78% (2 samples), and it is expected that various pathogenic variation types such as SV, SNV and InDel can be effectively detected.

[0043] The embodiments described above are part of the embodiments of the present invention, rather than all of the embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

Claims

1. A set of probes, characterized in that, It includes multiple probes that can specifically identify corresponding target genes, and the probes meet the following conditions: (1) The probe is designed based on the longest transcript of the target gene, and its capture interval extends 2 kb above and below the target gene interval; (2) The probe has a base number of 100 bp and a GC content of 20-80%, and has no hairpin structure; (3) The probe avoids repetitive regions on the genome; The target genes include RB1, MYCN, DEK, E2F3, KIF14, CHEK2, BCOR, CDH11, RBL2, MDM4, SYK, TP53, RPGR, and DSPP genes.

2. A kit, characterized in that: Comprising the probe according to claim 1.

3. Use of the probe according to claim 1 and / or the kit according to claim 2 in detecting gene mutations for non-diagnostic purposes.

4. Use of the probe according to claim 1 and / or the kit according to claim 2 in the preparation of reagents and / or drugs for detecting retinoblastoma RB1 gene mutation.

5. A method for detecting gene mutations for non-diagnostic purposes, characterized in that: The following steps are involved: S1. After extracting blood DNA, DNA library is constructed after DNA molecule shearing, repair, adapter ligation, purification and polymerase binding; S2. Using the probe as described in claim 1 to perform hybridization capture and library amplification on the DNA library to obtain a PCR product; S3, constructing a PB library using the PCR product as a DNA template; S4. The constructed PB library is subjected to third-generation high-throughput sequencing. After being evaluated as qualified, data reading and bioinformatics analysis are performed to obtain the result of the gene mutation.

6. The gene mutation detection method according to claim 5, characterized in that: In step S3, the step of constructing a PB library using the PCR product as a DNA template is as follows: using the PCR product as a DNA template and using SMRTbell ExpressTemplate Kit 2.0 reagents to construct the PB library.

7. The gene mutation detection method according to claim 5, characterized in that: In step S4, the third-generation high-throughput sequencing is the third-generation PacBio Sequel II / IIe high-throughput sequencing.

8. The gene mutation detection method according to claim 5, characterized in that: In step S4, the evaluation is performed using SMRT Link.

Images