5'-tiRNA, a highly expressed molecular marker for gastric cancer screening Gly

Abstract

The application provides a high-expression molecular marker 5'-tiRNA for gastric cancer screening Gly , and relates to the technical field of biomedicine. The application provides a high-expression molecular marker for gastric cancer screening, characterized in that the molecular marker is 5'-tiRNA Gly , and the 5'-tiRNA Gly is derived from the 5'-half of tRNA-Gly-GCC. The application proves that the 5'-tiRNA Gly can be used as a gastric cancer diagnosis marker, and can be used for diagnosing and predicting gastric cancer by detecting the expression amount of the 5'-tiRNA Gly in serum, and has the advantages of high specificity and sensitivity.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and more particularly to a highly expressed molecular marker, 5′tiRNA, for gastric cancer screening. Gly . Background Technology

[0002] Gastric cancer is one of the most common malignant tumors worldwide, ranking fifth in incidence and fourth in mortality. Early-stage gastric cancer often presents with no obvious symptoms. Furthermore, traditional biomarkers for gastric cancer screening have low sensitivity and specificity, leading to many patients being diagnosed at an advanced stage with poor prognosis. While substantial progress has been made in the treatment of gastric cancer in recent years, further research and development are still needed. Current biomarkers for gastric cancer, including carcinoembryonic antigen (CEA), carbohydrate antigen 199 (CA199), and carbohydrate antigen 724 (CA724), have low positive rates in diagnosing gastric cancer. Therefore, exploring highly sensitive and specific diagnostic biomarkers for gastric cancer and their specific mechanisms of action is of great clinical significance.

[0003] tRNA-derived small RNAs (tsRNAs) have been found to be derivative fragments produced by specific cleavage of precursor tRNA or mature tRNA by different nucleases under specific conditions. Based on the cleavage site, they can be divided into tRNA-derived fragments (tRFs) and tRNA halves (tiRNAs). tsRNAs show significant differences in the bodily fluids of various cancer patients, exhibiting good diagnostic efficacy and the potential to become excellent tumor diagnostic biomarkers. Combining tsRNAs with liquid biopsy technology to screen for tsRNAs that show significant differences in the bodily fluids of gastric cancer patients, and then clinically monitoring tumor progression in real time by detecting and analyzing the expression levels of tsRNAs in patients' bodily fluid samples, will open up a new avenue for the clinical diagnosis of gastric cancer.

[0004] tsRNAs exert biological functions through various regulatory mechanisms, including interacting with proteins or mRNAs to regulate gene transcription and translation, epigenetic modifications, and the cell cycle. With the development of high-throughput sequencing technology, increasing research has revealed a close correlation between tsRNA dysregulation and tumor development. Therefore, identifying dysregulated tsRNAs in gastric cancer and exploring their specific mechanisms of action is of great significance for the diagnosis and treatment of gastric cancer. Summary of the Invention

[0005] The purpose of this invention is to identify dysregulated tsRNAs in gastric cancer and explore their specific mechanisms of action for the diagnosis and treatment of gastric cancer.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A highly expressed molecular biomarker for gastric cancer screening, characterized in that: the molecular biomarker is 5′-tiRNA. Gly The 5′-tiRNA Gly It originates from the 5'-half of tRNA-Gly-GCC.

[0008] This application also provides the aforementioned 5′-tiRNA. Gly Application of it as a detection target in the preparation of products for diagnosing gastric cancer.

[0009] Preferably, the product is a reagent or a kit.

[0010] Preferably, the product is validated by 5′-tiRNA. Gly The expression of [a specific substance] can be dynamically monitored to assess the prognosis of gastric cancer patients.

[0011] Based on the above applications, this application provides a detection kit for gastric cancer, characterized in that: the detection kit uses 5′-tiRNA. Gly To detect target points.

[0012] Preferably, the test kit also includes other medically acceptable reagents.

[0013] This application also provides the aforementioned 5′-tiRNA. Gly Application of target in the preparation of products for treating gastric cancer.

[0014] Preferably, the drug is used to inhibit 5′-tiRNA. Gly .

[0015] Compared with the prior art, this application has the following beneficial effects:

[0016] (1) This invention is the first to discover and confirm the high expression of 5′-tiRNA. Gly It can be used as a diagnostic marker for gastric cancer by detecting 5′-tiRNA in serum. Gly The expression level can be used to diagnose and predict gastric cancer, and can also distinguish gastric cancer patients from gastritis patients. It is convenient to sample, easy to detect, and has the advantages of high sensitivity and specificity.

[0017] (2) The present invention detected that 5′-tiRNA Gly Its expression in gastric cancer tissues was significantly higher than that in adjacent normal tissues; its expression in the serum of gastric cancer patients was significantly higher than that in healthy individuals; and its expression in gastric cancer cells was higher than that in human gastric mucosal epithelial cell lines. The 5′-tiRNA level in the serum of gastric cancer patients was also higher. GlyThe expression level of 5′-tiRNA was associated with T stage, lymph node metastasis, TNM stage, and nerve / vascular invasion; in gastric cancer patients after surgery, 5′-tiRNA expression .... Gly The expression level of 5′-tiRNA decreased, demonstrating that the expression level of 5′-tiRNA was reduced. Gly It can serve as a diagnostic marker for gastric cancer and dynamically monitor the prognosis of gastric cancer patients;

[0018] (3) This invention discovered that 5′-tiRNA Gly It exhibits good stability, its detection method is not easily affected by external factors, has good reproducibility, and the SYBR Green fluorescent dye method can simultaneously detect 5′-tiRNA without the need for separately designed probes. Gly It contains internal reference genes and is economical and convenient;

[0019] (4) The biomarker 5′-tiRNA provided by this invention Gly Its sensitivity in distinguishing between gastric cancer patients and healthy individuals in serum reached 0.74, with a specificity of 0.87 and an AUC of 0.837, which is higher than that of conventional gastric cancer biomarkers CEA, CA199, and CA724. Moreover, the AUC continued to increase after being combined with these three, reaching its maximum value when all four were combined, further enhancing the 5′-tiRNA. Gly Diagnostic efficacy;

[0020] (5) The present invention detected that 5′-tiRNA Gly Similarly, 5′-tiRNA can distinguish between patients with gastric cancer and patients with gastritis. Gly The expression of 5′-tiRNA in the serum of gastric cancer patients was significantly higher than that in gastritis patients. Gly The AUC in patients with gastric cancer and gastritis was 0.779, which was higher than that of CEA, CA199 and CA724. Moreover, the AUC continued to increase after being combined with these three, and reached its maximum value after the combination of all four.

[0021] (6) The 5′-tiRNA of the present invention Gly Associated with gastric cancer proliferation, 5′-tiRNA was used in a PDX model. Gly Antagomir can inhibit tumor growth. Antagomir has cholesterol modification at the 3' end, two thiocarbamate modifications at the 5' end, four thiocarbamate modifications at the 3' end, and full-chain methoxy modification. It has higher affinity for cell membranes and can accumulate in target cells to achieve highly efficient, specific, and stable interference. The drug candidate is a biological product for the effective treatment of gastric cancer.

[0022] (7) The present invention infers 5′-tiRNA based on experimental results. Gly It has an inhibitory effect on the Warburg effect in gastric cancer cells, and further studies have found that OGDHL can act as a 5′-tiRNA.Gly The target molecules affecting gastric cancer were elucidated, revealing 5′-tiRNA. Gly The mechanism by which the Warburg effect is regulated in gastric cancer cells provides a new target and technical support for targeted therapy of gastric cancer. Attached Figure Description

[0023] Figure 1 5′-tiRNA in gastric cancer tissue Gly The filtering; among which: Figure 1 A shows a heatmap of differentially expressed tsRNAs in three pairs of GC tissues and adjacent normal tissues; Figure 1 B represents the detection of 5′-tiRNA in 50 pairs of GC tissues by qRT-PCR. Gly The level of expression; Figure 1 C represents 5′-tiRNA from the UCSC database. Gly Biological information; Figure 1 D represents 5′-tiRNA in MINTbase v2.0. Gly Biological information; Figure 1 E is 5′-tiRNA Gly Structural diagram; Figure 1 F is 5′-tiRNA Gly Amplification curves; Figure 1 G is 5′-tiRNA Gly The melting curve;

[0024] Figure 2 To detect 5′-tiRNA Gly Methodological evaluation; including: Figure 2 A 5′-tiRNA was placed at room temperature and subjected to repeated freeze-thaw cycles for a period of time. Gly ct value; Figure 2 B represents the detection of 5′-tiRNA by agarose gel electrophoresis. Gly ;

[0025] Figure 3 5′-tiRNA Gly Diagnostic value in serum for gastric cancer; among which: Figure 3 A represents the detection of 5′-tiRNA in the serum of patients with gastric cancer and gastritis, and healthy individuals using qRT-PCR. Gly The level of expression; Figure 3 B represents 5′-tiRNA in gastric cancer patients before and after surgery. Gly Comparison of expression levels; Figure 3 C-3E is a 5′-tiRNA. Gly Independent and combined ROC analyses of CEA, CA199, and CA724 in the serum of gastric cancer patients and healthy individuals; Figure 3 F-3H is a 5′-tiRNA. GlyIndependent and combined ROC analyses of CEA, CA199, and CA724 in the serum of patients with gastric cancer and gastritis;

[0026] Figure 4 5′-tiRNA Gly Functional studies both in vivo and in vitro; including: Figure 4 A represents the detection of 5′-tiRNA by qRT-PCR. Gly Expression levels in GC cell lines; Figure 4 B represents the detection of 5′-tiRNA by qRT-PCR. Gly Transfection efficiency; Figure 4 C and 4D are CCK-8 assays used to detect transfection with 5′-tiRNA. Gly The effects of inhibitors and mimics on the proliferation capacity of GC cells; Figure 4 E and 4F are clone formation assays to detect transfection with 5′-tiRNA. Gly The effects of inhibitors and mimics on the proliferation capacity of GC cells; Figure 4 G and 4H are used in the EdU assay to detect transfection with 5′-tiRNA. Gly The effects of inhibitors and mimics on the proliferation capacity of GC cells; Figure 4 I is a schematic diagram of a PDX model of gastric cancer; Figure 4 J represents the size of the tumor; Figure 4 K is the weight of the tumor; Figure 4 L represents the tumor inhibition rate; Figure 4 M represents the HE and IHC staining results of the tumor tissue;

[0027] Figure 5 5′-tiRNA gly Targeted regulation of OGDHL expression; wherein: Figure 5 A represents the detection of 5′-tiRNA by FISH assay. Gly Cellular localization; Figure 5 B is 5′-tiRNA Gly The proportion of nucleoplasm in the cell; Figure 5 C represents the KEGG biological pathway enrichment analysis of 5′-tiRNA. Gly Functions; Figure 5 D represents the prediction of 5′-tiRNA using the miRanda and TargetScan databases. Gly Potential downstream target genes; Figure 5 E represents the intersection of target genes from two databases, along with metabolic pathways and glycolysis processes, jointly predicting 5′-tiRNA. Gly Potential downstream target genes; Figure 5 F represents the detection of 5′-tiRNA transfection. Gly Expression levels of three target genes in two GC cells following the mimicry; Figure 5G is a schematic diagram of a dual-luciferase reporter gene experiment; Figure 5 H represents a dual-luciferase reporter gene assay to verify the interaction between OGDHL and 5′-tiRNA. Gly The relationship of combination;

[0028] Figure 6 5′-tiRNA Gly Targeting OGDHL promotes the Warburg effect and progression of gastric cancer; among which: Figure 6 A is for detecting 5′-tiRNA transfection. Gly Changes in glucose uptake and lactate production after using inhibitors and mimics; Figure 6 B represents the expression level of OGDHL in the TCGA and GTEx databases; Figure 6 C represents the expression level of OGDHL in gastric cancer tissue; Figure 6 D represents the expression level of OGDHL in gastric cancer cell lines; Figure 6 E represents the effect of overexpression and interference with OGDHL on the proliferative capacity of gastric cancer cells as determined by the CCK-8 assay. Figure 6 F represents the effect of overexpression and interference of OGDHL on the proliferation capacity of GC cells as detected by a clonogenic assay. Figure 6 G represents the effect of overexpression and interference of OGDHL on the proliferation capacity of GC cells as determined by the EdU assay. Figure 6 H represents 5′-tiRNA. Gly The effects of mimics and inhibitors in CCK-8 assays were reverted to those of OGDHL overexpression or interference; Figure 6 I is 5′-tiRNA Gly The effects of mimics and inhibitors in clonogenic assays were reverted to those of OGDHL overexpression or interference; Figure 6 J is 5′-tiRNA Gly The effects of mimics and inhibitors on glucose uptake and lactate production were restored by OGDHL overexpression or interference. Detailed Implementation

[0029] The present invention will be further described in detail below with reference to specific embodiments.

[0030] A highly expressed molecular biomarker for gastric cancer screening, said biomarker being 5′-tiRNA. Gly The 5′-tiRNA Gly It originates from the 5'-half of tRNA-Gly-GCC.

[0031] Based on the above, this application also provides 5′-tiRNA. Gly Application in the preparation of diagnostic products for gastric cancer, wherein the product is a reagent or kit.

[0032] The product was validated through 5′-tiRNA. Gly The expression of [a specific substance] can be dynamically monitored to assess the prognosis of gastric cancer patients.

[0033] This application also provides a detection kit for gastric cancer, wherein the detection kit uses 5′-tiRNA. Gly To detect target points.

[0034] In one embodiment, the test kit also includes other medically acceptable reagents.

[0035] The above content is verified through specific verification experiments:

[0036] Example 1: Expression profile of tsRNA and 5′-tiRNA in gastric cancer tissue Gly Filtering

[0037] To identify novel biomarkers in gastric cancer tissue and investigate their molecular mechanisms, this application collected three pairs of gastric cancer and adjacent normal tissues for tsRNA sequencing. Figure 1 A). Based on the average expression levels and fluorescence signal uniformity of each group, the top three tsRNAs with significantly upregulated expression were selected for validation in this application. qRT-PCR results showed that 5′-tiRNA Gly The expression was significantly higher in 50 pairs of gastric cancer tissues than in the corresponding adjacent normal tissues. Figure 1 B). The UCSC database shows that 5′-tiRNA Gly Located on chromosome chr1:161,413,094-161,413,124, with a length of 31 nt. Figure 1 C). The MINTbase database shows that 5′-tiRNA Gly It originates from the 5'-half of tRNA-G1y-GCC, and the cleavage site is shown in the figure. Figure 1 D and 1E). The smooth amplification curve and single-peak melting curve demonstrate the specificity of this detection method. Figure 1 F and 1G).

[0038] Example 2: 5′-tiRNA Gly Methodological evaluation

[0039] To investigate the detection of 5′-tiRNA Gly Whether the expression level method can be applied to clinical analysis was comprehensively evaluated in this application. Firstly, serum mixtures were used to test its accuracy, and 5′-tiRNA was found in this application. GlyThe results showed good intra-batch coefficient of variation (CV) and inter-batch CV, at 1.97% and 2.18%, respectively (Table 1). Subsequently, room temperature storage and repeated freeze-thaw experiments revealed 5′-tiRNA... Gly The expression levels did not differ significantly with these conditions (P > 0.05). Figure 2 A) indicates that 5′-tiRNA Gly The detection method is not easily affected by external factors and exhibits good stability and reproducibility. Agarose gel electrophoresis showed that 5′-tiRNA... Gly The size of the qRT-PCR product is approximately 80 bp. Figure 2 B).

[0040] Table 1 5′-tiRNA Gly Inter-batch CV and intra-batch CV

[0041]

[0042] Example 3: 5′-tiRNA Gly A novel serum biomarker for gastric cancer

[0043] To investigate 5′-tiRNA Gly To determine whether it has the potential to become a serum biomarker for gastric cancer, this application detected 5′-tiRNA. Gly Expression levels in the serum of 118 patients with gastric cancer, 52 patients with gastritis, and 105 healthy individuals undergoing physical examinations.

[0044] qRT-PCR results showed that 5′-tiRNA was present in gastric cancer patients. Gly The expression level was significantly higher than that of patients with gastritis and healthy individuals undergoing physical examinations. Figure 3 A). Furthermore, in gastric cancer patients after surgery, 5′-tiRNA... Gly The expression level decreased ( Figure 3 B).

[0045] ROC curve analysis showed that 5′-tiRNA Gly It exhibits excellent diagnostic efficacy (sensitivity 0.74, specificity 0.87, AUC 0.837) for differentiating gastric cancer, superior to CEA, CA199, and CA724. Figure 3 C; Table 2). The AUC increased continuously after combination with these three, reaching its maximum after combination with all four, further enhancing 5′-tiRNA. Gly Diagnostic efficacy ( Figure 3 D-3E).

[0046] Because gastritis and early-stage gastric cancer symptoms are similar and difficult to distinguish, this application further performed ROC analysis on 118 gastric cancer patients and 52 gastritis patients. The results showed 5′-tiRNA... Gly The AUC was higher than that of CEA, CA199, and CA724, and further improved after combination, consistent with previous results. Figure 3 F-3H), indicating 5′-tiRNA Gly It can also distinguish between patients with gastric cancer and those with gastritis, and has the potential to become a diagnostic marker for gastric cancer. To investigate 5′-tiRNA... Gly Whether it has clinical application value is determined in this application based on 5′-tiRNA. Gly Based on the median expression level in the serum of gastric cancer patients, 118 gastric cancer patients were divided into a relatively high expression group (N=59) and a relatively low expression group (N=59). Chi-square test results showed that 5′-tiRNA... Gly The expression level of [the substance] was associated with T stage, lymph node metastasis, TNM stage and nerve / vascular invasion, but not with other pathological parameters (Table 3).

[0047] The above results indicate that serum 5′-tiRNA Gly It has high diagnostic efficacy in gastric cancer diagnosis and has the potential to become a gastric cancer biomarker and dynamically monitor the prognosis of gastric cancer patients.

[0048] Table 2 5'-tiRNA Gly Diagnostic efficacy in gastric cancer serum

[0049]

[0050] Table 3 Serum 5'-tiRNA Gly Correlation studies with clinicopathological parameters

[0051]

[0052] Example 4: 5′-tiRNA Gly Promotes the proliferation of gastric cancer cells and affects tumor growth in PDX models.

[0053] This application further investigates 5′-tiRNA. Gly To investigate its biological function in gastric cancer, its expression level in gastric cancer cell lines was first examined, revealing significantly increased expression in HGC-27, MKN-45, and AGS. Figure 4 A). In this application, 5′-tiRNA was transfected into AGS and MKN-45, which have relatively high expression levels. Gly Inhibitors, while 5′-tiRNA was transfected in HGC-27 and MKN-45, where expression levels were relatively low. GlyThe simulant showed good transfection results. Figure 4 B). CCK8, clonogenesis, and EdU assays showed that transfection with 5′-tiRNA... Gly Inhibitors reduced the proliferative capacity of gastric cancer cells, while transfection with 5′-tiRNA... Gly The proliferative capacity of gastric cancer cells was enhanced after the use of the mimicry. Figure 4 (C-4H). Subsequently, a PDX model was constructed in this application, and the clinical chemotherapy drug 5-FU was set as a control to test 5′-tiRNA in vivo. Cly Does it have the same inhibitory effect on gastric cancer? Figure 4 I). The results showed that, compared with the antagonist control group, injection of 5′-tiRNA... Gly Tumor volume decreased after antagonist treatment. Figure 4 J), weight reduction Figure 4 K), growth is inhibited ( Figure 4 L). In addition, 5′-tiRNA Gly The antagonist also inhibited the expression of Ki67 protein in tumor tissue and promoted the expression of Cleaved caspase3 protein. Figure 4 M). The above results suggest that 5′-tiRNA Gly It can promote the progression of gastric cancer both in vitro and in vivo.

[0054] Example 5: 5′-tiRNA Gly Directly targeting OGDHL and regulating OGDHL expression to further investigate 5′-tiRNA Gly The mechanism promoting malignant progression of gastric cancer, as described in this application, is FISH (…). Figure 5 A) and nuclear-cytoplasmic separation ( Figure 5 B) The experiment detected 5′-tiRNA. Gly Subcellular localization revealed that it is primarily located in the cytoplasm, and may exert its biological function by regulating downstream target genes through miRNA-like mechanisms. KEGG enrichment analysis showed that its target genes are mainly enriched in metabolic pathways. Figure 5 C). Next, 5′-tiRNA was predicted using the miRanda and TargetScan databases in this application. Gly target genes ( Figure 5 D), combining the metabolic pathways in KEGG (Pathway ID: hsa01100) and the glycolysis process in GO (GOID: 0006096), three potential target genes (OGDHL, OGDH, and PFKL) were further screened. Figure 5 E). qRT-PCR results showed that transfection with 5′-tiRNA... Gly Only OGDHL expression decreased significantly after the mimicry. Figure 5F). Dual-luciferase reporter gene assays showed that transfection with 5′-tiRNA... Gly The fluorescence intensity of OGDHL-WT decreased after the mimicry was applied, but had no effect on OGDHL-MUT, suggesting the presence of 5′-tiRNA. Gly There may be a combination relationship with OGDHL. Figure 5 G, 5H). The above experiments suggest that 5′-tiRNA Gly Targeting OGDHL reduces OGDHL expression in gastric cancer.

[0055] Example 6: 5′-tiRNA Gly Combining with OGDHL promotes the Warburg effect and progression of gastric cancer.

[0056] KEGG enrichment analysis showed 5′-tiRNA Gly The target genes are mainly enriched in metabolic pathways. Since the Warburg effect is a common feature of metabolic disorders in tumor cells, this application focuses on transfecting 5′-tiRNA. Gly After using inhibitors and mimics, glucose uptake and lactate production in gastric cancer cells were examined. Results showed that transfection with 5′-tiRNA... Gly Inhibitors reduced both glucose uptake and lactate production in gastric cancer cells, while transfection with 5′-tiRNA resulted in decreased levels. Gly The results were reversed after using the mimicry, suggesting the presence of 5′-tiRNA. Gly It may promote the Warburg effect in gastric cancer cells. Figure 6 A).

[0057] OGDHL is an important component of OGDHC, a key enzyme in the tricarboxylic acid cycle. qRT-PCR results showed that OGDHL expression levels were significantly reduced in gastric cancer tissues, consistent with results from the TCGA STAD database. Figure 6 B, 6C). OGDHL expression was decreased in gastric cancer cell lines HGC-27, AGS, and MKN-45. Figure 6 D). To evaluate the biological role of OGDHL in gastric cancer, this application constructed an AGS cell line stably overexpressing OGDHL and an shRNA interference vector. CCK8, colony formation, and EdU assays showed that the AGS cell line stably overexpressing OGDHL exhibited decreased proliferation, while OGDHL knockdown enhanced the proliferation of HGC-27 cells, suggesting that OGDHL can inhibit the malignant progression of gastric cancer. Figure 6 E-6G). Subsequently, rescue experiments were performed in this application, and the results showed that overexpression of OGDHL could recover 5′-tiRNA. Gly The mimicry promoted the proliferation of gastric cancer cells as well as glucose uptake and lactate production, while knocking down OGDHL could recover 5′-tiRNA.Gly The inhibitory effect of the inhibitor on the proliferation of gastric cancer cells, as well as on glucose uptake and lactic acid production. Figure 6 H-6J). The above results suggest that 5′-tiRNA Gly Promoting the Warburg effect and progression of gastric cancer by targeting OGDHL.

[0058] The following are some of the experimental steps used in the above embodiments:

[0059] I. Raw Materials and Reagents

[0060] 1. Specimen Collection: Fifty pairs of gastric cancer tissue and adjacent normal tissue (including 3 pairs for tsRNA sequencing) were collected from the Affiliated Hospital of Nantong University between 2019 and 2021. Serum samples were obtained from 118 gastric cancer patients, 105 healthy controls, 52 patients with gastritis, and 39 gastric cancer patients who underwent surgery 7 days prior. All gastric cancer patients underwent pathological diagnosis of gastric cancer. Informed consent was obtained from all patients involved in this study, and the study protocol was approved by the local hospital ethics committee.

[0061] 2. tsRNA sequencing: Total RNA was extracted from the samples, and the quality and integrity of the RNA were assessed. A small RNA library was then constructed, and after passing quality control, tsRNA sequencing was performed on the HiSeq 2500 platform in SE50 mode, completed by Guangzhou Ribo Biotechnology Co., Ltd.

[0062] 3. Total RNA extraction:

[0063] (1) Steps for extracting total RNA from blood: Use the BioTeke Total RNA Rapid Extraction Kit (centrifuge column type). Add 900 μL of lysis buffer RLS to 300 μL of serum sample, and pipette the liquid sample to aid lysis; vortex the homogenate sample vigorously for at least 1 minute, and incubate at 15-30℃ for 5 minutes to ensure complete ribosome breakdown; add 200 μL of chloroform, shake vigorously for 15 seconds and incubate at room temperature for 3 minutes; centrifuge at 12000 rpm for 10 minutes at 4℃. The sample will separate into three layers: a lower organic phase, a middle layer, and an upper colorless aqueous phase. RNA is present in the aqueous phase. The volume of the aqueous phase is approximately 60% of the volume of the added lysis buffer RLS. Transfer 700 μL of the aqueous phase to a new tube; add 1 volume of 70% ethanol, invert and mix; aspirate the resulting solution... Transfer 700 μL of the solution to the adsorption column RA, centrifuge at 12000 rpm for 1 minute, discard the waste liquid, and put the adsorption column back into the collection tube; transfer the remaining 700 μL of the solution back to the adsorption column RA, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid; add 500 μL of protein removal solution RE, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid; add 700 μL of wash buffer RW, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid; centrifuge at 12000 rpm for 2 minutes to remove as much wash buffer as possible; remove the adsorption column RA and place it in an RNase-free centrifuge tube. Add 50-80 μL of DEPC water (preheated in a 65-70℃ water bath) to the middle of the adsorption membrane according to the expected RNA yield, incubate at room temperature for 2 minutes, centrifuge at 12000 rpm for 1 minute, and collect the original RNA solution.

[0064] (2) Extraction steps for total RNA from cells: Aspirate the cells to be treated from the culture medium, rinse once with PBS, add 500 μL of RNA-easy Isolation Reagent (Vazyme) for lysis for 15 minutes, and then transfer to a 1.5 mL EP tube; add 200 μL of DEPC water to the lysis buffer for extraction, mix well, and let stand for 5 minutes; centrifuge at 12000 g at room temperature for 15 minutes; remove the EP tube, the solution will separate into an upper aqueous phase and a dark lower precipitate, carefully transfer the upper aqueous phase to a new EP tube; add an equal volume of isopropanol, mix well, and let stand at room temperature for 10 minutes; centrifuge at 12000 g at room temperature for 10 minutes, a white precipitate will be visible, carefully discard the supernatant; add 500 μL of 75% ethanol, gently tap the bottom of the tube to suspend the precipitate, and invert several times; centrifuge at 7500 g at room temperature for 10 minutes, discard the supernatant, invert the EP tube, and remove any water stains; open the lid and dry in an oven at 60℃ for 5-10 minutes; add 20-30 μL of... DEPC water; oven drying at 60℃ for 5 minutes to promote dissolution; after vortexing and mixing, centrifuge and store the RNA stock solution; use Nanodrop to detect the concentration and purity of RNA.

[0065] (3) For the extraction of total RNA from tissue: cut 30 mg of tissue and put it into a 1.5 mL EP tube, add 3 3 mm grinding beads; add 500 μL RNA-easy Isolation Reagent; grind with a grinder until no visible matter is visible; add 200 μL RNase-free water to the lysis buffer, mix well and let stand for 5 minutes; the subsequent steps are the same as for extracting cellular RNA.

[0066] 4. Reverse transcription and SYBR Green fluorescent dye method qRT-PCR

[0067] (1) Reverse transcription

[0068] After quantifying the total RNA concentration, the reverse transcription system was prepared using the Revert Aid RT Reverse Transcription Kit (Thermo Fisher Scientific) (Table 1-1) and the reverse transcription reaction was performed at 42℃ for 60 min and 70℃ for 5 min. After reverse transcription, the samples were placed at 4℃ for later use.

[0069] Table 1-1 Reverse Transcription System

[0070]

[0071] (2) qRT-PCR

[0072] After preparing the reaction system (Table 1-2), qRT-PCR was performed on an ABIQuantStudio5 under the following conditions: pre-denaturation at 95℃ for 30 s, followed by 40 cycles (denaturation at 95℃ for 10 s, annealing and extension at 60℃ for 30 s).

[0073] Table 1-2 PCR Reaction System

[0074]

[0075] U6 and β-actin are used as internal references for tsRNAs and mRNAs. Using 2 -ΔΔCT The method determines the expression.

[0076] ΔΔCt=ΔCt tumor[Ct(target)-Ct(reference)] -ΔCt control[Ct(target)-Ct(reference)] .

[0077] The reverse transcription and qRT-PCR primers were synthesized by Sangon Biotech Co., Ltd., and their sequences are as follows (5'-3'):

[0078] 5′-tiRNA Gly Specific RT primers:

[0079] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCGAG;

[0080] U6 specific RT primer: CGCTTCACGAATTTGCGTGTCAT;

[0081] 5′-tiRNA Gly The specific upstream primer F is: TGGGTGGTTCAGTGGTAGAATT;

[0082] Downstream primer R: AGTGCAGGGTCCGAGGTATT;

[0083] U6 specific upstream primer F: GCTTCAGCACATATACTAAAAT; downstream primer R: CGCTTCACGAATTTGCGTGTCAT;

[0084] OGDHL specific upstream primer F: CAAGTCCAGCTTTGACCAAATG; downstream primer R: CACCAGGTCATAGTACACCTTT;

[0085] The specific upstream primer F for β-actin is TCAAGATCATTGCTCCTCCTGAG; the downstream primer R is ACATCTGCTGGAAGGTGGACA.

[0086] 5. Agarose gel electrophoresis

[0087] Prepare 1L of 1×TAE solution for later use; prepare 2% agarose gel solution (100mL 1×TAE + 2g agarose); heat the prepared solution repeatedly in a microwave oven until the solution is clear; add 10μL of Gel-Red and mix quickly, then pour into the gel mixing tank and insert a comb; after the gel solidifies, place it in 1×TAE buffer, add 5μL of DNA marker to each well, mix the sample and loading buffer according to the ratio and add to the well, electrophoresis at 110V for 40min; after electrophoresis, perform UV imaging and take pictures.

[0088] 6. Room temperature storage and repeated freeze-thaw tests

[0089] Twenty serum samples were randomly pooled and incubated at room temperature (25°C) for 0, 6, 12, 18, and 24 hours. RNA was extracted and 5′-tiRNA was detected. Gly The expression of 5′-tiRNA was observed. Subsequently, the mixed serum was frozen and thawed at -80°C and room temperature for 0, 1, 3, 5, and 10 times. RNA was extracted and 5′-tiRNA was detected. Gly The expression.

[0090] 7. Cell Culture

[0091] Human gastric cancer cell lines (HGC-27, AGS, MKN-45) and human gastric mucosal epithelial cell line (GES-1) were obtained from the cell bank of the Chinese Academy of Sciences. AGS was cultured in F12 medium, while the other cell lines were cultured in RPMI 1640 medium containing 10% fetal bovine serum and 1% penicillin and streptomycin. The medium was changed every two days, and the cells were cultured in an incubator at 37°C with 5% CO2.

[0092] 8. Cell transfection

[0093] Seed healthy cells into 6-well plates. When cell confluence reaches approximately 60-70%, begin the experiment. Prepare two EP tubes. Add 125 μL of basal medium and 3.75 μL of 1 ipo3000 (Thermo Fisher Scientific) to the first EP tube. Add 125 μL of basal medium and an inhibitor, mimic, or 2500 ng of plasmid solution to the second EP tube. After incubating at room temperature for 5 min, add the second tube to the first tube, mix, and incubate at room temperature for 10 min. Replace the complete medium in the 6-well plate and evenly add the mixture to the 6-well plate. Perform cell function experiments after 24-48 h.

[0094] Suzhou Gemma Gene Co., Ltd. synthesized 5′-tiRNA Gly Inhibitors and mimics, OGDHL shRNAs and control vectors:

[0095] mimics NC sense: UUCUCCGAACGUGUCACGUTT;

[0096] mimics NC antisense: ACGUGACACGUUCGGAGAATT;

[0097] 5'-tiRNA Gly mimics sense:

[0098] GCAUGGGUGGUUCAGUGGUAGAAUUCUCGCC;

[0099] 5'-tiRNA Gly mimics antisense:

[0100] CGAGAAUUCUACCACUGAACCACCCAUGCUU;

[0101] inhibitor NC: CAGUACUUUUGUGUAGUACAA;

[0102] 5'-tiRNA Gly inhibitor:

[0103] GGCGAGAAUUCUACCACUGAACCACCCAUGC;

[0104] shOGDHL:GGAGAAACACTTTCAACAAAG;

[0105] shNC:TTCTCCGAACGTGTCACGT.

[0106] 9. Lentiviral infection

[0107] AGS cells were infected with lentiviral particles, and a supplementary cell line was established using puromycin as a selection marker. The OGDHL lentiviral vector sequence is shown in SEQ ID NO: 1.

[0108] 10.CCK-8

[0109] 48 hours after transfection, administer 3×10 3 Cells were placed in 96-well plates. After cell attachment, 10 μL of CCK-8 assay reagent was added to each well. The plates were incubated at 37°C for 2-3 hours. The absorbance values ​​at 450 nm and 630 nm were read using a microplate reader. The absorbance was measured once every 24 hours, and the results were repeated three times. The absorbance value at 450 nm was calculated by subtracting the absorbance value at 630 nm.

[0110] 11. Cloning experiment

[0111] Forty-eight hours after transfection, 1,000 cells were seeded into 6-well plates, and the culture medium was changed every 4 days. After about 14 days, the cells were fixed with 4% paraformaldehyde and then stained with crystal violet for photography.

[0112] 12. EdU proliferation experiment

[0113] 48 hours after transfection, 1×10 5 Cells were seeded into 24-well plates. When cell confluence reached approximately 70%, experiments were conducted according to the protocol in the EdU-555 cell proliferation assay kit (Beyotime). First, the culture medium was replaced with medium containing 10 μM EdU and the cells were incubated for 2 hours. After fixation with 4% paraformaldehyde, the cells were stained with Azide 555 and Hoechst 33342 fluorescent dyes. Finally, cell proliferation was observed using a fluorescence microscope.

[0114] 13. Transwell Experiment

[0115] 5×10 inoculated in the upper chamber 5Tumor cells were placed in the lower chamber with complete culture medium containing 20% ​​fetal bovine serum. Before the invasion experiment, a layer of matrix gel was placed in the upper chamber. After the matrix gel solidified, the tumor cells were seeded. After 2 days, the cells were fixed with paraformaldehyde, stained, photographed under a microscope, and counted.

[0116] 14. Establishment of the PDX model

[0117] The animal experimental protocol used in this study was approved by the Animal Management Committee of Nantong University and strictly adhered to ethical guidelines for animal experiments. Freshly obtained gastric cancer tissue was refrigerated at 4°C, rapidly cut into small fragments, and mixed with 10% Matrigel (Corning, Inc., USA) at 4°C. These tissue fragments were immediately transplanted subcutaneously into the right side of three NOD-SCID mice (F1) under sterile conditions. All animals received sterile food and water. When the tumor reached 1.5 cm... 3 At that time, a portion was cut off, divided into smaller pieces, and implanted into three other NOD-SCID mice (F2). This procedure was repeated, with 12 pieces from the three tumors transplanted into another 12 NOD-SCID mice (F3). When the tumors grew to 5 mm, the NC and antagomir groups received intratumoral injections of 5 nmol every 3 days. The 5-FU group received intraperitoneal injections, also every 3 days. Suzhou Gemma Gene Co., Ltd. synthesized 5′-tiRNA. Gly antagomir and antagomir NC, 5'-tiRNA Gly Antagomir: GGCGAGAAUUCUACCACUGAACCACCCAUGC; Antagomir NC: UUGUACUACACAAAAGUACUG. Antagomir has cholesterol modification at the 3' end, two thiocarbonyl modifications at the 5' end, four thiocarbonyl modifications at the 3' end, and full-chain methoxy modification.

[0118] 15. RNA FISH

[0119] Place cell smears in 24-well plates and culture 6 × 10⁶ cells per well. 4Cells were collected and, when the cell confluence reached approximately 70%, experiments were initiated using a FISH kit (RiboBio). After washing the cells with PBS, they were fixed with 4% paraformaldehyde at room temperature for 10 min, washed three times with PBS, and then 1 mL of pre-chilled permeabilization buffer was added and incubated at 4°C for 5 min. The permeabilization buffer was discarded, and the cells were washed three times with PBS. After pre-hybridization at 37°C for 30 min, hybridization buffer containing the probe was added, and hybridization was carried out overnight at 37°C in the dark. The next day, the cells were washed sequentially with Wash I, Wash II, Wash III, and PBS in the dark. DAPI staining was performed for 10 min in the dark, followed by washing three times with PBS. The cell slides were removed, mounted with mounting medium, and then photographed using a fluorescence microscope.

[0120] 16. Nucleocytoplasmic RNA Isolation Experiment

[0121] Digest cultured cells with trypsin and collect at least 5 × 10⁶ cells / day. 6 1 cell per 1.5 mL EP tube. According to the reagent manufacturer's PARIS... TM The kit (Thermo Fisher Scientific) procedure and instructions are used to extract 60 μL of nuclear and cytoplasmic RNA, which should be stored at -80°C.

[0122] 17. Dual-luciferase reporter gene assay

[0123] Predicting 5′-tiRNA using TargetScan software Gly The binding site of OGDHL was identified, and the 3'-UTR fragment of OGDHL was amplified by PCR. After purification, the fragment was ligated into the pmirGLO vector, and the recombinant vector was finally identified by double enzyme digestion and DNA sequencing. Using Renida luciferase as an internal control gene and firefly luciferase as a reporter gene, cells were seeded in 24-well culture plates, and 5'-tiRNA was co-transfected into the cells. Gly The 5′-tiRNA was tested using a dual-luciferase reporter gene assay system (Promega, USA) with a mimic / mimic NC and a luciferase OGDHL reporter gene containing a WT / MUT binding site. The substrate was added after 48 hours, and the fluorescence intensity was measured. The ratio of firefly fluorescence to that of *Gynostemma pentaphyllum* was calculated to validate the 5′-tiRNA. Gly The relationship with OGDHL.

[0124] 18. Detection of glucose intake and lactate production

[0125] After transfection, 1×10 6 Cells were seeded into 6-well plates. After incubation in basal medium for 24 hours, the supernatant was collected for analysis. Analysis was performed using a lactate assay kit and a glucose assay kit (Nanjing Jiancheng Biotechnology Research Institute Co., Ltd.) according to the protocol.

[0126] 19. Statistical Analysis

[0127] Statistical analysis was performed using IBM SPSS Statistics 20.0 and GraphPad Prism version 9. Data are expressed as mean ± standard deviation (SD). For normally distributed data, t-tests, one-way ANOVA, or two-way ANOVA were used. For non-normally distributed data, the Mann-Whitney U test, Kruskal-Wallis test, or Wilcoxon test were used. The Chi-square test was used to analyze 5′-tiRNA. Gly Correlation with pathological parameters. ROC and area under the curve (AUC) were created and calculated to assess serum 5′-tiRNA in gastric cancer. Gly The diagnostic efficacy. The Youden index is used to determine 5′-tiRNA. Gly The cutoff values ​​for CEA, CA199, and CA724 were set according to the reference range of Nantong University Affiliated Hospital, at 5 ng / mL, 37 U / mL, and 10 U / mL, respectively. Statistical significance was defined as P < 0.05.

[0128] In summary, this application demonstrates through specific verification experiments that 5′-tiRNA Gly It can be used as a diagnostic marker for gastric cancer by detecting 5′-tiRNA in serum. Gly Using expression levels to diagnose and predict gastric cancer has the advantages of high specificity and sensitivity.

Claims

1. Detection of 5'-tiRNA Gly The application of reagents for expressing levels in the preparation of diagnostic products for gastric cancer is characterized by: The 5'-tiRNA Gly It is derived from the 5'-half of tRNA-Gly-GCC, the 5'-tiRNA Gly The sequence is GCAUGGGUGGUUCAGUGGUAGAAUUCUCGCC.

2. The application according to claim 1, characterized in that: The product is a reagent or kit.

3. The 5'-tiRNA as described in claim 1 Gly The application of inhibitors in the preparation of products for treating gastric cancer, characterized by: The inhibitor is GCAUGGGUGGUUCAGUGGUAGAAUUCUCGCC and CGAGAAUUCUACCACUGAACCACCCAUGCUU.

Images