Molecular marker associated with pig longissimus dorsi protein content character, primer pair and application thereof

Abstract

The invention relates to the technical field of molecular biological detection, in particular to a molecular marker associated with pig longissimus dorsi protein content traits, a primer pair and application of the molecular marker and the primer pair. According to the invention, a new SNP of the BUB1B gene is detected in whole genome association analysis of protein content traits of Beijing black pig population; afterwards, a Beijing black pig is taken as a research object, mononucleotide variation existing on the BUB1B gene is analyzed, the variation is detected and verified in combination with a molecular biology means, and a result shows that the SNP is remarkably associated with the protein content character in the longissimus dorsi muscle. Therefore, the SNP site provided by the invention can be used for identifying the protein content of the pig longissimus dorsi. Meanwhile, the invention also provides a molecular marker associated with the property of the longissimus dorsi protein content of the pig, and the molecular marker can be used for establishing an auxiliary selective breeding system of the property of the longissimus dorsi protein content of the pig and accelerating the breeding process of the pig with high longissimus dorsi protein content.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology detection, and in particular to a molecular marker associated with the protein content trait of pig longissimus dorsi muscle, a primer pair and application thereof. Background Art

[0002] Molecular markers are genetic markers based on nucleotide sequence variation between individuals. They can directly reflect genetic diversity at the DNA level and reveal differences between the genomes of biological individuals or populations. Through molecular markers associated with quantitative traits, the information of these markers can be used to quickly and accurately analyze the genetic composition of individuals at the molecular level, thereby achieving genotype selection. In addition, combining genetic markers, pedigrees, and phenotypic information can provide richer information and higher selection accuracy than traditional breeding methods.

[0003] Single Nucleotide Polymorphism (SNP) refers to the diversity caused by the mutation of a single nucleotide in the genomic DNA sequence, including the insertion, deletion, substitution and inversion of a single base. This polymorphism is regarded as the third generation of genetic markers after restriction fragment length polymorphism and microsatellite markers. SNP has been widely studied and applied due to its significant advantages such as high genetic stability, rich site distribution, and rapid and easy automated detection. Sanger sequencing is a classic method for detecting SNP. It is the most direct and accurate means, especially in discovering unknown SNPs, with a detection rate of up to 100%, and can distinguish the type and position of the mutated base.

[0004] The protein content of the longissimus dorsi muscle of pigs is an extremely important trait, which plays a key role in the meat quality and growth performance of pigs. The longissimus dorsi muscle is one of the main muscle parts of pork, and its protein content directly affects the taste, flavor and nutritional value of the meat. A higher protein content can improve the quality of the meat, bringing a more tender and juicy taste and high nutritional value, thereby meeting consumers' demand for high-quality pork. Therefore, through molecular markers and genomic selection and other technologies, the study and breeding of the longissimus dorsi muscle protein content can significantly improve the overall quality of pork. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker, a primer pair and an application thereof associated with the protein content trait of the longissimus dorsi muscle of a pig, so as to solve the problems existing in the above-mentioned prior art. Based on large-scale gene chip data of Beijing black pigs and phenotypic data of protein content in the longissimus dorsi muscle of pigs, the present invention mines a SNP site in the BUB1B (BUB1 MitoticCheckpoint Serine / Threonine Kinase B, BUB1B) gene through whole genome association analysis and is significantly associated with the trait, and the site is named c.34A>G site, and the c.34A>G site is found by Sanger sequencing and genotyping is performed, and the association between the mutation site and the protein content trait in the longissimus dorsi muscle of Beijing black pigs is analyzed. As a result, it is found that the c.34A>G site provided by the present invention is associated with the protein content trait in the longissimus dorsi muscle of Beijing black pigs, thereby establishing a new marker-assisted selection site for the protein content trait in the longissimus dorsi muscle of pigs.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an application of a SNP site in identifying high or low protein content of the longissimus dorsi muscle of pigs, wherein the SNP site is c.34A>G; the c.34A>G is located at the 34th position of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is G / A.

[0008] Preferably, if the genotyping result of c.34A>G is GA and GG, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is high; if it is AA, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is low.

[0009] Further preferably, the reference genome of the SNP site is Sscrofa11.1.

[0010] The invention provides a molecular marker associated with the protein content trait of the longissimus dorsi muscle of pigs. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a G / A base mutation at the 34th position of the nucleotide sequence.

[0011] The present invention provides a primer pair for detecting the above-mentioned molecular marker, wherein the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.3.

[0012] The present invention provides a detection product for the above-mentioned molecular marker, and the detection product comprises the above-mentioned primer pair.

[0013] Preferably, the detection product includes a detection reagent, a detection kit and a detection chip.

[0014] The present invention provides the use of the above-mentioned molecular marker, the above-mentioned primer pair or the above-mentioned detection product in any of the following:

[0015] (1) Application in identifying the protein content of longissimus dorsi muscle of pig;

[0016] (2) Application in screening or predicting pig breeds with high longissimus dorsi protein content;

[0017] (3) Application in screening or predicting improved pig breeds with high longissimus dorsi protein content;

[0018] (4) Application in pig molecular marker breeding.

[0019] The present invention provides a method for identifying the protein content of longissimus dorsi muscle of pig, comprising the following steps:

[0020] Using the genome of the pig to be tested as a template, performing PCR amplification on the template using the above primer pair, sequencing the obtained amplification product, and obtaining the genotyping of the above molecular marker;

[0021] If the genotyping results are GA and GG, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is high; if the genotyping result is AA, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is low.

[0022] Preferably, the PCR amplification system is: 2×Taq PCR Master Mix 12.5 μL, upstream primer 1 μL, downstream primer 1 μL, DNA template 1 μL and ddH 2 2. O 9.5 μL.

[0023] Further preferably, the concentrations of the upstream primer and the downstream primer are both 10 μM.

[0024] Preferably, the PCR amplification program is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 1 min, 31 cycles; final extension at 72°C for 5 min.

[0025] The present invention discloses the following technical effects:

[0026] The present invention detected a new SNP of the BUB1B gene in the genome-wide association analysis of the protein content trait of the Beijing black pig group. Afterwards, the present invention used the Beijing black pig with "Asian, European and American ancestry" as the research object, analyzed the single nucleotide variation existing in the BUB1B gene, and combined the means of molecular biology to detect and verify the variation. The results showed that the SNP was significantly associated with the protein content trait in the longissimus dorsi muscle. Therefore, the SNP site provided by the present invention can be used to identify the protein content of the longissimus dorsi muscle of pigs. The present invention can provide new ideas for further studying the effect of the BUB1B gene on the protein content trait in the longissimus dorsi muscle of pigs, and provide a reference for the breeding work of the protein content trait of the longissimus dorsi muscle of pigs.

[0027] At the same time, the present invention also provides a molecular marker associated with the protein content trait of the longissimus dorsi muscle of pigs, which can be used to establish an auxiliary selection breeding system for the protein content trait of the longissimus dorsi muscle of pigs, and accelerate the breeding process of pigs with high longissimus dorsi muscle protein content. The results of the specific embodiments of the present invention show that the molecular marker can accurately and efficiently screen out pig breeds with high longissimus dorsi muscle protein content through genotype.

[0028] Moreover, when the SNP sites or molecular markers provided by the present invention are used to screen and identify the protein content trait of the longissimus dorsi muscle of pigs, they have the advantages of high accuracy, high efficiency and low cost, which greatly promotes the breeding process of pigs with high protein content of the longissimus dorsi muscle of pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 The whole genome association analysis results of Example 1;

[0031] Figure 2 The variance analysis results of the longissimus dorsi protein content of different genotypes of the molecular markers provided in Example 1;

[0032] Figure 3 The amplification bands of Example 3 using the primer pair provided by the present invention for polymerase chain reaction, wherein from left to right are the marker, the amplification bands of 8 individuals, the marker, and the amplification bands of 7 individuals;

[0033] Figure 4 The sanger sequencing results for homozygous individuals with mutations, i.e., genotype GG;

[0034] Figure 5 It is a wild-type homozygous individual, that is, the Sanger sequencing result of the genotype is AA. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0040] The SNP site (single nucleotide variation) described in the present invention mainly refers to the SNP variation in the BUB1B gene, and the location of the SNP is site 131128214 of pig chromosome 1 (Sscrofa11.1 reference genome).

[0041] Sequence Description:

[0042] The nucleotide sequence shown in SEQ ID NO.1 is the gene fragment screened by the present invention, i.e., a molecular marker (genetic marker) for detecting the protein content trait of the longissimus dorsi muscle of pigs. One SNP site is found in the sequence, and the specific mutation site is position 34, where there is a G / A base mutation.

[0043] SEQ ID NO.1: TTCCAGGAGTTCACGTCATGGCGCAGTGGAAACRAATCCAACTAGGAACCATGAGGTTGAGGGTTCAATACCTGGCCTCGCTCAGTGGGTTAAGGATCCAGCGTT GCTGTGAGCTGTGGTGTAGGTCGCAGACACGGCTCAGATCTGGCATTGCTGAGGCTCTG GTGTAGGC, R is G / A, i.e., there is an allele replacement (G / A) at the 34th base of the sequence.

[0044] Example 1 Genetic marker mining for protein content of longissimus dorsi muscle of pig

[0045] The protein content of the longissimus dorsi muscle and the carcass weight of 1509 Beijing black pigs were measured to obtain phenotypic data. The outliers of the protein content of the longissimus dorsi muscle and the carcass weight phenotypic traits were eliminated by the quartile test method. At the same time, the Beijing black pigs were genotyped using the SMIC No. 1 PLUS pig 50K SNP chip, and then the chip data were filled to the whole genome level based on the 1kcigp filling panel. The chip data were filled to the whole genome level using shapeit5 and minimac4 software, and then quality controlled using PLINK software. The quality control standards were ① individual genotype frequency>0.95; ② SNP call rate>0.95; ③ minimum allele frequency (MAF)>0.05; ④ Hardy-Weinberg equilibrium test P value>10-6; The SNP site information obtained after quality control was used for subsequent whole genome association analysis.

[0046] The GEMMA software was used to perform genome-wide association analysis based on a linear mixed model. The linear mixed model was expressed as: y = Xα + Yβ + Zγ + e;

[0047] Where: y is the meat quality trait phenotype vector; α is the SNP marker effect vector; X is the association matrix corresponding to α, coded as 0, 1, 2; β is the non-genetic fixed effect vector, including population mean, sex, and carcass weight; Y is the association matrix corresponding to β; γ is the residual polygenic effect vector, which follows the normal distribution γ-N G is the genomic kinship matrix, is the additive genetic variance; Z is the correlation matrix corresponding to γ; e is the residual vector, which obeys eN I is the identity matrix, are random residuals.

[0048] The significance test was performed using the Wald test with a 10 -6 As a threshold for potential genome-wide significance, the Manhattan result obtained is Figure 1 The results showed that the newly discovered SNP at position 131128214 on chromosome 1 (located in the BUB1B gene, the reference genome is Sscrofa11.1) may be a regulatory site for the protein content of the longissimus dorsi muscle of pigs.

[0049] Afterwards, by blasting the upstream and downstream sequences of the SNP on the NCBI website, the nucleotide polymorphism site was found in the gene fragment. The SNP site was at the 34th base of the sequence described in SEQ ID NO.1. The present invention named the mutation site as c.34A>G.

[0050] In summary, based on the large-scale Beijing black pig gene chip data and the phenotypic data of protein content in the longissimus dorsi muscle of pigs, the present invention fills the 50K genome chip (SMIC-1 PLUS pig 50K SNP chip) data to the sequencing level, uses a linear mixed model to perform genome-wide association analysis, and finds that there is a new SNP in the BUB1B gene that is significantly associated with the protein content in the longissimus dorsi muscle of pigs. By blasting the upstream and downstream sequences of the SNP on the NCBI website, the nucleotide polymorphism site is found in the gene fragment. The SNP site is at the 34th base of the sequence described in SEQ ID NO.1. The present invention names the mutated site as c.34A>G.

[0051] At the same time, a molecular marker as shown in SEQ ID NO.1 was obtained based on the SNP site, and the specific nucleotide sequence was: TTCCAGGAGTTCACGTCATGGCGCAGTGGAAACRAATCCAACTAGGAACCATGAGGTTG AGGGTTCAATACCTGGCCTCGCTCAGTGGGTTAAGGATCCAGCGTTGCTGTGAGCTGTG GTGTAGGTCGCAGACACGGCTCAGATCTGGCATTGCTGAGGCTCTGGTGTAGGC, where R is G / A, that is, there is an allele replacement (G / A) at the 34th base of the sequence.

[0052] Finally, the variance analysis was performed on the different genotypes of the molecular marker and the protein content of the longissimus dorsi muscle of these 1509 Beijing black pigs. The results of the variance analysis are as follows: Figure 2As shown, the results show that the protein content of the longissimus dorsi muscle of the pigs with the AG genotype and the GG genotype at the 34th base of the molecular marker is significantly higher than that of the AA genotype. It can be seen that the AG genotype and the GG genotype are favorable genotypes for the protein content of the longissimus dorsi muscle of the pigs.

[0053] Example 2 Development of primer pairs

[0054] The following primer pairs were designed based on the porcine BUB1B genome sequence and the SNP sites and molecular markers screened in Example 1. The specific sequences of the primer combinations are as follows:

[0055] Forward primer F: 5'-TTCCAGGAGTTCACGTCATG-3', SEQ ID NO. 2;

[0056] Reverse primer R: 5'-GCCTACACCAGAGCCTCAG-3', SEQ ID NO.3.

[0057] Example 3 Application of molecular markers and primer pairs

[0058] PCR amplification was performed in genomic DNA of 15 Beijing black pigs (15 out of 1509 Beijing black pigs) using the primer pairs in Example 2. The PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2.

[0059] Table 1 PCR reaction system

[0060] Components Dosage 2×TaqPCRMasterMix 12.5μL Forward primer F (10 μM) 1μL Reverse primer R (10 μM) 1μL DNA template 1μL <![CDATA[ddH 2 The]]> 9.5μL

[0061] Table 2 PCR reaction conditions

[0062]

[0063] PCR amplification results are as follows Figure 3 shown.

[0064] At the same time, the obtained PCR amplification products were purified and cloned, and then Sanger sequencing was performed to obtain the genotype of the 34th position of the SNP molecular marker. After blast comparison with the reference genome Sus scrofa11.1, it was found that the SNP mutation (base substitution) existed in the amplified product, i.e., the sequence, and the mutation caused the polymorphism of the BUB1B gene. Some Sanger sequencing results are shown as follows: Figure 4 and Figure 5 As shown. Figure 4 The sample in the sample is a homozygous mutant GG, and is a pig with a high content of longissimus dorsi protein (the content of longissimus dorsi protein is 24.72%). Figure 5 The sample in the sample is a wild-type AA homozygote, and is a pig with low longissimus dorsi protein content (the longissimus dorsi protein content is 20.03%).

[0065] This shows that the primer pair can be used to detect the polymorphism of the SNP site.

[0066] Among them, the specific experimental steps of the above-mentioned Sanger sequencing are:

[0067] The BigDye sequencing reaction kit containing PE patented four-color fluorescent labeled ddNTP and common dNTP, AmpliTaq DNA polymerase FS, reaction buffer, etc. was used to perform PCR sequencing on the positive clones confirmed by agarose gel electrophoresis to have a 172 bp target fragment using the primers described in SEQ ID NO.2 and SEQ ID NO.3. The specific steps include the following four steps:

[0068] (1) Cut the desired DNA target band from the electrophoresis results of the PCR product: load 25 μL of the sample, use TAE to prepare 1.5% agarose gel and perform electrophoresis at a voltage of 111 V and a current of 260 mA for 30 min. Place the gel under a UV transmission gel cutting table and use a clean scalpel to cut the target band (172 bp) to be detected and place it in a 1.5 mL centrifuge tube;

[0069] (2) Gel recovery: use Tiangen ordinary agarose gel DNA recovery kit (DP209) and follow the instructions for recovery;

[0070] (3) TA cloning of the target fragment was performed according to the steps of 10907-HieffCloneTM Zero TOPO-TA Cloning Kit-HB180280. 10L of the ligation product was added to 100L of competent cells for transformation and plating. Positive clones were selected for shaking and plasmid extraction. The plasmid was digested with PstI or other appropriate enzymes, and the fragment size was checked by agarose gel electrophoresis to determine whether the target fragment was contained.

[0071] (4) DNA sequencing: Take a 0.2 mL PCR tube, number it with a marker pen, and insert the tube into pelleted ice. The reaction system is shown in Table 3.

[0072] Table 3 DNA sequencing reaction system

[0073] BigDyeMix 1μL Plasmid DNA to be tested 1μL Forward primer of the DNA to be tested 1μL Reverse primer of the DNA to be tested 1μL Sterile deionized water 1μL

[0074] Note: The forward primer of the DNA to be tested is shown as SEQ ID NO.2; the reverse primer of the DNA to be tested is shown as SEQ ID NO.3.

[0075] Place the PCR tube on the BBI PCR instrument for amplification. After denaturation at 98°C for 2 minutes, perform PCR cycles. The PCR cycle parameters are 96°C for 10 seconds, 50°C for 5 seconds, and 60°C for 4 minutes for 25 cycles. After amplification, set the temperature at 4°C for insulation. Purify the PCR product using the sodium acetate / ethanol method. Add 12 μl of TSR to the purified PCR product in a centrifuge tube, shake vigorously to fully dissolve the DNA precipitate, centrifuge briefly, and perform heat denaturation (95°C for 2 minutes) on the PCR instrument. Cool in ice, perform capillary electrophoresis on the instrument, and analyze the sequencing map output by the instrument.

[0076] In summary, the SNP sites, molecular markers and primer pairs provided by the present invention can be used to identify the protein content of the longissimus dorsi muscle of pigs, and can be used for pig molecular marker breeding, specifically: screening or predicting pig breeds with high longissimus dorsi muscle protein content and improving pig breeds.

[0077] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. The application of SNP sites in identifying the protein content of longissimus dorsi muscle of pigs is characterized by: The SNP site is c.34A>G; the c.34A>G is located at the 34th position of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is G / A.

2. The use according to claim 1, characterized in that: If the genotyping result of c.34A>G is GA and GG, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is high; if it is AA, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is low.

3. A molecular marker associated with the protein content trait of the longissimus dorsi muscle of pigs, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a G / A base mutation at position 34 of the nucleotide sequence.

4. A primer pair for detecting the molecular marker according to claim 3, characterized in that: The primer pair includes an upstream primer whose nucleotide sequence is shown as SEQ ID NO.2 and a downstream primer whose nucleotide sequence is shown as SEQ ID NO.

3.

5. A molecular marker detection product according to claim 4, characterized in that: The detection product comprises the primer pair described in claim 3.

6. The detection product according to claim 4, characterized in that: The detection products include detection reagents, detection kits and detection chips.

7. Use of the molecular marker according to claim 3, the primer pair according to claim 4, or the detection product according to claim 5 or 6 in any of the following: (1) Application in identifying the protein content of longissimus dorsi muscle of pig; (2) Application in screening or predicting pig breeds with high longissimus dorsi protein content; (3) Application in screening or predicting improved pig breeds with high longissimus dorsi protein content; (4) Application in pig molecular marker breeding.

8. A method for identifying the protein content of longissimus dorsi muscle of pig, characterized in that: The following steps are involved: Using the genome of the pig to be tested as a template, performing PCR amplification on the template using the primer pair described in claim 4, sequencing the obtained amplification product, and obtaining the genotyping of the molecular marker described in claim 3; If the genotyping results are GA and GG, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is high; if the genotyping result is AA, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is low.

9. The method according to claim 8, characterized in that The PCR amplification system is: 2×Taq PCRMasterMix 12.5 μL, upstream primer 1 μL, downstream primer 1 μL, DNA template 1 μL and ddH2O 9.5 μL.

10. The method according to claim 8, characterized in that The PCR amplification procedure was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 1 min, 31 cycles; and final extension at 72°C for 5 min.

Images