Wheat stripe rust resistance gene TaPBL16-1B functional molecular marker and application thereof

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a wheat stripe rust resistance gene TaPBL16-1B functional molecular marker and application thereof. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, and the molecular marker is located at the 226361575 to 226360891 sites of a wheat 1B chromosome and directly indicates a wheat stripe rust resistance gene TaPBL16-1B. Wheat containing the molecular marker has the stripe rust resistance character, and wheat without the molecular marker does not have the stripe rust resistance character. Whether the stripe rust resistant wheat variety is resistant to stripe rust or not can be accurately and efficiently identified by utilizing the molecular marker and the amplification primer thereof, and the molecular marker can be applied to wheat molecular marker-assisted breeding, so that the breeding selection efficiency is greatly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a functional molecular marker of a wheat stripe rust resistance gene TaPBL16-1B and an application thereof. Background Art

[0002] Wheat is one of the most widely planted food crops in the world. During the large-scale production and cultivation of wheat, the losses caused by various pathogenic microorganisms and pests to wheat yield are difficult to estimate. Among them, wheat stripe rust has become one of the important diseases in wheat production. Studies have shown that breeding resistant varieties with stripe rust resistance genes is the most economical and effective measure to control the disease. However, due to the sexual hybridization of stripe rust hosts and the co-evolution of plants and pathogens, stripe rust resistance is often lost, which has become a global problem in wheat production. Therefore, it is necessary to strengthen the exploration of excellent disease-resistant genes to alleviate the current shortage of stripe rust resistance.

[0003] With the advancement of modern biotechnology and the application of molecular marker technology, a large number of stripe rust resistance genes have been discovered and named. So far, 83 stripe rust resistance genes (Yr1-Yr83) have been officially named. The number of disease resistance genes discovered seems "considerable", but most of the stripe rust resistance genes have "lost" resistance. Therefore, it is necessary to develop more molecular markers for wheat stripe rust resistance genes. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a functional molecular marker of wheat stripe rust resistance gene TaPBL16-1B and its application, which is of great significance for molecular-assisted polymer breeding of multiple disease resistance genes.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] In the first aspect, the present invention provides a functional molecular marker of the wheat stripe rust resistance gene TaPBL16-1B, which is located at positions 226361575-226360891 of wheat chromosome 1B, directly indicating the wheat stripe rust resistance gene TaPBL16-1B, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The molecular marker of the present invention provides a new approach for identifying wheat stripe rust resistance traits and / or assisted breeding.

[0007] In a second aspect, the present invention provides the use of the molecular marker in detecting wheat stripe rust resistance traits.

[0008] Furthermore, wheat containing the molecular marker has the trait of resistance to stripe rust, while wheat not containing the molecular marker does not have the trait of resistance to stripe rust.

[0009] Furthermore, the nucleotide sequence of the amplification primer of the molecular marker is shown in SEQ ID NO.2-3.

[0010] Further, detecting wheat stripe rust resistance traits includes the following steps:

[0011] S1. Extracting genomic DNA of the wheat material to be tested;

[0012] S2, using the genomic DNA of the wheat material as a template and using the primers to perform PCR amplification to obtain an amplified product;

[0013] S3. Determine whether the amplified product is the 683 bp amplified band shown in SEQ ID NO.1, and judge that the wheat material has the trait of resistance to stripe rust or the trait of susceptibility to stripe rust.

[0014] Furthermore, in S2, the composition of each 10 μL PCR amplification system is: 4-5 μL 2×PCR Buffer, 0.8-1 μL 2mM dNTPMix, 0.4-0.5 μL 10 μM upstream primer and downstream primer, 0.2-0.3 μL 5U / μL Taq enzyme, 0.8-1 μL 100ng / μL template DNA, and ddH2O to make up to 10 μL.

[0015] Furthermore, the PCR reaction program in S2 was: 1) 93.9-94.1°C for 3 minutes; 2) 93.9-94.1°C for 30 seconds, 57.9-58.1°C for 30 seconds, 71.9-72.1°C for 1 minute, 35 cycles; 3) 71.9-72.1°C for 10 minutes.

[0016] In a third aspect, the present invention provides an application of the molecular marker in wheat assisted breeding, wherein the application is to cultivate wheat germplasm resistant to stripe rust.

[0017] The present invention has the following beneficial effects:

[0018] The present invention provides a functional molecular marker of a wheat stripe rust resistance gene TaPBL16-1B. The molecular marker can accurately predict the wheat stripe rust resistance trait, and is beneficial to the establishment of a wheat molecular marker-assisted breeding system. The molecular marker is co-segregated with the TaPBL16-1B gene. The molecular marker of the present invention can be simply and quickly applied to wheat molecular-assisted breeding, thereby accelerating the wheat breeding process at the whole genome level. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the electrophoresis diagram of the amplification results of the resistant material 1013R and the susceptible material 1013S using the TaPBL16-683 primer set, where lanes 1 and 2 are 1013R and 1013S, respectively.

[0020] Figure 2 This is the electrophoresis diagram of the amplification products of the resistant material 1013R, the susceptible material 1013S and Zhengmai 7698 using the TaPBL16-683 primer set, where lanes 1 to 3 are for the resistant material 1013R, the susceptible material 1013S and Zhengmai 7698, respectively.

[0021] Figure 3 This is the electrophoresis diagram of the amplification products of disease-resistant materials 1013R, 158R, Xinong 658R and Shaanyou 225, and susceptible materials 1013S, Zhengmai 7698, Xiaoyan 22 and Fielder using the TaPBL16-683 primer set. Lanes 1 to 4 are for the disease-resistant materials 1013R, 158R, Xinong 658R and Shaanyou 225, and lanes 5 to 8 are for the susceptible materials 1013S, Zhengmai 7698, Xiaoyan 22 and Fielder. DETAILED DESCRIPTION

[0022] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0023] The invention provides a wheat stripe rust resistance gene TaPBL16-1B functional molecular marker TaPBL16-683, which is located at positions 226361575-226360891 of wheat 1B chromosome, directly indicates the wheat stripe rust resistance gene TaPBL16-1B, and its nucleotide sequence is shown in SEQ ID NO.1.

[0024] Example 1: Development of functional molecular markers for wheat stripe rust resistance gene TaPBL16-1B

[0025] Wheat genomic DNA of the test wheat materials (the wheat materials are disease-resistant material 1013R, susceptible material 1013S and Zhengmai 7698), the extraction of wheat genomic DNA refers to the conventional molecular biology operation steps, PCR amplification is performed using the test wheat genomic DNA as a template, and the amplified product is detected by gel electrophoresis; upstream primer TaPBL16-683-F (shown in SEQ ID NO.2), downstream primer TaPBL16-683-R (shown in SEQ ID NO.3).

[0026] The PCR system was as follows: 2×PCR Buffer 5 μl, 2.mM dNTP Mix 1 μl, 10 μM TaPBL16-648-F and TaPBL16-648-R 0.5 μl each, 5 U / μl Taq enzyme 0.2 μl, 100 ng / μl template DNA 1 μl, add ddH2O to 10 μl;

[0027] Reaction program: 1) 94°C for 3 minutes; 2) 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 1 minute, 35 cycles; 3) 72°C for 10 minutes.

[0028] The results are as follows 1 and Figure 2 As shown, the results showed that TaPBL16-683 could successfully amplify a 683bp PCR product in the disease-resistant material 1013R, while such a PCR product did not exist in the susceptible materials 1013S and Zhengmai 7698, indicating that the molecular marker TaPBL16-683 can be used to detect wheat stripe rust resistance.

[0029] SEQ ID NO.1: 5′-ATGCATAACATTCCAGACTTAGGTAGTAGCCATGTC CCGAGTGGGTCCTATGGAATGGGTCCTATGGAATATCACTAAGGAGAGATGTCACCTCGGTCTCAAGAGCTCTATCTCGTGCTTGTGTCATCGGTCCTCTTGGCACTTGGTGAGATGATGGTAGCTCCATGGGGATGACCATAAGATGCTCCGCATCACGTATACTCCAAGACATCTCCTACCGCCTCCATGCGATACCCCTAGATATCAACCATGCAACCCTAGATGCGCTACCTGGCGTGTATATAAGCCAAAGGGTTTAGCCCACAGAAAGGACCGAATCACAATTACATTCACCTGGCCATAGGGTTAGAACACAACTTACGATGTCGAGGTAGATCAAGCTTGTACTCGATACATCACCATCAATATAAACAGGAGCAGGACGTAGGGTTTTACCTCCACCAAGAGGGCCCGAACCTGGGTAAACATCGTCTCCCTTGTTCCTGTTGCCACCAATCTAAGATCCACAGCTCCGGACCCCCTACCCCGAGGTCTGCCGGTTTTGACACCAACAATGGGTGAAATGGGGACGTTGGTTGCATCGGGGCGGATGTCCGGCAACTGGTCCGAGCCAAATCTGATCTAACGGGTTTAAAGACATGGAGAAAAAATGGGTGGATTTCATGGGGAGAGGTGATGGAAAG-3′。

[0030] SEQ ID NO.2: 5′-ATGCATAACATTCCAGACTTAGGTAGTAG-3′。

[0031] SEQ ID NO.3: 5′-CTTTCCATCACCTCTCCCCATG-3′。

[0032] Example 2: Practical Verification of the Functional Molecular Marker TaPBL16-1B for Wheat Resistance to Stripe Rust

[0033] Wheat genomic DNA was taken from the test wheat materials (the wheat materials were disease-resistant materials 1013R, 158R, Xinong 658R and Shaanyou 225, and susceptible materials 1013S, Zhengmai 7698, Xiaoyan 22 and Fielder). The extraction of wheat genomic DNA followed conventional molecular biology procedures, and PCR amplification was performed using the test wheat genomic DNA as a template. The amplified product was detected by gel electrophoresis; upstream primer TaPBL16-683-F (shown in SEQ ID NO.2), and downstream primer TaPBL16-683-R (shown in SEQ ID NO.3).

[0034] The PCR system and reaction procedure were the same as those in Example 1.

[0035] The results are as follows Figure 3 As shown, the results showed that TaPBL16-683 could successfully amplify a 683bp PCR product in the disease-resistant materials 1013R, 158R, Xinong 658R and Shaanyou 225, while such a PCR product did not exist in the susceptible materials 1013S, Zhengmai 7698, Xiaoyan 22 and Fielder, indicating that the molecular marker TaPBL16-683 can be used to detect wheat stripe rust resistance.

[0036] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0037] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

Claims

1. A functional molecular marker of wheat stripe rust resistance gene TaPBL16-1B, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1.

2. Use of the molecular marker according to claim 1 in detecting wheat stripe rust resistance traits.

3. The use according to claim 2, characterized in that: The wheat containing the molecular marker has the trait of resistance to stripe rust, while the wheat not containing the molecular marker does not have the trait of resistance to stripe rust.

4. The use according to claim 3, characterized in that: The nucleotide sequence of the amplification primer of the molecular marker is shown in SEQ ID NO.2-3.

5. The use according to claim 4, characterized in that: Testing wheat for stripe rust resistance involves the following steps: S1. Extracting genomic DNA of wheat materials to be tested; S2, using the genomic DNA of the wheat material as a template and using the primers to perform PCR amplification to obtain an amplified product; S3. Determine whether the amplified product is the 683 bp amplified band shown in SEQ ID NO.1, and judge that the wheat material has the trait of resistance to stripe rust or the trait of susceptibility to stripe rust.

6. The use according to claim 5, characterized in that: In S2, the composition of each 10 μL PCR amplification system is: 4-5 μL 2×PCRBuffer, 0.8-1 μL 2mM dNTP Mix, 0.4-0.5 μL 10 μM upstream primer and downstream primer, 0.2-0.3 μL 5U / μL Taq enzyme, 0.8-1 μL 100ng / μL template DNA, and ddH2O to make up to 10 μL.

7. The use according to claim 6, characterized in that: The PCR reaction program in S2 was: 1) 93.9-94.1°C for 3 minutes; 2) 93.9-94.1°C for 30 seconds, 57.9-58.1°C for 30 seconds, 71.9-72.1°C for 1 minute, 35 cycles; 3) 71.9-72.1°C for 10 minutes.

8. The use of the molecular marker according to claim 1 in wheat assisted breeding, characterized in that: The application is to cultivate wheat germplasm resistant to stripe rust.

Images