Diagnostic KASP marker for detecting wheat stalk rust resistance gene Sr43 and application of diagnostic KASP marker

Abstract

The invention discloses a diagnostic KASP marker for detecting a wheat stalk rust resistance gene Sr43 and application of the diagnostic KASP marker, and belongs to the technical field of wheat molecular breeding. By utilizing the diagnostic KASP marker disclosed by the invention, the existence condition of the Sr43 gene can be known in advance, the resistance of wheat to the Puccinia graminicola can be predicted, genetic typing is carried out according to the fluorescent type detected by the marker, a strain carrying the wheat Puccinia graminicola resistance gene Sr43 is accurately screened out for wheat breeding, and the molecular marker can directly serve production practice and has a wide application prospect. The breeding efficiency of the wheat Puccinia stelleriana Sr43 gene is improved, the breeding process is accelerated, and the application of the gene in wheat molecular breeding is promoted.

Description

Technical Field

[0001] The invention relates to the technical field of wheat molecular breeding, and in particular to a diagnostic KASP marker for detecting wheat stem rust resistance gene Sr43 and an application thereof. Background Art

[0002] Wheat stem rust is a wheat disease caused by the fungus (Puccinia graminis f.sp.Tritici). A large number of red brick-shaped spores will appear on the stems and leaves of infected wheat, causing a reduction in grain weight. In severe cases, wheat plants will fall over, resulting in yield losses. Since the 1970s, wheat stem rust has been effectively controlled worldwide due to the promotion and application of the disease-resistant gene Sr31. However, with the discovery of the highly pathogenic strain Ug99 (later named TTKSK), stem rust has once again broken out on a large scale. Ug99 mutates quickly and is extremely toxic, causing multiple stem rust resistance genes, including Sr31, to lose resistance. Therefore, discovering new antigens is one of the key tasks in dealing with Ug99 and its variants.

[0003] The Sr43 gene from Elytrigium longispinum is a new wheat stem rust resistance gene with a unique resistance mechanism and a wide resistance spectrum. It shows high resistance to a variety of currently popular stem rust physiological races, including Ug99 and its derivatives. The existence of this gene provides a new gene resource for breeding long-lasting and broad-spectrum stem rust-resistant wheat varieties, which is expected to effectively solve the yield and quality loss problems faced by current wheat production due to stem rust. However, traditional breeding methods are time-consuming and labor-intensive, poorly targeted, and have low breeding efficiency. Molecular marker-assisted selection breeding can effectively solve this problem. However, there is currently no development of diagnostic molecular markers for this gene, which seriously restricts the application of this gene in wheat breeding. Summary of the invention

[0004] In view of the above-mentioned prior art, the object of the present invention is to provide a diagnostic KASP marker for detecting wheat stem rust resistance gene Sr43 and its application.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect of the present invention, a SNP molecular marker associated with stem rust resistance is provided. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No. 1. The 33rd base from the 5' end of the sequence shown in SEQ ID No. 1 is a SNP site, and its base is A or T.

[0007] The nucleotide sequence of the SNP molecular marker is as follows:

[0008] gtgga aaagcttgtt gatatcgtca gttttctygataaacaaatc cgggatgcatttggtgaag.

[0009] Note: The nucleotides in bold shade in the sequence are SNP sites, and the nucleotide polymorphism is A / T, which is represented by "y" in the sequence table.

[0010] The present invention discovered a SNP site associated with stem rust resistance in the stem rust resistance gene Sr43 (Gene ID: ON237711.1; database link: https: / / www.ncbi.nlm.nih.gov / nucleotide / ON237711.1?report=genbank&log$=nuclalign&blast_rank=1&RID=NMENZ7DJ016), which is located at the 9178th base in the nucleotide sequence of the gene Sr43 and has a specific A / T polymorphism with the homologous gene of the wheat D chromosome group.

[0011] The second aspect of the present invention provides the use of the above-mentioned SNP molecular marker in any one of the following (1)-(3):

[0012] (1) Develop diagnostic markers for the stem rust resistance gene Sr43;

[0013] (2) Identify the resistance of plant resources to stem rust;

[0014] (3) Molecular marker-assisted breeding of wheat resistant to stem rust.

[0015] The third aspect of the present invention provides a KASP molecular marker primer combination for specifically detecting the stem rust resistance gene Sr43, comprising: primers shown in SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4; specifically as follows:

[0016] Sr43-KASP-FAM:

[0017] 5'-GAAGGTGACCAAGTTCATGCTGCTTGTTTGATATCGTCAGTTTTCTA-3'; (SEQ ID No. 2)

[0018] Sr43-KASP-HEX:

[0019] 5'-GAAGGTCGGAGTCAACGGATTGCTTGTTGATATCGTCAGTTTTCTT-3'; (SEQ ID No. 3)

[0020] Sr43-KASP-R:

[0021] 5'-AATGCATCCCGGATTTGTTT-3'. (SEQ ID No.4)

[0022] Among the above primers, Sr43-KASP-FAM and Sr43-KASP-HEX are upstream typing primers, and Sr43-KASP-R is a downstream universal primer. Sr43-KASP-FAM, Sr43-KASP-HEX and Sr43-KASP-R are dissolved to 100 μM with TE (pH 8.0) or sterilized ultrapure water, and then mixed at a volume ratio of 2:2:5 for use.

[0023] Based on the SNP molecular marker associated with stem rust resistance of the present invention, the present invention designs a KASP molecular marker primer combination for specifically detecting the stem rust resistance gene Sr43, and can perform genotype analysis on the SNP difference at position 9178 of the gene Sr43. The A / A genotype is the Sr43 resistance haplotype, which exhibits resistance to wheat stem rust; the T / T genotype is the Sr43 susceptible haplotype, which exhibits susceptibility to wheat stem rust; and the A / T genotype is the Sr43 gene heterozygous type.

[0024] The fourth aspect of the present invention provides the use of the above-mentioned KASP molecular marker primer combination in the following (1) or (2):

[0025] (1) Identify the resistance of plant resources to stem rust;

[0026] (2) Molecular marker-assisted breeding of wheat resistant to stem rust.

[0027] A fifth aspect of the present invention provides a method for identifying or assisting in identifying wheat resistance to stem rust, comprising the following steps:

[0028] The wheat to be tested is genotyped based on specific SNP loci, and the wheat stem rust resistance is determined according to the genotyping: wheat with haplotype AA is resistant to stem rust; wheat with haplotype TT is susceptible to stem rust;

[0029] The specific SNP site is the 9178th nucleotide of the Sr43 gene (Gene ID: ON237711.1), and there is an A / T polymorphism.

[0030] Preferably, the above KASP molecular marker primer combination is used to detect the genotyping of the wheat to be tested based on the specific SNP loci. Specifically as follows:

[0031] The genomic DNA of the wheat to be tested was used as a template and PCR amplification was performed using the KASP molecular marker primer combination. After the amplified product was centrifuged, fluorescence data was collected and genotyping was performed based on the fluorescence data.

[0032] Furthermore, the PCR reaction system was: 2 μL of DNA template, 1.94 μL of 2×KASP Master Mix, and 0.06 μL of primer mixture.

[0033] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing and extension at 60-55°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.5°C each cycle; annealing at 94°C for 20 sec, annealing and extension at 55°C for 60 sec, 30 cycles.

[0034] After centrifugation of the PCR products, fluorescence data were collected using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization analysis.

[0035] Beneficial effects of the present invention:

[0036] By using the diagnostic KASP marker of the present invention, the presence of the Sr43 gene can be known in advance, the resistance of wheat to stem rust can be predicted, genotyping can be performed according to the fluorescence type detected by the marker, and the lines carrying the wheat stem rust resistance gene Sr43 can be accurately screened out for wheat breeding. The molecular marker can directly serve the production practice, improve the breeding efficiency of the wheat stem rust resistance gene Sr43, accelerate the breeding process, and promote the application of the gene in wheat molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 : Development of molecular marker Sr43-KASP and its sequence information.

[0038] Figure 2 :Genotypic and phenotypic data of molecular marker Sr43-KASP in wheat-Elygropyrum elongatum short segment translocation line materials; "+" indicates carrying the Sr43 gene, and "-" indicates not carrying the Sr43 gene.

[0039] Figure 3 : Molecular marker Sr43-KASP in the backcross BC2F between RJimai22 and American wheat variety Jagger 2:3 The typing of the population. "A / A" indicates the homozygous Sr43 disease-resistant haplotype, "A / T" indicates the heterozygous Sr43 disease-resistant haplotype, and "T / T" indicates the homozygous Sr43 disease-susceptible haplotype. DETAILED DESCRIPTION

[0040] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0041] As mentioned above, the strong pathogenic bacteria of wheat stem rust Ug99 caused multiple stem rust resistance genes including Sr31 to lose resistance, posing a huge threat to wheat production. The Sr43 gene Ug99 from Elytium longipedum and its derivatives showed high resistance and had important research value.

[0042] However, since the Sr43 gene originates from a closely related plant of wheat, Elytium longissima, only some homologous sequences can be found in wheat, and there are great differences between the sequences, making it difficult to find a sequence suitable for editing and development, which brings great difficulties to marker development. So far, there has been no report on a diagnostic molecular marker for this gene.

[0043] In view of this, the present invention compares the relatively conservative gene coding regions of 50 homologous genes from 18 common wheat varieties with the Sr43 gene sequence, and finally finds that only the 9178th base in the Sr43 nucleotide sequence has a specific polymorphism with the wheat D chromosome group, which can avoid the amplification of the marker in the wheat A and B chromosome groups ( Figure 1 ), and the number of SNPs near this site is relatively small, so developing markers in this area can ensure the amplification efficiency of primers.

[0044] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0045] The test materials used in the examples of the present invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without detailed conditions are carried out according to conventional test methods or the operating instructions recommended by the supplier.

[0046] Example 1: Development of a diagnostic KASP marker for specific detection of the wheat stem rust resistance gene Sr43

[0047] The sequence information of Sr43 gene (Gene ID: ON237711.1) in NCBI database was used to screen wheat homologous sequences of Sr43 in WheatOmics database (http: / / 202.194.139.32 / ) by blast sequence alignment tool. After finding the homologous sequence, DNAMAN software was used for comparison analysis to explore the SNP differences between resistance and sensitivity homologous genes.

[0048] It was found that there was a SNP difference at the 9178th base in the sequence of the Sr43 gene, which was A in the Sr43 resistance haplotype and T in its susceptible haplotype, which can be used for the development of diagnostic markers for Sr43.

[0049] Based on this SNP, the present invention further developed and designed a diagnostic KASP marker for specifically detecting the wheat stem rust resistance gene Sr43, specifically:

[0050] Primer3 v4.1.0 online primer design software ( https: / / bioinfo.ut.ee / primer3- 0.4.0 / ) for primer design.

[0051] The KASP marker primer sequence combination is as follows:

[0052] Sr43-KASP-FAM: The underlined part is the FAM fluorescent tag sequence

[0053] 5'- GAAGGTGACCAAGTTCATGCT GCTTGTTGATATCGTCAGTTTTCTA-3'; (SEQ ID No. 2)

[0054] Sr43-KASP-HEX: The underlined part is the HEX fluorescent tag sequence

[0055] 5'- GAAGGTCGGAGTCAACGGATT GCTTGTTGATATCGTCAGTTTTCTT-3'; (SEQ ID No. 3)

[0056] Sr43-KASP-R: 5'-AATGCATCCCGGATTTGTTT-3'. (SEQ ID No.4)

[0057] The primers were dissolved to 100 μM with sterile ultrapure water, and then mixed in a volume ratio of upstream typing primer Sr43-KASP-FAM: upstream typing primer Sr43-KASP-HEX: downstream universal primer Sr43-KASP-R = 2:2:5, and stored at -20°C for future use.

[0058] Example 2: Genotypic and phenotypic identification of different wheat materials for resistance to stem rust

[0059] 1. Test method:

[0060] Four wheat materials, K2620, RJimai22, K11463 and SN2-16, were selected, among which: K2620 carries the Sr43 gene under the genetic background of the wheat variety 'Marquis'; K11463 does not carry the Sr43 gene under the genetic background of the wheat variety 'Thatcher'; Rjimai22 carries the Sr43 gene under the background of Jimai 22; SN2-16 carries a short segment of Thinopyrum truncatum under the background of the wheat variety Chinese Spring, but does not carry the Sr43 gene.

[0061] (1) Genotype detection:

[0062] DNA was extracted from wheat materials K2620, RJimai22, K11463 and SN2-16, and genotypes were analyzed using the Sr43-KASP marker primer combination (SEQ ID No. 2-SEQ ID No. 4) developed in Example 1. The details are as follows:

[0063] 1) Extract sample genomic DNA using the CTAB method;

[0064] The CTAB method is used to extract DNA from wheat samples, and the specific steps are as follows:

[0065] For the above materials, 2-3 cm wheat leaves were cut at the 2-leaf stage and placed in a 2 mL centrifuge tube. The leaves were quickly ground into powder after being frozen with liquid nitrogen, and 650 μL of CTAB extraction buffer preheated to 65°C was added, and the mixture was placed in a water bath at 65°C for 45 min. Then, 300 μL of chloroform: isoamyl alcohol = 24:1 (V:V) was added, and the mixture was slowly mixed and allowed to stand for 15 min. During this period, the mixture was slowly mixed 2-3 times, and 450 μL of supernatant was extracted after centrifugation at 12000 rpm for 10 min. After mixing, an equal volume of ice isopropanol was added and allowed to stand at 4°C for 30 min or overnight. Subsequently, the mixture was centrifuged at 12000 rpm for 45 min, the supernatant was discarded, and genomic DNA was precipitated. After washing twice with 500 μL of 70% ethanol, the precipitate was dissolved in TE solution or sterile water after drying, and the concentration was diluted to 20 ng / μL, and stored at low temperature for later use.

[0066] 2) PCR amplification;

[0067] The PCR reaction system used was: 2 μL DNA template, 1.94 μL 2×KASP Master Mix, and 0.06 μL primer mixture.

[0068] The PCR reaction conditions used were: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing and extension at 60-55°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.5°C each cycle; annealing at 94°C for 20 sec, annealing and extension at 55°C for 60 sec, 30 cycles.

[0069] PCR products can be stored at room temperature but need to be kept away from light.

[0070] 3) Analysis of KASP labeling results.

[0071] After centrifugation of the PCR products, fluorescence data were collected using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization analysis.

[0072] (2) Phenotypic identification:

[0073] Spores of wheat stem rust fungus (TPMKC (isolate 74MN1409)) were stored in an ultra-low temperature freezer at -80°C. They were taken out before use, heat-shocked in a 42°C water bath for 6 minutes, and then suspended in Soltrol 170 mineral oil for inoculation. Wheat was inoculated at the two-leaf stage. After inoculation, they were placed outdoors for 30 minutes. After the mineral oil evaporated completely, they were transferred to an incubator with a humidity of 100%, incubated in the dark at 24°C for 16 hours, and then moved to a plant incubator at 21±4°C after 4 hours of light treatment. Phenotypic identification was performed 12-14 days after inoculation. The susceptible wheat variety Morocco was used as a susceptible control.

[0074] 2. Test results:

[0075] The identification results of wheat material genotype and phenotype are as follows Figure 2 As shown, the results showed that the genotype detection results of the molecular marker Sr43-KASP were consistent with the situation that the wheat material carried the Sr43 gene; the identification results of the genotype and the stem rust resistance phenotype were also consistent.

[0076] Example 3: Detection of Sr43 gene and identification of stem rust resistance in wheat backcross population

[0077] 1. Test method:

[0078] The Sr43-KASP marker primer combination (SEQ ID No. 2-SEQ ID No. 4) developed in Example 1 was used to backcross BC2F between RJimai22 and the American wheat variety Jagger. 2:3 The 94 plants in the population were tested for Sr43 gene detection and stem rust resistance identification. The detection and identification methods were the same as those in Example 2.

[0079] 2. Test results:

[0080] The results are shown in Table 1 and Figure 3 .

[0081] Table 1: BC2F of RJimai22 and Jagger 2:3 Molecular marker Sr43-KASP genotype and stem rust resistance phenotype in the first generation population

[0082]

[0083]

[0084]

[0085] Note: Genotype R in the table represents the Sr43 homozygous resistance genotype (A / A); H represents the Sr43 heterozygous resistance genotype (A / T); S represents the Sr43 homozygous susceptible genotype (T / T); NTC represents the negative water control, no PCR amplification.

[0086] RJimai22 x Jagger backcross BC2F 2:3 The results of population detection showed that both the homozygous (A / A) and heterozygous (A / T) resistant Sr43 types showed good resistance to wheat stem rust, while the susceptible type (T / T) showed high susceptibility to wheat stem rust. Therefore, the KASP marker of the present invention can accurately diagnose the Sr43 gene.

[0087] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A SNP molecular marker associated with stem rust resistance, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No.

1. The 33rd base from the 5' end of the sequence shown in SEQ ID No. 1 is the SNP site, and the base is A or T.

2. Use of the SNP molecular marker according to claim 1 in any one of the following (1)-(3): (1) Develop diagnostic markers for the stem rust resistance gene Sr43; (2) Identify the resistance of plant resources to stem rust; (3) Molecular marker-assisted breeding of wheat resistant to stem rust.

3. A KASP molecular marker primer combination for specific detection of stem rust resistance gene Sr43, characterized in that: include: Primers shown in SEQ ID No.2, SEQ ID No.3 and SEQ ID No.

4.

4. Use of the KASP molecular marker primer combination according to claim 3 in the following (1) or (2): (1) Identify the resistance of plant resources to stem rust; (2) Molecular marker-assisted breeding of wheat resistant to stem rust.

5. A method for identifying or assisting in identifying wheat resistance to stem rust, characterized in that: The following steps are involved: The wheat to be tested is genotyped based on specific SNP loci, and the wheat stem rust resistance is determined according to the genotyping: wheat with haplotype AA is resistant to stem rust; wheat with haplotype TT is susceptible to stem rust; The specific SNP site is the 9178th nucleotide of the Sr43 gene, and there is an A / T polymorphism.

6. The method according to claim 5, characterized in that The KASP molecular marker primer combination described in claim 3 is used to detect the genotyping of the wheat to be tested based on the specific SNP site, as follows: The genomic DNA of the wheat to be tested was used as a template and PCR amplification was performed using the KASP molecular marker primer combination. After the amplified product was centrifuged, fluorescence data was collected and genotyping was performed based on the fluorescence data.

7. The method according to claim 6, characterized in that The PCR reaction system was: 2 μL of DNA template, 1.94 μL of 2×KASP Master Mix, and 0.06 μL of the primer mixture shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No.

4.

8. The method according to claim 6, characterized in that The PCR reaction conditions were as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing and extension at 60-55°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.5°C each cycle; annealing at 94°C for 20 sec, annealing and extension at 55°C for 60 sec, 30 cycles.

Images