A molecular marker, primer pair and their application associated with the protein content trait of porcine longissimus dorsi muscle
Through genome-wide association analysis and primer pairs to detect the c.34A>G site of the BUB1B gene, the problem of identifying the longest myoprotein content of pig back was solved, efficient and accurate breeding selection was achieved, and pork quality was improved.
Patent Information
- Application Number
- CN202411869027.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-18
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2044-12-18
AI Technical Summary
It is difficult for the prior art to efficiently and accurately identify and select pig breeds with the longest muscle protein content on the pig back, which will affect the improvement of pork quality.
Through genome-wide association analysis, it was found that the c.34A>G site in the BUB1B gene was significantly associated with the longest myoprotein content of pig dorsal. Primer pairs were designed for PCR amplification and Sanger sequencing, and the genotype of the SNP site was detected, and pig breeds with high longest myoprotein content were screened.
The efficient and accurate identification of the longest myoprotein content of pig back is achieved, and new breeding selection sites are provided, which improves the breeding efficiency and accuracy of pork quality.
Smart Images

Figure CN119592709B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology detection, and particularly to a molecular marker, a primer pair and their applications associated with the protein content trait of the longissimus dorsi muscle in pigs. Background Art
[0002] A molecular marker is a genetic marker based on nucleotide sequence variation among individuals, which can directly reflect genetic diversity at the DNA level and reveal differences between the genomes of biological individuals or populations. Through molecular markers related to quantitative traits, the information of these markers can be used to quickly and accurately analyze the genetic composition of individuals at the molecular level, thereby realizing genotype selection. In addition, combining genetic markers, pedigree and phenotypic information can provide richer information and higher selection accuracy than traditional breeding methods.
[0003] Single Nucleotide Polymorphism (SNP) refers to the diversity caused by the mutation of a single nucleotide in the genomic DNA sequence, including single-base insertion, deletion, substitution, inversion, etc. This polymorphism is regarded as the third-generation genetic marker after Restriction Fragment Length Polymorphism and microsatellite markers. SNPs are widely studied and applied due to their significant advantages such as high genetic stability, rich site distribution, and fast and convenient automated detection. The Sanger sequencing method is a classic method for detecting SNPs. It is the most direct and accurate means, especially excellent in discovering unknown SNPs, with a detection rate of up to 100%, and can also distinguish the types and positions of mutant bases.
[0004] The protein content of the longissimus dorsi muscle in pigs is an extremely important trait, which plays a key role in the meat quality and growth performance of pigs. The longissimus dorsi muscle is one of the main muscle parts in pork, and its protein content directly affects the taste, flavor and nutritional value of the meat quality. A higher protein content can improve the meat quality, bringing a more tender and juicy taste and high nutritional value, thus meeting the needs of consumers for high-quality pork. Therefore, through technologies such as molecular markers and genomic selection, studying and breeding for the protein content of the longissimus dorsi muscle can significantly improve the overall quality of pork. Summary of the Invention
[0005] The present invention aims to provide a molecular marker, primer pair, and application thereof associated with the protein content trait of the longissimus dorsi muscle of pigs, so as to solve the problems existing in the above-mentioned prior art. Based on large-scale gene chip data of Beijing black pigs and phenotypic data of protein content in the longissimus dorsi muscle of pigs, the present invention mines a single nucleotide polymorphism (SNP) site in the BUB1B (BUB1 Mitotic Checkpoint Serine / Threonine Kinase B, BUB1B) gene through genome-wide association analysis and finds that it is significantly associated with the trait. The site is named c.34A>G site. The c.34A>G site is found by Sanger sequencing and genotyping is performed. The association between the mutation site and the protein content trait of the longissimus dorsi muscle of Beijing black pigs is analyzed. The results show that the c.34A>G site provided by the present invention is associated with the protein content trait of the longissimus dorsi muscle of Beijing black pigs, thereby establishing a new marker-assisted selection site for the protein content trait of the longissimus dorsi muscle of pigs.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides an application of a SNP site in identifying the high or low protein content of the longissimus dorsi muscle of pigs, wherein the SNP site is c.34A>G; the c.34A>G is located at the 34th position of the nucleotide sequence shown in SEQ ID NO.1, and the polymorphism is G / A.
[0008] Preferably, if the genotyping result of c.34A>G is GA and GG, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is high; if it is AA, it is determined that the protein content of the longissimus dorsi muscle of the tested pig is low.
[0009] Further preferably, the reference genome of the SNP site is Sscrofa11.1.
[0010] The present invention provides a molecular marker associated with the protein content trait of the longissimus dorsi muscle of pigs. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a G / A base mutation at position 34 of the nucleotide sequence.
[0011] The present invention provides a primer pair for detecting the above-mentioned molecular marker, wherein the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.3.
[0012] The present invention provides a detection product for the above-mentioned molecular marker, which includes the above-mentioned primer pair.
[0013] Preferably, the detection product includes a detection reagent, a detection kit and a detection chip.
[0014] The present invention provides the application of the above-mentioned molecular marker, the above-mentioned primer pair or the above-mentioned detection product in any one of the following:
[0015] (1) Application in identifying the high or low content of porcine longissimus dorsi muscle protein;
[0016] (2) Application in screening or predicting porcine breeds with high longissimus dorsi muscle protein content;
[0017] (3) Application in screening or predicting improved porcine breeds with high longissimus dorsi muscle protein content;
[0018] (4) Application in porcine molecular marker breeding.
[0019] The present invention provides a method for identifying the high or low content of porcine longissimus dorsi muscle protein, comprising the following steps:
[0020] Using the genome of the pig to be tested as a template, performing PCR amplification on the template with the above-mentioned primer pair, sequencing the obtained amplification product, and obtaining the genotype typing of the above-mentioned molecular marker;
[0021] If the gene typing result is GA and GG, it is determined that the longissimus dorsi muscle protein content of the pig to be tested is high; if the gene typing result is AA, it is determined that the longissimus dorsi muscle protein content of the pig to be tested is low.
[0022] Preferably, the system for PCR amplification is: 12.5 μL of 2×Taq PCR Master Mix, 1 μL of upstream primer, 1 μL of downstream primer, 1 μL of DNA template, and 9.5 μL of ddH2O.
[0023] More preferably, the concentrations of the upstream primer and the downstream primer are both 10 μM.
[0024] Preferably, the program for PCR amplification is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 1 min, 31 cycles; final extension at 72°C for 5 min.
[0025] The present invention discloses the following technical effects:
[0026] In the genome-wide association study of the protein content trait in the Beijing Black Pig population, a new SNP of the BUB1B gene was detected. Subsequently, the present invention took the Beijing Black Pig with "Asian, European, and American bloodlines" as the research object, analyzed the single nucleotide variations existing in the BUB1B gene, and detected and verified this variation by means of molecular biology. The results showed that this SNP was significantly associated with the protein content trait in the longissimus dorsi muscle. Therefore, the SNP locus provided by the present invention can be used to identify the high or low protein content in the longissimus dorsi muscle of pigs. The present invention can provide new ideas for further studying the role of the BUB1B gene in the protein content trait of the longissimus dorsi muscle of pigs, and provide a reference for the breeding work of the protein content trait of the longissimus dorsi muscle of pigs.
[0027] Meanwhile, the present invention also provides a molecular marker associated with the protein content trait of the longissimus dorsi muscle of pigs. This molecular marker can be used to establish an assistant selection breeding system for the protein content trait of the longissimus dorsi muscle of pigs, and accelerate the breeding process of pigs with high protein content in the longissimus dorsi muscle. The results of the specific examples of the present invention show that this molecular marker can accurately and efficiently screen out pig breeds with high protein content in the longissimus dorsi muscle through genotypes.
[0028] Moreover, when the SNP locus or molecular marker provided by the present invention is applied to screen and identify the protein content trait of the longissimus dorsi muscle of pigs, it has the advantages of high accuracy, high efficiency, and low cost, which greatly promotes the breeding process of pigs with high protein content in the longissimus dorsi muscle. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0030] Figure 1 It is the result of the genome-wide association study of Example 1;
[0031] Figure 2 It is the result of the variance analysis of the protein content in the longissimus dorsi muscle of different genotypes of the molecular marker provided by Example 1;
[0032] Figure 3 It is the result of the amplification band of the polymerase chain reaction using the primers provided by the present invention in Example 3. From left to right, they are Marker, the amplification bands of 8 individuals, Marker, and the amplification bands of 7 individuals;
[0033] Figure 4 It is the sanger sequencing result of the mutant homozygous individual, that is, the genotype is GG;
[0034] Figure 5 is a wild-type homozygous individual, that is, the Sanger sequencing result with the genotype AA. Detailed implementation manners
[0035] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0036] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0037] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0038] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.
[0039] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, that is, meaning including but not limited to.
[0040] The SNP loci (single nucleotide variations) described in the present invention mainly refer to the SNP variations within the BUB1B gene, and the position of this SNP is at the 131128214 site on chromosome 1 of pigs (Sscrofa11.1 reference genome).
[0041] Sequence description:
[0042] The nucleotide sequence shown in SEQ ID NO. 1 is the gene fragment screened by the present invention, i.e., a molecular marker (genetic marker) for detecting the protein content trait of the longissimus dorsi muscle of pigs. A single nucleotide polymorphism (SNP) site was found in the sequence, specifically at position 34, where a G / A base mutation exists.
[0043] SEQ ID NO.1: TTCCAGGAGTTCACGTCATGGCGCAGTGGAAACRAATCCAACTAGGAACCATGAGGTTGAGGGTTCAATACCTGGCCTCGCTCAGTGGGTTAAGGATCCAGCGTT GCTGTGAGCTGTGGTGTAGGTCGCAGACACGGCTCAGATCTGGCATTGCTGAGGCTCTG GTGTAGGC, R is G / A, i.e., there is an allele substitution (G / A) at the 34th base of the sequence.
[0044] Example 1 Genetic marker mining for protein content of pig longissimus dorsi muscle
[0045] Phenotypic data were obtained from 1509 Beijing Black pigs for longissimus dorsi muscle protein content and carcass weight. Outliers for longissimus dorsi muscle protein content and carcass weight were eliminated using the interquartile range test. Genotyping of Beijing Black pigs was performed using the Zhongxin No. 1 PLUS 50K SNP chip. The chip data were then populated to the whole genome using the 1kcigp filling panel, using Shapeit5 and Minimac4 software. Quality control was then performed using PLINK software. The quality control criteria were: ① individual genotype frequency > 0.95; ② SNP call rate > 0.95; ③ minimum allele frequency (MAF) > 0.05; and ④ Hardy-Weinberg equilibrium test P value > 10-6. The SNP loci obtained after quality control were used for subsequent genome-wide association analysis.
[0046] Genome-wide association analysis was performed using GEMMA software based on a linear mixed model. The linear mixed model is expressed as: y = Xα + Yβ + Zγ + e;
[0047] Where: y is the meat quality trait phenotype vector; α is the SNP marker effect vector; X is the association matrix corresponding to α, coded as 0, 1, 2; β is the non-genetic fixed effect vector, including population mean, sex, and carcass weight; Y is the association matrix corresponding to β; γ is the residual polygenic effect vector, which follows the normal distribution γ-N G is the genomic kinship matrix, is the additive genetic variance; Z is the correlation matrix corresponding to γ; e is the residual vector, which obeys eN I is the identity matrix, which is the random residual.
[0048] The significance test uses the Wald test. With 10 -6 as the threshold for the potential genome-wide significant level, the obtained Manhattan results are as Figure 1 shown. The results show that the newly discovered SNP at position 131128214 on chromosome 1 (within the BUB1B gene, with the reference genome being Sscrofa11.1) may be the regulatory locus for the protein content trait in the longissimus dorsi muscle of pigs.
[0049] After that, by performing a blast alignment on the upstream and downstream sequences of this SNP on the NCBI website, this nucleotide polymorphism site was found within this gene fragment. This SNP site is at the 34th base of the sequence described in SEQ ID NO.1. The present invention names this mutated site as c.34A>G respectively.
[0050] In summary, based on the large-scale Beijing Black pig gene chip data and the protein content phenotype data in the longissimus dorsi muscle of pigs, the present invention filled the data of the 50K genome chip (Zhongxin No.1 PLUS pig 50K SNP chip) to the sequencing level, used the linear mixed model for genome-wide association analysis, mined that there is a new SNP in the BUB1B gene that is significantly associated with the protein content in the longissimus dorsi muscle of pigs. By performing a blast alignment on the upstream and downstream sequences of this SNP on the NCBI website, this nucleotide polymorphism site was found within this gene fragment. This SNP site is at the 34th base of the sequence described in SEQ ID NO.1. The present invention names this mutated site as c.34A>G respectively.
[0051] Meanwhile, a molecular marker as shown in SEQ ID NO.1 was obtained according to this SNP site. The specific nucleotide sequence is: TTCCAGGAGTTCACGTCATGGCGCAGTGGAAACRAATCCAACTAGGAACCATGAGGTTG AGGGTTCAATACCTGGCCTCGCTCAGTGGGTTAAGGATCCAGCGTTGCTGTGAGCTGTG GTGTAGGTCGCAGACACGGCTCAGATCTGGCATTGCTGAGGCTCTGGTGTAGGC, where R is G / A, that is, there is an allele substitution (G / A) at the 34th base of this sequence.
[0052] Finally, an analysis of variance was performed on the protein content in the longissimus dorsi muscle of these 1509 Beijing Black pigs with different genotypes of this molecular marker. The results of the analysis of variance are as Figure 2As shown, the results indicate that the content of porcine longissimus dorsi muscle protein in individuals with the AG genotype and GG genotype at the 34th base of this molecular marker is significantly higher than that in individuals with the AA genotype. Thus, it can be seen that the AG genotype and GG genotype are favorable genotypes for porcine longissimus dorsi muscle protein content.
[0053] Development of primer pairs in Example 2
[0054] According to the porcine BUB1B genomic sequence, the SNP locus and molecular marker screened in Example 1, the following primer pairs were designed. The specific sequences of the primer combinations are as follows:
[0055] Forward primer F: 5’-TTCCAGGAGTTCACGTCATG-3’, SEQ ID NO.2;
[0056] Reverse primer R: 5’-GCCTACACCAGAGCCTCAG-3’, SEQ ID NO.3.
[0057] Application of molecular marker and primer pairs in Example 3
[0058] The primer pairs in Example 2 were used for PCR amplification in the genomic DNA of 15 Beijing Black pigs (15 out of 1509 Beijing Black pigs). The PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2.
[0059] Table 1 PCR reaction system
[0060] Component Dosage 2× Taq PCR Master Mix 12.5 μL Forward primer F (10 μM) 1 μL Reverse primer R (10 μM) 1 μL DNA template 1 μL <![CDATA[ddH2O]]> 9.5 μL
[0061] Table 2 PCR reaction conditions
[0062]
[0063] The PCR amplification results are as Figure 3 shown.
[0064] Meanwhile, the obtained PCR amplification products were purified, cloned, and then subjected to Sanger sequencing to obtain the genotype at the 34th position of the said SNP molecular marker. After blast alignment with the reference genome Sus scrofa11.1, it was found that there was this SNP mutation (base substitution) in the amplified product, i.e., the sequence, and this mutation caused polymorphism of the BUB1B gene. Part of the Sanger sequencing results are as Figure 4 and Figure 5 shown. Among them, Figure 4 the sample in is the mutant GG homozygote, which is a pig with a high content of longissimus dorsi muscle protein (the content of longissimus dorsi muscle protein is 24.72%), Figure 5 the sample in is the wild-type AA homozygote, which is a pig with a low content of longissimus dorsi muscle protein (the content of longissimus dorsi muscle protein is 20.03%).
[0065] Thus, it can be seen that this primer pair can be used to detect the polymorphism of this SNP locus.
[0066] Among them, the specific experimental steps of the above Sanger sequencing are as follows:
[0067] Using the BigDye sequencing reaction kit containing ddNTPs with internal PE patent four-color fluorescence labeling, ordinary dNTPs, AmpliTaq DNA polymerase FS, reaction buffer, etc., perform PCR sequencing on the positive clone with a 172bp target fragment confirmed by agarose gel electrophoresis using the primer pair described in SEQ ID NO.2 and SEQ ID NO.3. The specific steps include the following four steps:
[0068] (1) Cut the required DNA target band from the PCR product electrophoresis result: Load 25 μL of the sample, use 1.5% agarose gel prepared with TAE and electrophorese at a voltage of 111V, current of 260mA for 30 min, then place it under the ultraviolet transillumination gel cutting table, and use a clean scalpel to cut the target band to be detected (172bp) and load it into a 1.5 mL centrifuge tube;
[0069] (2) Gel recovery, use the Tiangen ordinary agarose gel DNA recovery kit (DP209) and recover according to the instructions;
[0070] (3) TA cloning of the target fragment is carried out according to the steps of 10907-HieffCloneTM Zero TOPO-TA Cloning Kit-HB180280. Add 10 μL of the ligation product to 100 μL of competent cells for transformation, spread on the plate, pick positive clones for shaking culture and plasmid extraction, and use PstI single enzyme digestion or other appropriate enzyme digestion of the plasmid, and check the fragment size by agarose gel electrophoresis to determine whether the target fragment is contained;
[0071] (4) DNA sequencing, take a 0.2 mL PCR tube, number it with a marker pen, insert the tube into the granular ice, and the reaction system is shown in Table 3.
[0072] Table 3 DNA sequencing reaction system
[0073] BigDye Mix 1 μL Plasmid DNA to be tested 1 μL Forward primer of DNA to be tested 1 μL Reverse primer of DNA to be tested 1 μL Sterilized deionized water 1 μL
[0074] Note: The forward primer of the DNA to be tested is as shown in SEQ ID NO.2; the reverse primer of the DNA to be tested is as shown in SEQ ID NO.3.
[0075] Place the PCR tube on the BBIPCR instrument for amplification. After denaturation at 98°C for 2 min, perform PCR cycling. The PCR cycling parameters are 96°C for 10 s, 50°C for 5 s, 60°C for 4 min, for 25 cycles. After the amplification is completed, set the incubation temperature at 4°C. Purify the PCR product using the sodium acetate / ethanol method. Add 12 μl of TSR to the purified PCR product in a centrifuge tube, shake vigorously to fully dissolve the DNA precipitate, perform instantaneous centrifugation, and then perform thermal denaturation (95°C for 2 min) on the PCR instrument, quickly cool in ice, and load onto the capillary electrophoresis instrument. Analyze the sequencing map output by the instrument.
[0076] In summary, the SNP loci, molecular markers, and primer pairs provided by the present invention can be used to identify the high or low content of porcine longissimus dorsi muscle protein and can be used for porcine molecular marker breeding, specifically: screening or predicting porcine breeds with high longissimus dorsi muscle protein content and improving porcine breeds.
[0077] The embodiments described above are only used to describe the preferred mode of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solution of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. Use of a primer pair for detecting a molecular marker in any of the following: (1) Use in identifying the high or low content of longissimus dorsi muscle protein in Beijing Black pigs; (2) Use in screening or predicting Beijing Black pig breeds with high longissimus dorsi muscle protein content; (3) Use in screening or predicting improved Beijing Black pig breeds with high longissimus dorsi muscle protein content; The nucleotide sequence of the said molecular marker is as shown in SEQ ID NO.1, where the 34th position is G or A; if the gene typing result is GA and GG, it is determined that the longissimus dorsi muscle protein content of the pig to be tested is high; if the gene typing result is AA, it is determined that the longissimus dorsi muscle protein content of the pig to be tested is low; The said primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.
3.
2. Use of a detection product of a molecular marker in any of the following: (1) Use in identifying the high or low content of longissimus dorsi muscle protein in Beijing Black pigs; (2) Use in screening or predicting Beijing Black pig breeds with high longissimus dorsi muscle protein content; (3) Use in screening or predicting improved Beijing Black pig breeds with high longissimus dorsi muscle protein content; The nucleotide sequence of the said molecular marker is as shown in SEQ ID NO.1, where the 34th position is G or A; if the gene typing result is GA and GG, it is determined that the longissimus dorsi muscle protein content of the pig to be tested is high; if the gene typing result is AA, it is determined that the longissimus dorsi muscle protein content of the pig to be tested is low.
3. A method for identifying the protein content level in the longissimus dorsi muscle of Beijing Black pigs, characterized in that, Including the following steps: Using the genome of the pig to be tested as a template, performing PCR amplification on the template with the primer pair described in claim 1, sequencing the obtained amplification product, and obtaining the genotype typing of the molecular marker described in claim 1; If the gene typing result is GA and GG, it is determined that the longissimus dorsi muscle protein content of the pig to be tested is high; if the gene typing result is AA, it is determined that the longissimus dorsi muscle protein content of the pig to be tested is low.
4. The method according to claim 3, wherein The system of the said PCR amplification is: 2×Taq PCR MasterMix 12.5 μL, upstream primer 1 μL, downstream primer 1 μL, DNA template 1 μL, and ddH2O 9.5 μL.
5. The method according to claim 3, characterized in that The program of the said PCR amplification is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 1 min, 31 cycles; final extension at 72°C for 5 min.