An iNKT-TCR molecule targeting lipid antigen and CD1d complex, TCR-T cell, and preparation and application thereof

Abstract

The present invention relates to an iNKT-TCR molecule, TCR-T cell, preparation and application targeting a lipid antigen and CD1d complex, and belongs to the field of genetic engineering and immunotechnology. The present invention utilizes specific iNKT amplification technology to amplify and sort iNKT cells, and obtains iNKT cell-enriched TCRs by sequencing analysis. In this study, iNKT cells were amplified by iNKT cell-specific activators, high-purity iNKT cells were obtained by magnetic bead sorting, and iNKT cell-enriched TCRs were accurately screened out based on sequencing analysis to ensure their accuracy and specificity. The NKT38 of the present invention has a higher killing effect on tumor cells that express CD1d and present endogenous lipid antigens, and has strong specificity: in vitro experiments show that iNKT-TCR-transfected NKT38 cells have a stronger killing effect on tumor cell lines that express CD1d and present endogenous lipid antigens, suggesting that it has a specific killing effect on tumors.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and immunotechnology, and more specifically, to an iNKT-TCR molecule and TCR-T cell targeting a lipid antigen and CD1d complex, as well as their preparation and application. Background Art

[0002] Natural killer T cells (NKT) are an important group of innate immune-like T lymphocytes in the human body. They have both T cell and NK cell phenotypes and functional characteristics, and play a role in connecting innate immunity with adaptive immunity. Among them, NKT cells (iNKT) with a relatively constant T cell receptor (TCR) composition are the NKT cell population that has been the main focus of current research. iNKT cells recognize lipid or glycolipid antigens presented by the non-classical MHC-I class molecule CD1d through TCR, and after activation, they can secrete a large amount of anti-tumor factors to exert anti-tumor effects. In addition, iNKT cells can also recognize lipid antigens presented by CD1d on the surface of tumor cells to directly exert anti-tumor effects.

[0003] Because iNKT cells possess a relatively constant TCR, their cytotoxicity is dependent on a lipid antigen and CD1d complex, and the CD1d molecule is relatively conserved, iNKT cells hold great promise for application in chimeric antigen receptor T cell immunotherapy (CAR-T) and TCR-modified T cell therapy (TCR-T). iNKT cells are differentially distributed across various tissues, but their number in the human body is limited, and even in the liver, where they are enriched, they comprise only 1% of T cells. Therefore, the research and application of human iNKT cells is currently quite challenging.

[0004] Therefore, screening for characteristic iNKT cell TCRs and constructing an iNKT-TCR-modified T cell line (NKT38) for killing tumor cells expressing CD1d and presenting endogenous lipid antigens has promising application prospects in anti-tumor immunotherapy. The constant TCR composition and specific lipid antigen-CD1d complex stimulation of these cells offer unique advantages for studying the characteristics of human iNKT cells and the effects of TCR stimulation on T cells. Based on the above analysis, iNKT cell-specific expansion can be used to analyze the TCRs enriched in human iNKT cells and prepare iNKT cell lines, which can then be validated in vitro for their effectiveness in killing tumor cell lines expressing CD1d and presenting endogenous lipid antigens and TCR stimulation. Summary of the Invention

[0005] The present invention uses sequencing to obtain TCR sequences enriched in iNKT cells (iNKT-TCR), and prepares an iNKT-TCR-modified T cell line (NKT38) through a lentiviral overexpression system. This cell line can specifically kill tumor cells that express CD1d and present endogenous lipid antigens.

[0006] According to a first aspect of the present invention, an iNKT cell TCR molecule is provided, wherein the iNKT cell TCR molecule comprises an α chain and a β chain, wherein the sequence of the α chain is shown in SEQ ID NO: 1, and the sequence of the β chain is shown in SEQ ID NO: 2;

[0007] The iNKT cell TCR molecule can specifically recognize and bind to the lipid antigen and CD1d complex.

[0008] According to another aspect of the present invention, a TCR-T cell is provided, wherein the TCR-T cell contains the iNKT cell TCR molecule.

[0009] According to another aspect of the present invention, a method for screening iNKT cell TCR molecules is provided, comprising the following steps:

[0010] (1) Using lymphocyte separation medium, peripheral blood mononuclear cells were isolated by density gradient centrifugation;

[0011] (2) using the peripheral blood mononuclear cells separated in step (1), using interleukin-2 and galactosylceramide to amplify iNKT cells in the peripheral blood mononuclear cells;

[0012] (3) staining the iNKT cells amplified in step (2) with APC fluorescently labeled tetramers to label the iNKT cell TCR; then washing with a buffer solution, incubating with anti-APC magnetic beads after washing, and then sorting the iNKT cells using a magnetic column;

[0013] (4) Collect the iNKT cells sorted in step (3), extract RNA, and then reverse transcribe to obtain cDNA; design corresponding primers based on the constant TCRα chain TRAV10 and β chain TRBV25-1 of the iNKT cells for PCR amplification, the sequence of the forward primer of the TCRα chain is shown in SEQ ID NO:3, the sequence of the reverse primer of the TCRα chain is shown in SEQ ID NO:4, the sequence of the forward primer of the TCRβ chain is shown in SEQ ID NO:5, and the sequence of the reverse primer of the TCRβ chain is shown in SEQ ID NO:6, connect the amplified PCR sequence with the vector to construct a plasmid, transform the plasmid into tool bacteria, and after amplification, plate it on a bacterial culture plate to form monoclonal colonies, select multiple monoclonal colonies for sequencing, and obtain the complete sequence of the iNKT cell TCRα chain and β chain; then splice the TCRα chain and β chain into a TCR sequence, and add a self-cleavage polypeptide 2A sequence between the light and heavy chains, the 2A sequence is shown in SEQ ID As shown in NO:7, the obtained gene sequence is subjected to gene synthesis to obtain the iNKT cell TCR molecule.

[0014] Preferably, the tetramer is a tetramer of PBS57 and hCD1d.

[0015] Preferably, the buffer is sterile phosphate buffered saline.

[0016] According to another aspect of the present invention, there is provided a method for preparing the TCR-T cells, comprising the following steps:

[0017] S1: loading the iNKT cell TCR molecule into a tool vector through homologous recombination to generate a plasmid, and transforming the plasmid into competent cells;

[0018] S2: co-transfecting the plasmid obtained in step S1 and the lentiviral packaging helper plasmid into the tool cells using a liposome transfection reagent, collecting the viral supernatant after culture, filtering through a filter membrane, and concentrating the viral supernatant by ultrafiltration and centrifugation to obtain concentrated lentivirus;

[0019] S3: The concentrated lentivirus obtained in step S2 is transfected into target cells. The target cell lines are infected with the control virus and the iNKT-TCR virus respectively. The target cells are tested by flow cytometry to determine whether they express CD3 and can bind to tetramers to determine whether the viral infection is successful.

[0020] S4: The cells successfully transfected in step S3 are screened with antibiotics to obtain successfully transfected cell lines, and monoclonal cells are selected for amplification to obtain TCR-T cells that co-express iNKT-TCR and CD3 molecules.

[0021] According to another aspect of the present invention, there is provided the use of the iNKT cell TCR molecule in the preparation of anti-tumor drugs.

[0022] According to another aspect of the present invention, there is provided the use of the TCR-T cells in the preparation of anti-tumor drugs.

[0023] In general, the above technical solutions conceived by the present invention have the following technical advantages compared with the existing technology:

[0024] (1) The present invention utilizes specific iNKT amplification technology to amplify and sort iNKT cells, and uses sequencing analysis to obtain iNKT cell-enriched TCRs to ensure the representativeness of the screening results: This study amplifies iNKT cells using iNKT cell-specific activators, obtains high-purity iNKT cells using magnetic bead sorting, and accurately screens iNKT cell-enriched TCRs based on sequencing analysis to ensure their accuracy and specificity.

[0025] (2) The NKT38 of the present invention has a higher killing effect on tumor cells that express CD1d and present endogenous lipid antigens and has strong specificity: in vitro experiments show that NKT38 cells transfected with iNKT-TCR have a stronger killing effect on tumor cell lines that express CD1d and present endogenous lipid antigens, suggesting that it has a specific killing effect on tumors and has clinical application prospects.

[0026] (3) The present invention establishes a precision treatment based on the expression of CD1d and presentation of endogenous lipid antigens by the patient's tumor cells: the specific iNKT cell constant TCR sequence screened out has the characteristics of specifically recognizing the complex of lipid antigen and CD1d, and provides specific killing for different tumors that express CD1d molecules and present endogenous lipid antigens for precision treatment.

[0027] (4) The present invention is scalable: the cells have a cytotoxic effect on tumor cells that express CD1d molecules and present endogenous lipid antigens. Furthermore, the TCR and CD1d molecules are highly conserved. The recognition between the iNKT-TCR and the lipid antigen-CD1d complex is specific and stable, resulting in a strong cytotoxic effect on tumor cell lines that express CD1d molecules and present endogenous lipid antigens. Furthermore, the establishment of this stable TCR-specific stimulation system can provide a robust tool for in vitro studies of TCR pathways. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 For iNKT cell expansion and sorting.

[0029] Figure 2 This is a flow cytometric identification diagram of in vitro transduction of iNKT-TCR into T cells.

[0030] Figure 3 The flow cytometry results of in vitro killing of iNKT-TCR modified TCR-T cells (NKT38). DETAILED DESCRIPTION

[0031] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely for the purpose of explaining the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0032] The present invention provides a method for preparing and using a specific iNKT-TCR molecule and TCR-T cell targeting a lipid antigen and CD1d complex, comprising the following steps:

[0033] 1. Expand and isolate iNKT cells from peripheral blood mononuclear cells of healthy individuals for DNA sequencing.

[0034] Peripheral blood was collected from healthy individuals and peripheral blood mononuclear cells were isolated. iNKT cells were amplified and sorted, and then DNA sequencing was performed to detect the TCR sequences enriched in iNKT cells.

[0035] 1.1 Isolation of peripheral blood mononuclear cells;

[0036] 1.2 Expand peripheral blood iNKT cells;

[0037] 1.3iNKT cell isolation;

[0038] 1.4 DNA sequencing and analysis of TCR sequences enriched in iNKT cells.

[0039] 2. In vitro transduction of iNKT cell-specific TCR into T cells was used for screening to obtain the iNKT-TCR-modified TCR-T cell line (NKT38).

[0040] 2.1 iNKT-TCR light chain and heavy chain splicing and gene synthesis;

[0041] 2.2 Lentiviral packaging and identification;

[0042] 2.3 Lentiviral transduction and TCR expression identification;

[0043] 3. In vitro verification experiment of NKT38 cell killing specific to lipid antigen and CD1d complex.

[0044] 3.1 CD1d molecule transduction and identification in tumor cell lines;

[0045] 3.2 Cell Trace Violet staining of target cells;

[0046] 3.3 Verification of NKT38 cell killing experiment in vitro.

[0047] The present invention provides a specific iNKT-TCR molecule and TCR-T cell targeting a lipid antigen and CD1d complex, and its preparation and application specifically include the following steps:

[0048] 1. Expand peripheral blood mononuclear cells from healthy individuals and sort iNKT cells for transcriptome sequencing.

[0049] 1.1 Isolation of peripheral blood mononuclear cells;

[0050] Using peripheral blood from healthy donors, sufficient peripheral blood mononuclear cells were isolated using lymphocyte separation medium and density gradient centrifugation to prepare for subsequent expansion experiments.

[0051] 1.2 Expand peripheral blood iNKT cells;

[0052] Using isolated peripheral blood mononuclear cells, iNKT cells were expanded using a combination of interleukin-2 and galactosylceramide (α-GalCer), a specific agonist for iNKT cells. The expansion system was as follows: interleukin-2 at a concentration of 50 UI / ml, α-GalCer at a concentration of 200 ng / ml, the culture medium was 200 μl, and 5×10 peripheral blood mononuclear cells were plated per well. 5 The cells were thoroughly mixed and cultured in a 37°C, 5% CO2 incubator. On the third day, 100 μl of supernatant was discarded and 100 μl of fresh culture medium containing 50 UI / ml interleukin-2 was added. On the seventh day, the cells were harvested and the proportion of iNKT cell expansion was measured.

[0053] 1.3iNKT cell isolation;

[0054] After expansion, the cells were stained with APC fluorescently labeled PBS57 and hCD1d tetramers to label the iNKT cell TCR. The cells were then incubated at 4°C for 40 minutes and washed with sterile phosphate buffered saline. After washing, the cells were incubated with 20 μl of anti-APC magnetic beads per 100 μl of solution. The cells were incubated at 4°C for 40 minutes before washing. The iNKT cells were then sorted using magnetic columns. The purity of the cells was assessed by measuring the fluorescence positivity rate in the APC channel. The purity of the resulting iNKT cells was approximately 95%.

[0055] 1.4 Sequencing and analyzing TCR sequences enriched in iNKT cells;

[0056] The sorted iNKT cells were collected and RNA was extracted using Trizol. After obtaining RNA, reverse transcription was performed using a reverse transcription kit to obtain cDNA. Based on the constant TCRα chain (TRAV10) and β chain (TRBV25-1) of iNKT cells, corresponding primers were designed for PCR amplification. The amplified PCR sequence was ligated with the pcDNA3.1 vector to construct a plasmid. The plasmid was transformed into E. coli tool bacteria. After amplification of the bacteria, monoclonal colonies were plated on bacterial culture plates to form monoclonal colonies. The next day, multiple monoclonal colonies were selected for sequencing to obtain the complete sequence of the iNKT cell TCRα chain and β chain. The sequencing results showed that the CDR3 region of the iNKT cell TCRα chain sequence was completely consistent, and the most enriched TCRβ chain sequence was selected for subsequent transfection experiments. The primer sequences and TCRα chain and β chain sequences are shown below:

[0057]

[0058]

[0059] TCR α-chain sequence (SEQ ID NO:1):

[0060] ATGAAAAAGCATCTGACGACCTTCTTGGTGATTTTGTGGCTTTATTTTTATAGGGGGAATGGCAAAAACCAAGTGGAGCAGAGTCCTCAGTCCCTGATCATCCTGGAGGGAAAGAACTGCACTCTTCAATGCAATTATACAGTGAGCCCCTTCAGCAACTTAAGGTGGTATAAGCAAGATACTGGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAAGTCGAACGGAAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCACATCACAGCCTCCCAGCTCAGCGATTCAGCCTCCTACATCTGTGTGGTGAGCGACAGAGGCTCAACCCTGGGGAGGCTATACTTTGGAAGAGGAACTCAGTTGACTGTCTGGCCTGATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGCTGA

[0061] TCR β-chain sequence (SEQ ID NO:2):

[0062] ATGACTATCAGGCTCCTCTGCTACATGGGCTTTTATTTTCTGGGGGCAGGCCTCATGGAAGCTGACATCTACCAGACCCCAAGATACCTTGTTATAGGGACAGGAAAGAAGATCACTCTGGAATGTTCTCAAACCATGGGCCATGACAAAATGTACTGGTATCAACAAGATCCAGGAATGGAACTACACCTCATCCACTATTCCTATGGAGTTAATTCCACAGAGAAGGGAGATCTTTCCTCTGAGTCAACAGTCTCCAGAATAAGGACGGAGCATTTTCCCCTGACCCTGGAGTCTGCCAGGCCCTCACATACCTCTCAGTACCTCTGTGCCAGCAGTGAAATTGTAGGACAGGACGGGTCAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGAAGCAGAGATCTCCCACACCCAAAAGGCCACACTGGTATGCCTGGCCACAGGCTTCTACCCCGACCACGTGGAGCTGAGCTGGTGGGTGAATGGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGAGCAGCCCGCCCTCAATGACTCCAGATACTGCCTGAGCAGCCGCCTGAGGGTCTCGGCCACCTTCTGGCAGAACCCCCGCAACCACTTCCGCTGTCAAGTCCAGTTCTACGGGCTCTCGGAGAATGACGAGTGGACCCAGGATAGGGCCAAACCCGTCACCCAGATCGTCAGCGCCGAGGCCTGGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGCAAGGGGTCCTGTCTGCCACCATCCTCTATGAGATCTTGCTAGGGAAGGCCACCTTGTATGCCGTGCTGGTCAGTGCCCTCGTGCTGATGGCCATGGTCAAGAGAAAGGATTCCAGAGGCTAG

[0063] 2. In vitro transduction of iNKT cell-specific TCR into T cells was used for screening to obtain the iNKT-TCR-modified TCR-T cell line (NKT38).

[0064] 2.1 iNKT-TCR light chain and heavy chain splicing and gene synthesis, and plasmid construction;

[0065] According to the selected TCR base fragments, the light chain and heavy chain of the TCR were spliced ​​into a complete TCR sequence, and the self-cleavage polypeptide 2A sequence (GGCAGCGGCGCCACCAACTTCAGCCTGCTGAAGCAGGCCGGTGACGTGGAGGAGAATCCCGGCCCT) (SEQ ID NO: 7) was added between the light and heavy chains, and the resulting gene sequence was subjected to gene synthesis. The synthesized sequence was loaded into the tool vector GV208 by homologous recombination to generate a plasmid. The plasmid was added to 100 μL competent cells through the exchange reaction product, and the tube wall was flicked several times to mix. It was placed on ice for 30 minutes. Heat shock at 42°C for 90 seconds and incubated in an ice water bath for 2 minutes. Add 500 μL LB medium and place it on a shaking incubator at 37°C for 1 hour. Take an appropriate amount of bacterial solution and evenly spread it on a plate containing the corresponding antibiotic and culture it upside down in a constant temperature incubator for 12-16 hours. Select a single clone and identify the correct sequence. The correctly sequenced bacterial solution was transferred to 10 ml of LB liquid culture medium containing the corresponding antibiotics, cultured at 37°C overnight, and the plasmid was extracted using a plasmid extraction kit and the concentration was detected.

[0066] 2.2 Lentiviral packaging and concentration;

[0067] A core plasmid carrying the full iNKT-TCR sequence and two lentiviral packaging helper plasmids (PMD2.0G and PSPAX2) were transfected into 293T tool cells using a lipofectamine transfection reagent. Depending on the cell status, the 293T cell supernatant was harvested after 3 days of culture. The supernatant was centrifuged at 4000g for 10 minutes at 4°C to remove cellular debris. The supernatant was then filtered through a 0.45μm filter into an ultracentrifuge tube. The viral supernatant was then concentrated by ultracentrifugation and stored at -80°C until use.

[0068] 2.3 Lentiviral transduction and TCR expression identification;

[0069] Jurkat 76 cells were used as target cells for viral transduction. Control virus and iNKT-TCR virus were used to infect Jurkat 76 cells, respectively. A viral infection gradient was set to obtain the optimal infection system. Three days after infection, flow cytometry was used to detect whether the target cells expressed CD3 and could bind to PBS57 and hCD1d tetramers to determine whether the viral infection was successful. The negative control was Jurkat 76 cells transfected with the control virus.

[0070] 2.4 Screening and expansion of monoclonal iNKT-TCR expressing cells;

[0071] Cells successfully transfected with the lentivirus possess puromycin resistance. Transfected cells were cultured in puromycin-containing medium for two weeks to screen for successfully transfected cell lines. Surviving cells after two weeks were selected for single clones, cultured and expanded in 96-well flat-bottom plates. Different clones were assayed for iNKT-TCR expression, and highly expressing clones were selected for expansion, resulting in the NKT38 cell line, which co-expresses the iNKT-TCR and CD3 molecules.

[0072] 3. In vitro verification experiment of NKT38 cell killing specific to lipid antigen and CD1d complex.

[0073] CD1d molecules were transfected into tumor cell lines, and the killing level of iNKT38 on the cell lines was detected.

[0074] 3.1 CD1d molecular identification of tumor cell lines;

[0075] In the early stages, tumor cell lines were transfected with CD1d molecules. The expression of CD1d molecules on the surface of the CD1d-transfected tumor cell line 721.221-CD1d and the control cell line 721.221 was tested to facilitate subsequent NKT38 cell-specific detection. The results showed that 721.221 had significantly elevated CD1d expression.

[0076] 3.2 Cell Trace Violet staining of target cells;

[0077] To distinguish tumor cell lines from NKT38 cells in subsequent killing experiments, the tumor cell lines were stained with Cell Trace Violet before killing. A staining solution was prepared by adding Cell Trace Violet stock solution to PBS at a ratio of 1:1000. Both tumor cell lines (i.e., target cells) were resuspended in 1 ml of staining solution and stained in a 37°C cell culture incubator for 20 minutes. The staining was terminated by adding half the suspension volume of fetal bovine serum for 5 minutes. After washing twice with PBS, the cells were resuspended in 1640 medium containing 10% FBS and counted in preparation for subsequent killing experiments.

[0078] 3.3 NKT38 cell killing assay verification in vitro;

[0079] Cell Trace Violet-stained target cells and the prepared NKT38 cell line were added to a 96-well plate at a ratio of 1:10, using 300 μl of the killing medium. After 24 hours of co-culture, the cells were harvested, washed, and stained with propidium iodide for 10 minutes at room temperature. The target cell death rate was immediately measured on a flow cytometer to assess the tumor-killing effect of NKT38 cells. The results showed that NKT38 cells had a higher killing effect on the 721.221-CD1d cell line, which expresses CD1d and presents endogenous lipid antigens, compared to 721.221 cells that do not express CD1d, demonstrating the specific tumor-killing effect of NKT38 cells.

[0080] It will be easily understood by those skilled in the art that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An iNKT cell TCR molecule, characterized in that The iNKT cell TCR molecule contains an α chain and a β chain, the sequence of the α chain is shown in SEQ ID NO: 1, and the sequence of the β chain is shown in SEQ ID NO: 2; The iNKT cell TCR molecule can specifically recognize and bind to the lipid antigen and CD1d complex.

2. A TCR-T cell, characterized in that The TCR-T cell contains the iNKT cell TCR molecule according to claim 1.

3. The method for preparing TCR-T cells according to claim 2, wherein: The following steps are involved: S1: loading the iNKT cell TCR molecule of claim 1 into a tool vector by homologous recombination to generate a plasmid, and transforming the plasmid into competent cells; S2: co-transfecting the plasmid obtained in step S1 and the lentiviral packaging helper plasmid into the tool cells using a liposome transfection reagent, collecting the viral supernatant after culture, filtering through a filter membrane, and concentrating the viral supernatant by ultrafiltration and centrifugation to obtain concentrated lentivirus; S3: The concentrated lentivirus obtained in step S2 is transfected into target cells. The target cell lines are infected with the control virus and the iNKT-TCR virus respectively. The target cells are tested by flow cytometry to determine whether they express CD3 and can bind to tetramers to determine whether the viral infection is successful. S4: The cells successfully transfected in step S3 are screened with antibiotics to obtain successfully transfected cell lines, and monoclonal cells are selected for amplification to obtain TCR-T cells that co-express iNKT-TCR and CD3 molecules.

Images