Mortierella chlamydosporia and its application

By developing Entomortierella chlamydospora JSAFC 2128 as a bio-drug agent, the problem of lack of biological methods for the control of white moths in the existing technology has been solved, and efficient and environmentally friendly control effects have been achieved.

CN119614390BActive Publication Date: 2025-06-27JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510040676.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-10
Publication Date
2025-06-27
Estimated Expiration
2045-01-10

AI Technical Summary

Technical Problem

The existing technology lacks effective biological control methods in the prevention and control of American white moths, resulting in the dominance of chemical control methods and the problems of environmental pollution and non-target biokill.

Method used

Developed a kind of Entomortierella chlamydospora JSAFC 2128 as a bio-drug agent, spraying or soaking mulberry leaves through its spore suspension to inhibit the growth of American white moths.

Benefits of technology

This method significantly improves the mortality rate of American white moth, which can reach 96.7% within 7 days, and is environmentally friendly and non-toxic, avoiding harm to the environment and non-target organisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614390B_ABST
    Figure CN119614390B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of biological control, and discloses a biological control fungus for Hyphantria cunea and its application. The biological control fungus is taxonomically named Entomortierella chlamydospora, deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on September 23, 2024, with the deposit number CGMCC 41564. The biological control fungus strain for Hyphantria cunea provided in this application can significantly inhibit the survival activity of Hyphantria cunea. After 7 days of treatment, the mortality rate of Hyphantria cunea larvae can be increased to 96.7%, and the pupae can die during the pupal stage and cannot emerge. It can be used to control Hyphantria cunea, which is a typical biological control method, and can avoid problems such as drug resistance and environmental pollution caused by chemical control, and has good application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology and relates to Entomortierella chlamydospora and its application. Background Art

[0002] The fall webworm (Hyphantria cunea) is native to North America. It spread to Europe and Asia in the late 1940s and has become a worldwide quarantine pest that seriously harms trees. The fall webworm has the characteristics of having a wide variety of host plants, a large reproductive potential, a strong adaptability, a wide range of transmission routes, a serious direct harm, and disturbing the people by spreading. The fall webworm can harm more than a hundred kinds of forest trees, fruit trees, and flowers. After eating up the leaves, it can harm a variety of crops and vegetables nearby. At present, the comprehensive management technology system for the fall webworm is not yet perfect. The main control technology means is chemical control, and the promotion and application of new sustainable biological control technologies are less, which is not conducive to the action of reducing pesticide use and controlling pests.

[0003] Therefore, it is urgent to find green control technologies with good and lasting control effects on the fall webworm. The microbial control of the fall webworm mainly uses specific microbial agents to inhibit or kill pests. Specifically, it can be carried out by foliar spraying. A more effective method is to use Beauveria bassiana and Bacillus thuringiensis, while the development and utilization of other biological control fungicide resources for the fall webworm are less. Microbial control has the advantages of environmental protection and sustainability compared with chemical control agents, and can reduce environmental pollution and the killing of non-target organisms. Therefore, in the control of the fall webworm, microbial control is a method worthy of promotion and application, and the prospect of developing biological control fungi for the fall webworm is broad. Summary of the Invention

[0004] The purpose of the present invention is to provide Entomortierella chlamydospora and its application in inhibiting the growth of the fall webworm.

[0005] Technical Solution: In order to enrich the resource library of biological control fungicides for the fall webworm, the present invention provides an Entomortierella chlamydospora. The strain number of the Entomortierella chlamydospora is JSAFC 2128, which is preserved in the China General Microbiological Culture Collection Center. The preservation time is September 23, 2024, and the preservation number is CGMCC41564. The microbial taxonomic name is Entomortierella chlamydospora.

[0006] Further, the nucleotide sequence of the ITS gene of the biological control fungus for the fall webworm is as shown in SEQ ID NO.1.

[0007] The present invention also provides a biological control fungicide for the fall webworm. The active ingredient of the biological control fungicide for the fall webworm is the above-mentioned Entomortierella chlamydospora, its mycelium or conidia.

[0008] The present invention also provides the application of the above-mentioned Entomortierella chlamydospora and the biological control agent for Hyphantria cunea in inhibiting the growth of Hyphantria cunea.

[0009] Further, the application specifically comprises spraying the spore suspension of the above-mentioned Entomortierella chlamydospora on the larvae or pupae of Hyphantria cunea.

[0010] Further, the application also includes feeding mulberry leaves soaked in the spore suspension of Entomortierella chlamydospora.

[0011] Further, the preparation method of the spore suspension is as follows: (1) inoculating the biological control bacterium Entomortierella chlamydospora JSAFC 2128 for Hyphantria cunea on a PDA medium for culturing to obtain a culture; (2) placing the culture obtained in step (1) in a Tween-80 solution (0.01%) and filtering out the spores to prepare a biological control agent for Hyphantria cunea.

[0012] Further, the culture conditions in step (1) are culturing for 5 - 7 days under the condition of 25°C in the dark.

[0013] Further, the spore concentration of the Entomortierella chlamydospora is 10 7 CFU / mL.

[0014] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and remarkable advantages: One kind of Entomortierella chlamydospora JSAFC 2128 is obtained by isolation and purification of the soil from Yandang Mountain in Wenzhou, Zhejiang. This strain can be used as a biological control strain, has a relatively high lethality rate to Hyphantria cunea and is environmentally friendly, non-toxic, can significantly inhibit the survival activity of Hyphantria cunea, can increase the mortality rate of Hyphantria cunea to 96.7% within 7 days, and has great significance for the future development of biological control agents for Hyphantria cunea. Description of the Drawings

[0015] Figure 1 : Colony morphology diagram of the biological control bacterium Entomortierella chlamydospora JSAFC 2128 for Hyphantria cunea of the present invention;

[0016] Figure 2 : Phylogenetic tree of the biological control bacterium Entomortierella chlamydospora JSAFC 2128 for Hyphantria cunea;

[0017] Figure 3 : Influence of the biological control bacterium Entomortierella chlamydospora JSAFC 2128 for Hyphantria cunea of the present invention on the growth of Hyphantria cunea larvae;

[0018] Figure 4 : Effects of the biological control fungus Entomortierella chlamydospora JSAFC 2128 against Hyphantria cunea Drury on the growth of Hyphantria cunea Drury pupae. Detailed implementation manners

[0019] The technical solutions of the present invention will be further described below with reference to the accompanying drawings.

[0020] As described in the present invention, the term "biological control fungus" refers to beneficial microorganisms that can control plant pests, mainly including bacteria, fungi, and actinomycetes.

[0021] Example 1: Isolation and identification of the biological control fungus Entomortierella chlamydospora JSAFC 2128 against Hyphantria cunea Drury

[0022] 1. Isolation of the biological control fungus Entomortierella chlamydospora JSAFC 2128 against Hyphantria cunea Drury

[0023] Soil from Yandang Mountain in Wenzhou, Zhejiang was taken, and JSAFC 2128 was isolated therefrom. The colony characteristics are as follows: When cultured on a PDA plate medium, the colony grows rapidly, is cottony, the color of its surface is white, and the color at the bottom is orange-yellow ( Figure 1 ).

[0024] 2. Molecular biological identification of the biological control fungus Entomortierella chlamydospora JSAFC 2128 against Hyphantria cunea Drury

[0025] (1) The genomic DNA of strain JSAFC 2128 was extracted using a kit from TIANGEN Company.

[0026] (2) The ITS gene of the genomic DNA was amplified. The DNA amplification used a reaction volume of 30 μL, including 15 μL of 2×EasyTaq PCR SuperMix (+dye), 1 μL each of primer pairs ITS1 (SEQ ID NO.2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.3: 5'-TCCTCCGCTTATTGATATGC-3') (10 μM), 2 μL of template DNA, and 11 μL of ddH2O. The PCR amplification program conditions were as follows: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 54°C for 45 s, extension at 72°C for 60 s, for a total of 35 cycles; finally, extension at 72°C for 10 min.

[0027] (3) After the amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light, the PCR products with target bands were sent to Nanjing Tsingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: The ITS gene sequence of strain JSAFC 2128 was SEQ ID NO.1 (TGTTTTATGGCACTTTTTTAAAAATCCATATCCACCTTGTGTGCAATGTTTTTAG ATCTCGCCAAAATGATATTTTGGTTAGGTTTTATTATATTACATCAACTCTTATTTAACTTGATTTGTCTGAAAAATATTATGAATTTTTAACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTCTGGTATTCCGGAGAGCATGCTTGTTTGAGTATCAGTAAACACCCTCAGAGCTTTTTTTTTTTCTTGATTTTCAAATCTTGGGGCTCTGGATTTGAGTGATCCCAACGGGGTCTTTTTCGAAAGGACATGGCGGGCCACTTGAAATACAGGTGCAGCTGAACTTTCTTCTGAGCTAAAAGCATATTTATTTAGTCCTGTCAGCACATGTGCTGCCGGATTATTACTTCTGCTGCAGCTTACATAAAGGTTGACTGTTCAAATGCTGACTGATACAGAATTTTT).

[0028] (4) Align the SEQ ID NO.1 sequence on the NCBI database website and construct a phylogenetic tree, see Figure 2 . The alignment results are shown in Table 1. According to the results in Table 1, it can be deduced that the biocontrol bacterium JSAFC 2128 of the present invention is Entomortierella chlamydospora, and the strain was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on September 23, 2024, with the deposit number CGMCC41564, and the taxonomic name is Entomortierella chlamydospora JSAFC 2128, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen, Chaoyang District, Beijing.

[0029] Table 1 Alignment results of SEQ ID NO.1

[0030]

[0031] Example 2: Inhibitory effect of Entomortierella chlamydospora JSAFC 2128, a biological control fungus against Hyphantria cunea, on the growth of Hyphantria cunea

[0032] 1. Preparation of spore suspension

[0033] (1) Inoculate JSAFC 2128 on PDA medium to prepare a culture. The culture conditions are: cultivate for 5 - 7 days under dark conditions at 25°C;

[0034] (2) Use an inoculation needle to pick out the fungal blocks in the culture and place them in a Tween - 80 solution (0.01%) and shake well. After shaking, filter out the spores and adjust the concentration to prepare a biological control agent against Hyphantria cunea. The spore concentration of the biological control agent against Hyphantria cunea is 10 7 cells / mL.

[0035] 2. Larval inoculation

[0036] The tested Hyphantria cunea larvae are 2 - 3 instar larvae, purchased from the Research Institute of Forest Ecology, Environment and Protection, Chinese Academy of Forestry. If they are less than 3 instars, they are reared in an artificial climate chamber (temperature 25°C, humidity 60 - 70%, light - dark ratio 14∶10 light) until they reach 3 instars, and surface - sterilized mulberry leaves are provided every day.

[0037] Adopt the dipping method to soak the healthy Hyphantria cunea larvae in the biological control agent against Hyphantria cunea prepared above for 30 s. Transfer the soaked Hyphantria cunea to a sterile culture box (a total of 20 culture boxes, with one treated Hyphantria cunea in each box) and feed them with fresh mulberry leaves (the mulberry leaves are also soaked in the spore suspension for 15 s). In the experiment, Hyphantria cunea and mulberry leaves treated with 0.01% Tween - 80 solution are used as the control, and they are cultured in a constant - temperature incubator at 25°C. Observe and record the death situation of Hyphantria cunea within 7 days. The experiment is repeated 3 times in total.

[0038] The experimental results are shown in Table 2.

[0039] Table 2 Mortality rate of Hyphantria cunea larvae (%) after inoculation with JSAFC 2128

[0040]

[0041] As shown in Table 2 and Figure 3As shown, the survival rate of the larvae of Hyphantria cunea treated with the biological control agent against Hyphantria cunea was significantly lower than that of the control group after 7 days. The larvae were also covered with hyphae, and lethality began from the first day, and the mortality rate also increased significantly after the second day. Most of the dead larvae concentrated from 3 to 6 days. The biological control agent against Hyphantria cunea of the present invention showed strong lethal activity against the larvae of Hyphantria cunea, and the mortality rate of Hyphantria cunea could be increased to 96.7% after 7 days of treatment and culture of Hyphantria cunea.

[0042] 3. Pupa inoculation

[0043] The healthy pupae of Hyphantria cunea were immersed in the biological control agent against Hyphantria cunea prepared above for 30 s by the impregnation method. The treated pupae of Hyphantria cunea were transferred to a sterile culture box (one treated pupa of Hyphantria cunea was placed in each box). In the experiment, the pupae of Hyphantria cunea treated with 0.01% Tween-80 solution were used as the control, and they were cultured in a constant temperature incubator at 25 °C, and the growth status of the pupae of Hyphantria cunea within 7 days was observed and recorded.

[0044] The experimental results are as Figure 4 shown. The pupae of Hyphantria cunea treated with the biological control agent against Hyphantria cunea were dark brown after 7 days, could not develop normally, and the emergence rate was 0.

[0045] The above are only the preferred embodiments of the present invention, and do not impose any limitations on the present invention. Any simple modifications, changes and equivalent transformations made to the above embodiments according to the technical essence of the present invention still belong to the protection scope of the technical solution of the present invention.

Claims

1. A chlamydosporicidal Mortierella Entomortierella chlamydospora ), which is characterized by The strain number of the chlamydosporic spore Mortierella is JSAFC 2128, which is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration Committee on September 23, 2024, with a deposit number of CGMCC41564, and the microbial classification is named Entomortierella chlamydospora .

2. A biological control fungus agent for the American white moth, characterized in that: The active ingredient of the gypsy moth biocontrol fungus is the Mortierella chlamydosporium described in claim 1.

3. Use of the Mortierella chlamydospora described in claim 1 and the biological control fungus of the gypsy moth described in claim 2 in inhibiting the growth of the gypsy moth.

4. The use according to claim 3, characterized in that: The application is specifically to spray the spore suspension of Mortierella chlamydospora according to claim 1 on the larvae or pupae of the white moth.

5. The use according to claim 4, characterized in that: The application also includes feeding mulberry leaves soaked with spore suspension of Mortierella chlamydosporium.

6. The use according to claim 4, characterized in that: The preparation method of the spore suspension is: (1) Apply the biocontrol bacteria of the American white moth Entomortierella chlamydospora JSAFC 2128 was inoculated on PDA medium to prepare the culture; (2) placing the culture obtained in step (1) in a Tween-80 solution, filtering out the spores, and preparing a biological control agent for the gypsy moth.

7. The use according to claim 6, characterized in that: The culture conditions described in step (1) are: culture at 25° C. in the dark for 5-7 days.

8. The use according to claim 6, characterized in that: The spore concentration of Mortierella chlamydospora in step (2) is 10 7 Pieces / mL.