Recombinant bacillus subtilis for displaying fusion protein of edwardsiella tarda outer membrane protein OmpA and vibrio cholerae enterotoxin CTB on surface, construction method and application

Abstract

The invention discloses recombinant bacillus subtilis with the surface displaying Edwardsiella tarda outer membrane protein OmpA and vibrio cholerae enterotoxin CTB fusion protein, a construction method and application, spore capsid protein CotY serves as an anchor point, coding genes of OmpA and CTB are recombined into a genome of bacillus subtilis 168 in a homologous double cross mode, and the recombinant bacillus subtilis is obtained. The recombinant bacillus subtilis can be stably inherited in the bacillus subtilis and displays edwardsiella tarda outer membrane protein OmpA and vibrio cholerae enterotoxin CTB on the spore surface; after fishes and mammals orally immunize the Edwardsiella tarda, the survival time and the survival rate of bodies infected with the Edwardsiella tarda are remarkably improved; the recombinant bacillus subtilis is used as an oral vaccine type micro-ecological immune preparation for preventing and treating Edwardsiella tarda infection of fishes and mammals, the immune procedure is remarkably simplified, the immune stress is reduced, the labor cost is saved, the effective action concentration in the intestinal tract is ensured, and the organism is induced to generate specific immune response.

Description

Technical Field

[0001] The present invention relates to the technical field of biological vaccines, and in particular to a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on its surface, a construction method and an application thereof. Background Art

[0002] Edwardsiella tarda is a Gram-negative, intracellular pathogen that belongs to the Enterobacteriaceae family. It can infect a variety of animals including fish, amphibians, reptiles and mammals, causing Edwardsiella disease, which leads to significant economic losses in commercial freshwater and marine fisheries worldwide.

[0003] As a Gram-negative bacterium, Edwardsiella tarda's cell membrane consists of three layers: inner membrane, periplasm and outer membrane. The outer membrane is mainly composed of phospholipids, lipopolysaccharide and outer membrane proteins (OMPs). Outer membrane proteins play a key role in bacterial adaptive response and are highly conserved throughout the evolutionary process. At the same time, because the epitopes exposed on the cell surface are highly immunogenic, they are one of the best candidate antigens today. Vibrio cholerae toxin B subunit (CTB) is the non-toxic part of Vibrio cholerae toxin, which has strong immunogenicity and adjuvant activity. It can be combined with antigens through gene fusion or chemical manipulation to increase the immune response of mucosal surface antigens. At the same time, after Vibrio cholerae toxin CTB enters the digestive tract, it can effectively improve the permeability of digestive tract mucosal cells, maintain the integrity of vaccine antigens, reduce degradation loss, and improve the immune effect.

[0004] As a safe and effective alternative to antibiotics, vaccines are increasingly used in the control of bacterial diseases in modern aquaculture. At present, Edwardsiella tarda vaccines mainly include inactivated whole-cell vaccines, live attenuated vaccines, bacterial exuviae vaccines, DNA vaccines and recombinant subunit vaccines. Among them, only a few inactivated whole-cell vaccines and live attenuated vaccines are approved for use in fish, and most of them are applied by immersion immunization or injection immunization. These routes are time-consuming, costly and labor-intensive. At the same time, due to crowding, grasping and injection, fish are subjected to great stress. Therefore, the limitation of immunization routes has become the main obstacle to the promotion and use of such vaccines on a larger scale. Oral immunization has the advantages of convenient operation and no stress. However, due to the acidic environment and rich digestive enzymes in the digestive tract, the antigens have been partially degraded before reaching the sites of uptake, presentation and transport. Therefore, the development of a new antigen presentation system to ensure that the antigens are free from degradation in the digestive tract has become an urgent need for the development of oral vaccines for fish. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a recombinant Bacillus subtilis with a surface display of an outer membrane protein OmpA of Edwardsiella tarda and a fusion protein of Vibrio cholerae enterotoxin CTB, a construction method and an application thereof. With spore capsid protein CotY as an anchor, the coding genes of OmpA and CTB are homologously double-crossed and recombined into the genome of Bacillus subtilis 168 to obtain a recombinant Bacillus subtilis that can be stably inherited in Bacillus subtilis and display the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on the surface of spores; after fish and mammals are orally immunized with the recombinant Bacillus subtilis, the survival time and survival rate of the organism after infection with Edwardsiella tarda are significantly improved; the recombinant Bacillus subtilis is used as an oral vaccine-type microecological immune preparation for preventing and treating Edwardsiella tarda infection in fish and mammals, which can significantly simplify the immunization procedure, reduce immune stress, save labor costs, ensure the effective action concentration in the intestine, and induce the body to produce a specific immune response.

[0006] In order to achieve the above technical effects, the following technical solutions are adopted:

[0007] A recombinant Bacillus subtilis that displays a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on its surface. The spore capsid protein CotY is used as an anchor point, and the coding genes of OmpA and CTB are homologously double-crossed and recombined into the genome of Bacillus subtilis 168 by a chemical transformation method. The obtained recombinant Bacillus subtilis can be stably inherited in Bacillus subtilis and display the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on the surface of the spore.

[0008] A method for constructing a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on its surface comprises the following steps:

[0009] Step S1:

[0010] The genome of Bacillus subtilis 168 was used as a template, cotY-F and cotY-R were used as primers, and Bam HI and Hind Ⅲ restriction sites were introduced at the 5' end of the upstream and downstream primers, respectively. The corresponding sites are underlined. The coding gene cotY containing the promoter encoding the spore capsid protein CotY was amplified by PCR. The sequence of the obtained PCR product is shown in the sequence table SEQ ID NO.3. The PCR product was connected to pMD TM 19Simple vector and transformed into competent cells for cloning to obtain the recombinant plasmid pMD-cotY;

[0011] The primers are as follows:

[0012] cotY-F: [5'-CG GGATCCTGACTGTGACCATCCGTTAG-3'], which is SEQ ID NO.1

[0013] cotY-R: [5'-CG AAGCTT TCCATTGTGATGATGCTTTTTA-3'], which is SEQ ID NO.2;

[0014] Step S2:

[0015] Using gene synthesis and TA cloning, the gene fragment encoding Vibrio cholerae enterotoxin B subunit was connected to the 3' end of the ompA gene through a linker to form a tandem ompA-linker-ctB gene fragment, and a HindⅢ restriction site was introduced at the 5' end of the sequence, and a stop codon "TAA" and an EcoRⅠ restriction site were introduced at the 3' end, and then connected to pMD TM 19Simple vector, and transformed into competent cells for cloning to obtain the recombinant plasmid pMD-ompA-linker-ctB;

[0016] The Gene ID of the gene fragment encoding Vibrio cholerae enterotoxin B subunit is U25679.1, and the sequence is shown in SEQ ID NO.7;

[0017] Step S3:

[0018] The integration plasmid pDG364 and the recombinant plasmid pMD-cotY were double-digested with Bam HI and Hind Ⅲ, respectively, and the cotY fragment obtained by the digestion was connected with pDG364, and then transformed into competent cells for cloning to obtain the recombinant integration plasmid pDG364-cotY;

[0019] Step S4:

[0020] The recombinant integrative plasmid pDG364-cotY and the recombinant plasmid pMD-ompA-linker-ctB were double-digested with HindⅢ and EcoRⅠ, respectively, the ompA-linker-ctB fragment obtained by enzyme digestion was connected with pDG364-cotY, and transformed into competent cells for cloning to obtain the recombinant integrative plasmid pDG364-cotY-ompA-linker-ctB;

[0021] Step S5:

[0022] The recombinant integrative plasmid pDG364-cotY-ompA-linker-ctB was linearized by single enzyme digestion using restriction endonuclease Xba I, and the linearized plasmid was transferred into competent cells of wild-type Bacillus subtilis 168 by chemical transformation. The amylase encoding gene amyE was used as a homologous double crossover recombination site, and the cotY-ompA-linker-ctB fragment was inserted into the genome of Bacillus subtilis 168 to obtain the recombinant Bacillus subtilis that displays the outer membrane protein OmpA of Edwardsiella tarda and the Vibrio cholerae enterotoxin CTB fusion protein on the surface.

[0023] Furthermore, the ompA gene in step S2 is a gene encoding the outer membrane protein OmpA of Edwardsiella tarda.

[0024] Furthermore, the linker sequence in step S2 is shown as SEQ ID NO.8; the tandem ompA-linker-ctB gene fragment is shown as SEQ ID NO.9;

[0025] Furthermore, the competent cells in step S1 are Escherichia coli DH5α; and the competent cells in step S2 are Escherichia coli DH5α.

[0026] Furthermore, the competent cells in step S3 are Escherichia coli DH5α.

[0027] Furthermore, in step S4, the obtained recombinant integration plasmid is transferred into Escherichia coli DH5α competent cells for cloning and amplification.

[0028] A recombinant Bacillus subtilis with surface display of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB fusion protein in the preparation of biological products against Edwardsiella tarda infection.

[0029] A recombinant Bacillus subtilis with surface display of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB fusion protein in the preparation of vaccines against Edwardsiella tarda infection.

[0030] A recombinant Bacillus subtilis with surface display of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB fusion protein in the preparation of an oral vaccine-type microecological immune preparation against Edwardsiella tarda infection.

[0031] The beneficial effects of the present invention are:

[0032] 1. The present invention uses genetic engineering means to connect the coding gene ompA of the outer membrane protein OmpA of Edwardsiella tarda and the coding gene ctB of the enterotoxin B subunit of Vibrio cholerae to the integrative plasmid pDG364 through a linker, and then uses the spore capsid protein CotY as an anchor point and the amylase gene amyE on pDG364 as a homologous arm to use a homologous double crossover recombination method to embed the outer membrane protein ompA gene of Edwardsiella tarda and the enterotoxin ctB gene of Vibrio cholerae into the genome of wild-type Bacillus subtilis 168, thereby obtaining a recombinant Bacillus subtilis Et2 that can be stably inherited in Bacillus subtilis and display the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae on the surface of spores.

[0033] 2. Application tests on mammals represented by mice showed that compared with recombinant Bacillus subtilis Et1 and wild-type Bacillus subtilis 168 that only displayed the outer membrane protein OmpA of Edwardsiella tarda, oral immunization with recombinant Bacillus subtilis Et2 by mixing with feed can significantly increase the IgG level against the outer membrane protein OmpA of Edwardsiella tarda in the mouse serum, significantly increase the sIgA content against the outer membrane protein OmpA of Edwardsiella tarda in the small intestinal contents of mice, induce mice to produce specific immune responses, and significantly improve the survival rate of mice after infection with Edwardsiella tarda.

[0034] 3. Application tests on fish represented by zebrafish showed that compared with recombinant Bacillus subtilis Et1 and wild-type Bacillus subtilis 168 that only displayed the outer membrane protein OmpA of Edwardsiella tarda, oral immunization with recombinant Bacillus subtilis Et2 by mixing feed can significantly increase the IgM level against the outer membrane protein OmpA of Edwardsiella tarda in zebrafish serum, induce zebrafish to produce specific immune response, and significantly increase the survival time and survival rate of zebrafish infected with Edwardsiella tarda. This provides a new solution for the prevention and treatment of Edwardsiella tarda in aquatic economic animals such as tilapia, flounder, turbot, carp, eel, channel catfish, striped bass and trout during the breeding process.

[0035] 4. The recombinant Bacillus subtilis Et2 of the present invention can be directly added to fish feed by stably displaying the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB fusion protein of Vibrio cholerae on the surface of the spores. Compared with the traditional injection immunization or immersion immunization vaccines for fish, the oral vaccine-type microecological immune preparation recombinant Bacillus subtilis Et2 can significantly simplify the immunization procedure, reduce immune stress, and save labor costs. At the same time, compared with the common genetically engineered bacteria such as lactobacillus, lactococci or enterococci as expression vectors, the spores of recombinant Bacillus subtilis Et2 can still maintain immunogenicity under extreme conditions, avoid antigen inactivation or degradation caused by production, transportation or digestive tract environment, ensure its effective concentration in the body, induce specific mucosal immunity in the intestine, reduce the loss during production and application, and ensure the economic benefits of each link. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is a schematic diagram of the integrative plasmid pDG364 of an embodiment of the present invention;

[0037] Figure 2 This is a schematic diagram of the recombinant integration plasmid pDG364-cotY-ompA of an embodiment of the present invention;

[0038] Figure 3 This is a schematic diagram of the recombinant integration plasmid pDG364-cotY-ompA-linker-ctB of an embodiment of the present invention;

[0039] Figure 4 This is a schematic diagram of homologous double crossover recombination according to an embodiment of the present invention;

[0040] Figure 5 This is a schematic diagram of the amylase activity verification results of the recombinant Bacillus subtilis of the embodiment of the present invention;

[0041] Figure 6 This is a schematic diagram of the PCR verification results of the integration site of the recombinant Bacillus subtilis Et1 according to an embodiment of the present invention;

[0042] Figure 7 This is a schematic diagram of the PCR verification results of the integration site of the recombinant Bacillus subtilis Et2 of the embodiment of the present invention;

[0043] Figure 8 This is a schematic diagram of Western Blot test results of prokaryotic expression of Edwardsiella tarda outer membrane protein OmpA in an embodiment of the present invention;

[0044] Fig. 9 This is a schematic diagram of the immunofluorescence verification results of the recombinant Bacillus subtilis of an embodiment of the present invention;

[0045] Fig.10is the IgG level against Edwardsiella tarda outer membrane protein OmpA in the serum of mice in the present invention;

[0046] Fig.11 The sIgA level against Edwardsiella tarda outer membrane protein OmpA in the small intestinal contents of mice in the embodiment of the present invention;

[0047] Fig.12 This is the survival curve of mice infected with Edwardsiella tarda in an embodiment of the present invention;

[0048] Fig.13 is the IgM level against Edwardsiella tarda outer membrane protein OmpA in zebrafish serum in the embodiment of the present invention;

[0049] Fig.14 This is a survival curve of zebrafish infected with Edwardsiella tarda in an embodiment of the present invention. DETAILED DESCRIPTION

[0050] The present invention is further described below in conjunction with the accompanying drawings, and the protection scope of the present invention is not limited to the following:

[0051] Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0052] The microorganism and plasmid involved in the present invention are:

[0053] Escherichia coli BL21, Escherichia coli DH5α, plasmid pET-32a(+) and plasmid pMD TM19Simple was purchased from TaKaRa Biotechnology (Beijing) Co., Ltd. (TaKaRa); Bacillus subtilis 168 (Bacillus subtilis 168) and plasmid pDG364 were purchased from the Bacillus Genetic Stock Center (http: / / www.bgsc.org); Edwardsiella tarda XYHZY Q (Edwardsiella tarda XYHZYQ) was purchased from the Animal Microecology Research Center of Sichuan Agricultural University. It is a strain in the prior art and is recorded in "Cao, Y., Wang, Z., Dai, X., Zhang, D., Zeng, Y., Ni, X., & Pan, K. (2024). Evaluation of probiotic properties of a Brevibacillus laterosporus strain. FASEB Journal, 38(5), e23530.doi:10.1096 / fj.202302408R".

[0054] Embodiment 1:

[0055] The present invention discloses a method for preparing a recombinant Bacillus subtilis Et1 which displays the outer membrane protein OmpA of Edwardsiella tarda on its surface and has the function of an oral vaccine-type microecological immune preparation for preventing and treating Edwardsiella tarda infection in fish and mammals, comprising the following steps:

[0056] (1) Using the genome of Bacillus subtilis 168 as a template:

[0057] cotY-F[5'-CG GGATCC TGACTGTGACCATCCGTTAG-3'] (SEQ ID NO.1) and cotY-R[5'-CG AAGCTT TCCATTGTGATGATGCTTTTTA-3'] (SEQ ID NO.2) was used as primer, and restriction sites of Bam HI and Hind III were introduced at the 5' end of the upstream and downstream primers (the corresponding sites are underlined), and PCR amplification of the spore capsid protein CotY coding gene cotY (including promoter) was performed. The sequence of the obtained PCR product is shown in the sequence table SEQ ID NO.3. The PCR product was connected to pMD TM The 19Simple vector was transformed into Escherichia coli DH5α competent cells, placed on LB plates or broth containing 50 μg / mL ampicillin sodium for screening and cloning to obtain the recombinant plasmid pMD-cotY.

[0058] (2) Using the genome of Edwardsiella tarda XYHZYQ as a template:

[0059] ompA-F[5'-CC AAGCTT GCTCCGAAAGATAACACCTG-3'] (SEQ ID NO.4) and ompA-R[5'-C GAATTC TTAAGCCTGCGGCTGAGTAACTT] (SEQ ID NO.5) was used as primer, and the restriction sites of HindⅢ and EcoRI (the corresponding sites are underlined) and the stop codon "TTA" were introduced at the 5' end of the upstream and downstream primers respectively, and the coding gene ompA encoding the outer membrane protein OmpA was amplified. The sequence of the obtained PCR product is shown in the sequence table SEQ ID NO.6. The PCR product was connected to pMD TM The 19Simple vector was transformed into Escherichia coli DH5α competent cells, placed in LB plates or broth containing 50 μg / mL ampicillin sodium for screening and cloning to obtain the recombinant plasmid pMD-ompA.

[0060] (3) Figure 1 As shown (Bam HI, HindIII, EcoR I and Xba I represent different restriction sites; cat represents the chloramphenicol resistance gene; amyE represents the amylase encoding gene), the integration plasmid pDG364 and the recombinant plasmid pMD-cotY were double-digested with Bam HI and HindIII, respectively, the cotY fragment obtained by restriction digestion was connected to pDG364, transformed into Escherichia coli DH5α competent cells, placed on LB plates or broth containing 50 μg / mL ampicillin sodium for screening and cloning, and the recombinant integration plasmid pDG364-cotY was obtained.

[0061] (4) Figure 2 As shown in the figure (Bam HI, HindIII, EcoR I and Xba I represent different restriction sites; cat represents chloramphenicol resistance gene; amyE represents amylase encoding gene), the recombinant integrative plasmid pDG364-cotY and the recombinant plasmid pMD-ompA were double-digested with HindⅢ and EcoRⅠ, respectively, the ompA fragment obtained by restriction digestion was connected to pDG364-cotY and transformed into Escherichia coli DH5α competent cells, placed on LB plates or broth containing 50 μg / mL ampicillin sodium for screening and cloning, and the recombinant integrative plasmid pDG364-cotY-ompA was obtained.

[0062] (5) Figure 4As shown, the recombinant integrative plasmid pDG364-cotY-ompA was linearized by single enzyme digestion using restriction endonuclease Xba I, and the linear plasmid was transferred into the competent cells of wild-type Bacillus subtilis 168 by chemical transformation. The amylase encoding gene amyE was used as the homologous double crossover recombination site, and the cotY-ompA fragment was inserted into the genome of Bacillus subtilis 168. The cells were placed on an LB plate or broth containing 5 μg / mL of chloramphenicol for screening and cloning to obtain recombinant Bacillus subtilis Et1.

[0063] Example 2

[0064] The present invention discloses a method for preparing a recombinant Bacillus subtilis Et2 which displays an outer membrane protein OmpA of Edwardsiella tarda and a fusion protein of Vibrio cholerae enterotoxin CTB on its surface and has the function of an oral vaccine-type microecological immune preparation for preventing and treating Edwardsiella tarda infection in fish and mammals, comprising the following steps:

[0065] (1) Using the genome of Bacillus subtilis 168 as a template:

[0066] cotY-F[5'-CG GGATCC TGACTGTGACCATCCGTTAG-3'] (SEQ ID NO.1) and cotY-R[5'-CG AAGCTT TCCATTGTGATGATGCTTTTTA-3'] (SEQ ID NO.2) was used as primer, Bam HI and Hind III restriction sites were introduced at the 5' end of the upstream and downstream primers respectively (the corresponding sites are underlined), and PCR amplification of the spore capsid protein CotY coding gene cotY (including promoter) was performed. The sequence of the obtained PCR product is shown in the sequence table SEQ ID NO.3. The PCR product was connected to pMD TM The 19Simple vector was transformed into Escherichia coli DH5α competent cells, placed on LB plates or broth containing 50 μg / mL ampicillin sodium for screening and cloning to obtain the recombinant plasmid pMD-cotY.

[0067] (2) Using gene synthesis and TA cloning, the gene fragment encoding the B subunit of Vibrio cholerae enterotoxin (Gene ID: U25679.1, i.e., SEQ ID NO.7) was connected to the 3' end of the ompA gene encoding the outer membrane protein OmpA of Edwardsiella tarda through a linker (SEQ ID NO.8) to form a tandem ompA-linker-ctB gene fragment (SEQ ID NO.9). A HindⅢ restriction site was introduced at the 5' end of the sequence, and a stop codon "TAA" and an EcoRⅠ restriction site were introduced at the 3' end. The fragment was then connected to pMD TM19Simple vector, and transformed into Escherichia coli DH5α competent cells, placed in LB plates or broth containing 50 μg / mL ampicillin sodium for screening and cloning to obtain the recombinant plasmid pMD-ompA-linker-ctB.

[0068] (4) Figure 1 As shown (Bam HI, HindIII, EcoR I and Xba I represent different restriction sites; cat represents the chloramphenicol resistance gene; amyE represents the amylase encoding gene), the integration plasmid pDG364 and the recombinant plasmid pMD-cotY were double-digested with Bam HI and HindIII, respectively, the cotY fragment obtained by restriction digestion was connected to pDG364, transformed into Escherichia coli DH5α competent cells, placed on LB plates or broth containing 50 μg / mL ampicillin sodium for screening and cloning, and the recombinant integration plasmid pDG364-cotY was obtained.

[0069] (5) Figure 3 As shown in the figure (Bam HI, HindIII, EcoR I and Xba I represent different restriction sites; cat represents chloramphenicol resistance gene; amyE represents amylase encoding gene), the recombinant integrative plasmid pDG364-cotY and the recombinant plasmid pMD-ompA-linker-ctB were double-digested with HindⅢ and EcoRⅠ, respectively, the ompA-linker-ctB fragment obtained by restriction digestion was connected to pDG364-cotY, transformed into Escherichia coli DH5α competent cells, placed on LB plates or broth containing 50 μg / mL ampicillin sodium for screening and cloning, and the recombinant integrative plasmid pDG364-cotY-ompA-linker-ctB was obtained.

[0070] (6) Figure 4 As shown, the recombinant integrative plasmid pDG364-cotY-ompA-linker-ctB was linearized by single enzyme digestion using restriction endonuclease Xba I, and the linear plasmid was transferred into the competent cells of wild-type Bacillus subtilis 168 by chemical transformation. The amylase encoding gene amyE was used as the homologous double crossover recombination site, and the cotY-ompA-linker-ctB fragment was inserted into the genome of Bacillus subtilis 168, and the cells were placed on an LB plate or broth containing 5 μg / mL of chloramphenicol for screening and cloning to obtain recombinant Bacillus subtilis Et2.

[0071] Example 3

[0072] The amylase verification method of two oral vaccine-type microecological immune preparations recombinant Bacillus subtilis of the present invention for preventing and treating Edwardsiella tarda infection in fish and mammals, a recombinant subtilis spore Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda on the surface, and a recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on the surface is as follows:

[0073] After the exogenous gene fragment was inserted into the genome of wild-type Bacillus subtilis 168, recombinant Bacillus subtilis Et1 carrying ompA or recombinant Bacillus subtilis Et2 carrying ompA-linker-ctB fragment was obtained, resulting in the loss of amylase gene and inability to decompose and utilize starch. The results of amylase activity analysis of recombinant Bacillus subtilis Et1 and recombinant Bacillus subtilis Et2 are shown in Figure 5 .according to Figure 5 It can be seen that after 24 hours of cultivation, the starch around the colonies of the wild-type Bacillus subtilis 168 was fully utilized to form a transparent starch hydrolysis circle; the starch around the colonies of the recombinant Bacillus subtilis Et1 and the recombinant Bacillus subtilis Et2 was still not utilized after 24 hours of growth and cultivation, and no starch hydrolysis circle was formed, which proved that the amylase expression gene of the two recombinant Bacillus subtilis was missing, and the constructed target gene fragment was successfully homologously recombined into the genome of the wild-type Bacillus subtilis 168, obtaining a new genetically engineered strain.

[0074] Example 4

[0075] Integration site verification of two oral vaccine-type microecological immune preparations recombinant Bacillus subtilis for preventing and treating Edwardsiella tarda infection in fish and mammals, a recombinant subtilis spore Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda on the surface, and a recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on the surface, comprises the following steps:

[0076] (1) Verify the integration site of the ompA gene on the recombinant Bacillus subtilis Et1 genome. Using the genomes of Bacillus subtilis 168 and recombinant Bacillus subtilis Et1 as templates, PCR amplification was performed using ompA-F / ompA-R, amyE-F (SEQ ID NO.10) / amyE-R (SEQ ID NO.11), amyE-F / ompA-R and ompA-F / amyE-R as primers. The size of the PCR product was detected by agarose gel electrophoresis. The detection results are shown in Figure 6 (Lane M is DNA maker of 250bp-15000bp). Figure 6It can be seen that, with the genome of Bacillus subtilis 168 as template, except for amyE-F / amyE-R, the other three pairs of primers failed to successfully amplify products. When amyE-F / amyE-R were used as primers, the size of the PCR product obtained was 556 bp, which was consistent with the expected amyE gene size and the theoretical sequence of amyE in wild-type Bacillus subtilis 168 (Gene subtilis Et1 was used as a template, and the sizes of PCR products obtained by the four pairs of primers were 1008 bp, 3881 bp, 2326 bp and 2563 bp, respectively, which were consistent with expectations, further confirming that the coding gene ompA for expressing the outer membrane protein OmpA of Edwardsiella tarda was successfully integrated into the amyE gene of the wild-type Bacillus subtilis 168, and the recombinant Bacillus subtilis Et1 with the amylase expression gene amyE deleted and the ompA gene of Edwardsiella tarda integrated in the genome was obtained.

[0077] (2) Verify the integration site of the ompA-linker-ctB fragment on the recombinant Bacillus subtilis Et2 genome. Using the genomes of Bacillus subtilis 168 and recombinant Bacillus subtilis Et2 as templates, PCR amplification was performed using ompA-F / ompA-R, amyE-F / amyE-R, amyE-F / ompA-R and ompA-F / amyE-R as primers. The size of the PCR product was detected by agarose gel electrophoresis. The detection results are shown in Figure 7 (Lane M is DNA maker of 250bp-15000bp). Figure 7 It can be seen that, with the genome of Bacillus subtilis 168 as template, except for amyE-F / amyE-R, the other three pairs of primers failed to successfully amplify products. When amyE-F / amyE-R were used as primers, the size of the PCR product obtained was 556 bp, which was consistent with the expected amyE gene size and the theoretical sequence of amyE in wild-type Bacillus subtilis 168 (Gene subtilis Et2 was consistent with the results of the present invention; using the genome of the recombinant Bacillus subtilis Et2 as a template, the sizes of the PCR products obtained by the four pairs of primers were 1008 bp, 4220 bp, 2326 bp and 2902 bp, respectively, which were consistent with expectations, further confirming that the coding gene ompA for expressing the outer membrane protein OmpA of Edwardsiella tarda and the coding gene ctB for expressing the enterotoxin B subunit of Vibrio cholerae were successfully integrated into the amyE gene of the wild-type Bacillus subtilis 168, and the recombinant Bacillus subtilis Et2 in which the amylase expression gene amyE was deleted and the ompA gene of Edwardsiella tarda and the ctB gene of Vibrio cholerae enterotoxin were integrated into the genome was obtained.

[0078] Example 5

[0079] The biological activity verification of the OmpA protein of two oral vaccine-type microecological immune preparations for preventing and treating Edwardsiella tarda infection in fish and mammals, a recombinant subtilis spore Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda on the surface, and a recombinant Bacillus subtilis Et2 displaying the outer membrane protein OmpA of Edwardsiella tarda and the Vibrio cholerae enterotoxin CTB fusion protein on the surface, comprises the following steps:

[0080] (1) Prokaryotic expression of OmpA protein. Using the genome of Edwardsiella tarda XYHZYQ as a template, PompA-F[5'-CG GCGGCCGC GCTCCGAAAGATAACACCTG-3'] (SEQ ID NO.12) and PompA-R [5'-GGG CTCGAG AGCCTGCGGCTGAGTAACTT-3'](SEQ ID NO.13) was used as primer, and NotⅠ and XhoⅠ restriction sites were introduced at the 5' end of the upstream and downstream primers (the corresponding sites were underlined) to amplify the coding gene ompA of the OmpA protein. The PCR product of the ompA gene was double-digested with restriction endonucleases NotⅠ and XhoⅠ, respectively, and the expression plasmid pET-32a(+) was connected with the ompA gene obtained by restriction digestion and pET-32a(+), and then transferred into the competent cells of the expression host Escherichia coli DH5α, and placed in LB plates or broth containing 50μg / mL of ampicillin sodium for screening and cloning to obtain the recombinant expression plasmid pET-32a(+)-ompA.

[0081] (2) Expression and purification of OmpA protein. The recombinant expression plasmid pET-32a(+)-ompA was transferred into the expression host Escherichia coli BL21 competent cells, spread on LB plates containing 50 μg / mL ampicillin sodium to obtain single colonies, inoculated into LB broth containing 50 μg / mL ampicillin sodium, and induced with 0.25 mmol / L IPTG at 16°C overnight. The cells were collected, disrupted by ultrasonic wave, and purified using a His tag column affinity chromatography kit (purchased from Cytiva, USA) to obtain purified OmpA protein.

[0082] (3) The purified OmpA protein was subjected to Western Blot analysis. Figure 8As shown (lane M is the protein Maker of 15kDa-250kDa; lane 1 is the expression product of Escherichia coli BL21 / pET-32a(+)-ompA; lane 2 is the expression product of Escherichia coli BL21 / pET-32a(+)), it can be seen that the recombinant expression plasmid pET-32a(+)-ompA successfully expressed a specific band of about 57kDa in Escherichia coli BL21, which is consistent with the theoretical value.

[0083] (4) Preparation of mouse anti-OmpA serum. In the first week of the first immunization, the purified OmpA protein was mixed evenly with an equal volume of Freund's complete adjuvant (purchased from Sigma-Aldrich, USA) using the double push method to obtain Freund's complete adjuvant with an OmpA protein content of 0.5 g / mL, and the mice were immunized by multiple subcutaneous injections in the abdomen (0.2 mL / mouse); in the second and third weeks, booster immunizations were performed once each, and the purified OmpA protein was mixed evenly with an equal volume of Freund's incomplete adjuvant (purchased from Sigma-Aldrich, USA) using the double push method to obtain Freund's incomplete adjuvant with an OmpA protein content of 0.5 g / mL, and the mice were immunized by multiple subcutaneous injections in the abdomen (0.2 mL / mouse); one week after the third immunization, blood was collected from the eyeballs to obtain mouse anti-OmpA serum.

[0084] (5) Immunofluorescence verification of the display of Edwardsiella tarda outer membrane protein OmpA on the surface of recombinant Bacillus subtilis Et1 and recombinant Bacillus subtilis Et2 spores. Bacillus subtilis 168, recombinant Bacillus subtilis Et1 and recombinant Bacillus subtilis Et2 were inoculated into sporulation medium, respectively, and cultured at 150r / min and 37°C for 48h; the spores were collected and fixed on the surface of the slide, placed in 3% BSA-PBS blocking solution (purchased from Sangon Biotechnology (Shanghai) Co., Ltd.), blocked at room temperature for 30min, and washed 5 times with PBS (pH7.4); the blocked samples were placed in mouse anti-OmpA serum appropriately diluted with blocking solution, incubated at room temperature for 1h, and washed 5 times with PBS; the samples were incubated with fluorescein Cy3-labeled sheep anti-mouse IgG antibody (diluted 1:200 in blocking solution) at room temperature in the dark for 45min, washed 5 times with PBS, and then placed on a coverslip for observation and imaging under an immunofluorescence microscope. The verification results are shown in Fig. 9 (The scale bar is 100 μm). Under the excitation of 532 nm laser (green light), only the surfaces of recombinant Bacillus subtilis Et1 and recombinant Bacillus subtilis Et2 were loaded with Cy3-labeled goat anti-mouse IgG secondary antibody, which emitted orange-red fluorescence, indicating that the outer membrane protein OmpA of Edwardsiella tarda was successfully displayed in a biologically active form on the surface of recombinant Bacillus subtilis Et1 and recombinant Bacillus subtilis Et2, and could be recognized and bound by specific antibodies.

[0085] Example 6

[0086] The oral immunization effect of a recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda on the surface and a recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on mammals such as mice of the present invention comprises the following steps:

[0087] (1) Sixty 21-day-old SPF female Kunming mice (weight 18.0±2.0 g, purchased from Chengdu Dashuo Experimental Animal Co., Ltd.) were randomly divided into four groups as shown in Table 1. Group A was the control group, which was fed with a basal diet only. Groups B, C, and D were fed with a basal diet containing an equal amount of wild-type Bacillus subtilis 168, an equal amount of recombinant Bacillus subtilis Et1, and an equal amount of recombinant Bacillus subtilis Et2, respectively (the amount of spores in the feed was 2.0×10 6 CFU / g). During the experiment, mice in each group had free access to food and water, and the ambient temperature was controlled at 18℃-23℃.

[0088] Table 1 Oral immunization group design for mice

[0089]

[0090] (2) The entire experimental period was 42 days. On the 14th, 28th and 42nd days of the experiment, 5 mice were randomly selected from each group for eye sampling. The blood was collected and allowed to stand at room temperature for 2 h, then allowed to stand at 4°C overnight, and centrifuged at 4°C and 2500 r / min for 10 min. The serum was collected and stored in a -80°C refrigerator. After blood collection, the mice were killed by cervical dislocation, and the small intestine was aseptically dissected. The small intestinal contents were collected and packaged into 0.1 g / EP tube, supplemented with 0.9 mL of pre-cooled PBS, mixed thoroughly, centrifuged at 4°C and 4500 r / min for 10 min, and the supernatant was collected and stored in a -80°C refrigerator for later use.

[0091] (3) Indirect ELISA was used to detect the IgG level against Edwardsiella tarda outer membrane protein OmpA in mouse serum. The purified OmpA protein was diluted to 5 μg / mL using 0.05 mol / L carbonate buffer (pH 9.6) and added to a 96-well high-adsorption flat-bottom polystyrene ELISA plate (purchased from Wuhan Sevier Biotechnology Co., Ltd.), 100 μL per well, and adsorbed and fixed at 37°C until the liquid evaporated completely; washed three times with PBS (pH 7.4) washing solution (PBST) containing 0.05% Tween 20, 300 μL / well each time; added 250 μL of blocking solution (3% BSA-PBS) to each well, blocked at 37°C for 2h, and washed three times with PBST; diluted mouse serum 1:100 using blocking solution, 100 μL per well, incubated at 37°C for 2h, and washed three times with PBST; used blocking solution to stain the plate with horseradish peroxidase-labeled rabbit anti-mouse IgG (purchased from Santa Cruz, USA) Biotechnology Company) was diluted 1:2000, incubated at 37°C for 2h, washed three times with PBST; 100μL / well of TMB substrate colorimetric solution (purchased from Sangon Biotechnology (Shanghai) Co., Ltd.) was added, and the reaction was carried out at room temperature in the dark for 5min-10min; 100μL / well of 2mol / LH2SO4 was added to terminate the reaction; the absorbance of each well was measured at 450nm using an ELISA reader (Thermo MultiskanFC). The antibody level is expressed as P / N value: P / N = sample well OD 450 / PBS OD 450 .

[0092] (4) After mice and other mammals were orally immunized with recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda or recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on its surface, the IgG level against the outer membrane protein OmpA of Edwardsiella tarda in the mouse serum was shown in Table 2. According to Table 2, the IgG level against the outer membrane protein OmpA of Edwardsiella tarda was plotted. Fig.10(Data columns in the same cluster marked with different lowercase letters indicate significant differences (p<0.05), and marked with the same letters indicate insignificant differences (p>0.05)). It can be seen that compared with the control group and Bacillus subtilis 168 group, the levels of OmpA-specific IgG antibodies in the serum of mice in groups C and D fed with recombinant Bacillus subtilis were significantly increased (p<0.05), and gradually increased with the extension of immunization time. Among them, the serum specific IgG level of mice fed with recombinant Bacillus subtilis Et2 was always significantly higher than that of recombinant Bacillus subtilis Et1 (p<0.05), proving that recombinant Bacillus subtilis Et1 and Et2 displaying the outer membrane protein OmpA of Edwardsiella tarda on their surface can stimulate mice to produce high levels of OmpA-specific IgG antibodies, among which recombinant Bacillus subtilis Et2 fused with Vibrio cholerae enterotoxin CTB can enhance the immunogenicity of the antigen and prompt mammals such as mice to obtain higher levels of OmpA-specific IgG antibodies.

[0093] Table 2 IgG levels against Edwardsiella tarda outer membrane protein OmpA in mouse serum (P / N)

[0094]

[0095] Note: Data in the same industry with different lowercase letters on the right shoulder indicate significant differences (p<0.05), and data with the same lowercase letters indicate insignificant differences (p>0.05)

[0096] (5) Indirect ELISA was used to detect the level of sIgA against Edwardsiella tarda outer membrane protein OmpA in the small intestinal contents of mice. The purified OmpA protein was diluted to 5 μg / mL using 0.05 mol / L carbonate buffer (pH 9.6) and added to a 96-well high-adsorption flat-bottom polystyrene ELISA plate (purchased from Wuhan Sevier Biotechnology Co., Ltd.), 100 μL per well, and adsorbed and fixed at 37°C until the liquid evaporated completely; PBS (pH 7.4) washing solution (PBST) containing 0.05% Tween 20 was used to wash three times, 300 μL / well each time; 250 μL of blocking solution (3% BSA-PBS) was added to each well, blocked at 37°C for 2h, and washed three times with PBST; the supernatant of the small intestinal contents of mice was diluted 1:100 using the blocking solution, 100 μL per well, incubated at 37°C for 2h, and washed three times with PBST; horseradish peroxidase-labeled rabbit anti-mouse IgA (purchased from Santa Cruz, USA) was added using the blocking solution. Biotechnology Company) was diluted 1:2000, incubated at 37°C for 2h, washed three times with PBST; 100μL / well of TMB substrate colorimetric solution (purchased from Sangon Biotechnology (Shanghai) Co., Ltd.) was added, and the reaction was carried out at room temperature in the dark for 5min-10min; 100μL / well of 2mol / L H2SO4 was added to terminate the reaction; the absorbance of each well was measured at 450nm using an enzyme reader (Thermo Multiskan FC). The antibody level is expressed as P / N value: P / N = sample well OD 450 / PBS OD 450 .

[0097] (6) After mice and other mammals were orally immunized with recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda or recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB, the levels of sIgA against the outer membrane protein OmpA of Edwardsiella tarda in the small intestine of mice were shown in Table 3. According to Table 3, the levels of sIgA against the outer membrane protein OmpA of Edwardsiella tarda were plotted. Fig.11(The data columns in the same cluster marked with different lowercase letters indicate significant differences (p<0.05), and marked with the same letters indicate insignificant differences (p>0.05)). It can be seen that compared with the control group and Bacillus subtilis 168 group, the levels of OmpA-specific sIgA in the small intestinal contents of mice in groups C and D fed with recombinant Bacillus subtilis were significantly increased (p<0.05), and gradually increased with the extension of immunization time. Among them, the level of specific sIgA in the small intestinal contents of mice fed with recombinant Bacillus subtilis Et2 was always significantly higher than that of recombinant Bacillus subtilis Et1 (p<0.05), proving that recombinant Bacillus subtilis Et1 and Et2 displaying the outer membrane protein OmpA of Edwardsiella tarda on their surface can stimulate mice to produce high levels of OmpA-specific sIgA antibodies, among which recombinant Bacillus subtilis Et2 fused with Vibrio cholerae enterotoxin CTB can enhance the immunogenicity of the antigen and prompt mammals such as mice to obtain higher levels of OmpA-specific sIgA antibodies.

[0098] Table 3 sIgA levels against Edwardsiella tarda outer membrane protein OmpA in mouse small intestinal contents (P / N)

[0099]

[0100] Note: Data in the same industry with different lowercase letters on the right shoulder indicate significant differences (p<0.05), and data with the same lowercase letters indicate insignificant differences (p>0.05)

[0101] Example 7

[0102] The verification of the effects of a recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda on the surface and a recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on preventing and treating Edwardsiella tarda infection in mammals such as mice comprises the following steps:

[0103] (1) Fifty 21-day-old SPF female Kunming mice (weight 18.0±2.0 g, purchased from Chengdu Dashuo Experimental Animal Co., Ltd.) were randomly divided into five groups as shown in Table 4. Group A- and Group A+ were the negative control group and the positive control group, respectively, and were fed with a basal diet alone. Groups B, C, and D were fed with a basal diet containing an equal amount of wild-type Bacillus subtilis 168, an equal amount of recombinant Bacillus subtilis Et1, and an equal amount of recombinant Bacillus subtilis Et2, respectively (the amount of spores in the feed was 2.0×10 6 CFU / g). During the experiment, mice in each group had free access to food and water, and the ambient temperature was controlled at 18℃-23℃.

[0104] Table 4 Grouping and design of oral immunization and Edwardsiella tarda challenge in mice

[0105]

[0106]

[0107] (2) The entire experimental period was 45 days. On the 42nd day, mice in each group were fed and injected intraperitoneally with 0.5 mL / mouse Edwardsiella tarda XYHZYQ bacterial solution (7.6×10 9 CFU / mL) were used for virus challenge, and mice in group A were injected with an equal dose of normal saline and observed for 72 h. The deaths were recorded and the survival rate of mice was calculated.

[0108] (3) Mice and other mammals were orally immunized with recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda or recombinant Bacillus subtilis Et2 displaying the fusion protein of outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on its surface. 42 days later, they were infected with Edwardsiella tarda. The mortality of mice was as follows: Fig.12 As shown. Fig.12 It can be seen that no one in the negative control group died during the 72-hour observation period, with a survival rate of 100%; all mice in the positive control group died within 48 hours of the challenge, that is, the survival rate was 0%; 80% of the mice in group B that were orally immunized with wild-type Bacillus subtilis 168 died within 60 hours of the challenge, and the survival rate within 72 hours was only 20%; the survival rates of mice in groups C and D that were orally immunized with recombinant Bacillus subtilis within 72 hours were 50% and 60%, respectively. Therefore, compared with the positive control group, recombinant Bacillus subtilis Et1 and Et2 that display the outer membrane protein OmpA of Edwardsiella tarda on their surfaces can significantly improve the survival rate of mice and other mammals after infection with Edwardsiella tarda through oral immunization, among which recombinant Bacillus subtilis Et2 that integrates Vibrio cholerae enterotoxin CTB can further enhance the resistance of mice to Edwardsiella tarda.

[0109] Example 8

[0110] The oral immunization effect of a recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda on the surface and a recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on zebrafish and other fishes of the present invention comprises the following steps:

[0111] (1) Two hundred adult male zebrafish (purchased from Hubei Chuangxin Biotechnology Co., Ltd.) were randomly divided into four groups as shown in Table 5. Group A was the control group, which was fed only with a basal diet. Groups B, C, and D were fed with an equal amount of a basal diet containing wild-type Bacillus subtilis 168, an equal amount of a basal diet containing recombinant Bacillus subtilis Et1, and an equal amount of a basal diet containing recombinant Bacillus subtilis Et2, respectively (the amount of spores in the feed was 2.0 × 10 6 CFU / g), and feed the zebrafish at 5% of their body weight every day. During the experiment, the water temperature was kept constant at 22°C, and the experimental period was 45 days. After the end of the culture, all zebrafish were anesthetized, and 10 fish were repeated. The tails were cut off and blood was collected. The blood samples of each repeat were mixed, and after standing at room temperature for 2 hours, they were stood at 4°C overnight, centrifuged at 4°C and 2500r / min for 10 minutes, and the serum was collected and stored in a -80°C refrigerator for later use.

[0112] Table 5 Oral immunization grouping design for zebrafish

[0113]

[0114] (2) Indirect ELISA was used to detect the IgM level against Edwardsiella tarda outer membrane protein OmpA in zebrafish serum. The purified OmpA protein was diluted to 5 μg / mL using 0.05 mol / L carbonate buffer (pH 9.6), added to a 96-well high-adsorption flat-bottom polystyrene ELISA plate (purchased from Wuhan Saiweier Biotechnology Co., Ltd.), 100 μL per well, and adsorbed and fixed at 37°C until the liquid evaporated completely; washed three times with PBS (pH 7.4) washing solution (PBST) containing 0.05% Tween 20, 300 μL / well each time; 250 μL of blocking solution (3% BSA-PBS) was added to each well, blocked at 37°C for 2h, and washed three times with PBST; zebrafish serum was appropriately diluted using blocking solution, 100 μL per well, incubated at 37°C for 3h, and washed three times with PBST; mouse anti-zebrafish IgM monoclonal antibody (purchased from Creative Diagnostics, USA) was diluted 1:33 using blocking solution, incubated at 37°C for 1h, and washed five times with PBST; horseradish peroxidase-labeled sheep anti-mouse IgG (purchased from Santa Clara, USA) was labeled using blocking solution Cruz Biotechnology) was diluted 1:1000, incubated at 37°C for 1h, washed three times with PBST; 100μL / well of TMB substrate colorimetric solution (purchased from Sangon Biotechnology (Shanghai) Co., Ltd.) was added, and the reaction was carried out at room temperature in the dark for 5min-10min; 100μL / well of 2mol / L H2SO4 was added to terminate the reaction; the absorbance of each well was measured at 450nm using an ELISA reader (Thermo Multiskan FC). The antibody level is expressed as P / N value: P / N = sample well OD 450 / PBS OD 450 .

[0115] (3) After zebrafish and other fish were orally immunized with recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda or recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on its surface, the IgM level against the outer membrane protein OmpA of Edwardsiella tarda in the serum of zebrafish was shown in Table 6 . Fig.13 (Data columns marked with different lowercase letters indicate significant differences (p<0.05), and data columns marked with the same letters indicate insignificant differences (p>0.05)). It can be seen that compared with the control group and Bacillus subtilis 168 group, the levels of OmpA-specific IgM in the serum of zebrafish in groups C and D fed with recombinant Bacillus subtilis were significantly increased (p<0.05), among which the specific IgM level in the serum of zebrafish fed with recombinant Bacillus subtilis Et2 was significantly higher than that of recombinant Bacillus subtilis Et1 (p<0.05), proving that recombinant Bacillus subtilis Et1 and Et2 displaying the outer membrane protein OmpA of Edwardsiella tarda on their surface can stimulate zebrafish to produce high levels of OmpA-specific IgM antibodies, among which recombinant Bacillus subtilis Et2 fused with Vibrio cholerae enterotoxin CTB can enhance the immunogenicity of the antigen and prompt zebrafish to obtain higher levels of OmpA-specific IgM antibodies.

[0116] Table 6 IgM levels against Edwardsiella tarda outer membrane protein OmpA in zebrafish serum

[0117]

[0118] Note: Data in the same column marked with different lowercase letters on the right shoulder indicate significant differences (p<0.05), and marked with the same letters indicate no significant differences (p>0.05)

[0119] Example 9

[0120] The verification of the effects of a recombinant Bacillus subtilis spore Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda on the surface and a recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on zebrafish and other fishes on preventing and treating Edwardsiella tarda infection comprises the following steps:

[0121] (1) A total of 240 adult male zebrafish (purchased from Hubei Chuangxin Biotechnology Co., Ltd.) were randomly divided into five groups as shown in Table 7. Group A- and Group A+ were the negative control group and the positive control group, respectively, and were fed with a basal diet alone. Groups B, C, and D were fed with a basal diet containing wild-type Bacillus subtilis 168, an equal amount of a basal diet containing recombinant Bacillus subtilis Et1, and an equal amount of a basal diet containing recombinant Bacillus subtilis Et2, respectively (the amount of spores in the feed was 2.0 × 10 6 CFU / g), and the zebrafish were fed at 5% of their body weight every day. During the experiment, the water temperature was kept constant at 22°C, and the experimental period was 60 days. When the zebrafish in each group were fed to the 45th day, except for the A-group, the other four groups of zebrafish were intraperitoneally injected with 5 μL / tail of Edwardsiella tarda XYHZYQ bacterial solution (1.0×10 9 CFU / mL) were used for virus challenge, and zebrafish in group A were injected with an equal dose of normal saline and observed for 15 days. The mortality was recorded and the survival rate of zebrafish was calculated.

[0122] Table 7 Grouping and design of oral immunization and Edwardsiella tarda challenge of zebrafish

[0123]

[0124]

[0125] (2) Zebrafish and other fish were orally immunized with recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda or recombinant Bacillus subtilis Et2 displaying the fusion protein of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB. 45 days later, they were infected with Edwardsiella tarda. The mortality of zebrafish was as follows: Fig.14 As shown. Fig.14It can be seen that no one in the negative control group died during the 15-day observation period, with a survival rate of 100%; all of the positive control group died 12 days after the infection, that is, the survival rate was 0%; for the zebrafish in group B orally immunized with wild-type Bacillus subtilis 168, 27.08% (13 / 48) of the zebrafish died on the third day after the infection, and this continued until the 13th day, when all 48 zebrafish died, that is, the survival rate was 0%; the zebrafish in groups C and D orally immunized with recombinant Bacillus subtilis had survival rates of 72.92% (35 / 48) and 85.42% (41 / 48), respectively, during the 15-day observation period, among which 12.50% (6 / 48) of the zebrafish in group C fed with recombinant Bacillus subtilis Et1 died on the third day after the infection, while 4.17% (2 / 48) of the zebrafish in group D fed with recombinant Bacillus subtilis Et2 died 8 days after the infection. Therefore, compared with the positive control group and the oral immunization wild-type Bacillus subtilis 168, the recombinant Bacillus subtilis Et1 and Et2 that display the outer membrane protein OmpA of Edwardsiella tarda on their surface can significantly improve the survival rate of zebrafish and other fish after infection with Edwardsiella tarda through oral immunization. Among them, the recombinant Bacillus subtilis Et2 that is fused with Vibrio cholerae enterotoxin CTB can further enhance the resistance of zebrafish to Edwardsiella tarda and prolong the survival time of zebrafish after infection with Edwardsiella tarda.

[0126] In summary, the present invention discloses a recombinant Bacillus subtilis that displays a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on its surface, a construction method, and its application in preventing Edwardsiella tarda infection. This technology uses the spore capsid protein CotY as an anchor point, and uses a chemical transformation method to homologously double-cross recombine the coding genes of OmpA and CTB into the genome of Bacillus subtilis 168, thereby obtaining a recombinant Bacillus subtilis Et2 that can be stably inherited in Bacillus subtilis and displays the outer membrane protein OmpA of Edwardsiella tarda and Vibrio cholerae enterotoxin CTB on the surface of spores. Compared with the recombinant Bacillus subtilis Et1 that only displays the outer membrane protein OmpA of Edwardsiella tarda and the wild-type Bacillus subtilis 168, after fish and mammals orally take the recombinant Bacillus subtilis Et2, the level of specific antibodies against OmpA protein in the body can be significantly improved, and the survival time and survival rate of the body after infection with Edwardsiella tarda can be improved. Recombinant Bacillus subtilis Et2 is an oral vaccine-type microecological immune preparation for preventing and treating Edwardsiella tarda infection in fish and mammals. It can significantly simplify the immunization procedure, reduce immune stress, save labor costs, ensure effective concentration in the intestine, and induce the body to produce specific immune responses.

[0127] SEQ ID NO.1 (cotY-F):

[0128] cgggatcctg actgtgacca tccgttag 28

[0129] SEQ ID NO.2(cotY-R):

[0130] cgaagctttc cattgtgatg atgctttta 30

[0131] SEQ ID NO.3(cotY,1134):

[0132] cgggatcctg actgtgacca tccgtgatat gacaaagaga aagataaaga aaaacacgaa 60

[0133] agaaaatgtc attgcgacgt ttgctgtaat ggcaatggtt tttttggcaa cgacaacgcc 120

[0134] ttcatcgacc aagatctagc tcaagcaaat ctcaacaaac aagtttcaga tgaaacgatt 180

[0135] attattagag attcttgtga catcaatgtt acatctacag acgttcaagc cgtaacatca 240

[0136] gttgtaacag cacttaatgc cgctgtcgta acggcaactc tgacatcaat tgcagacggc 300

[0137] gtaattgccg aattagtcgc acaagatttg ttacagctta cagctaacaa acaagtaaac 360

[0138] cgccaaaaac ttctcatcga atgttcccgc ggcgtaaacg tcacaacagt agatgccgat 420

[0139] atcgcaaccc ttattctac agcaacaaat acactcgtag ccatcctagt tatcactctt 480

[0140] gtcctctagg acctaaaagc agagctaaaa acgctctgct ttttcttatt ttccaagcat 540

[0141] atgatgaata tatagacgtt cacccacacc aagtggggca cgggtacata tgttgttaag 600

[0142] gactaaagtc aaatacccta taaagaagga gctgaaatca atgagctgcg gaaaaaccca 660

[0143] tggccggcat gagaactgtg tatgcgatgc agtggaaaag attttagcag agcaggaggc 720

[0144] agttgaagaa cagtgtccga ctggctgcta taccaacctt ttaaacccta cgattgctgg 780

[0145] aaaagacaca attccgtttc tcgtttttga taaaaaaggc ggattgttct ccacattcgg 840

[0146] aaacgtaggg ggatttgtgg atgatatgca atgctttgaa tccattttct tccgcgtcga 900

[0147] aaaattatgc gattgctgtg caacactgtc tattttacgc ccggtcgatg tcaaaggcga 960

[0148] taccttaagt gtttgccacc cttgcgaccc ggatttcttc gggctagaaa aaacagattt1020

[0149] ctgcattgaa gtggatctcg gatgcttctg cgcgattcag tgcctgtcac cagagctagt1080

[0150] tgacagaaca tcgcctcaca aagataaaa gcatcatcac aatggaagc ttcg 1134

[0151] SEQ ID NO.4(ompA-F):

[0152] ccaagcttgc tccgaagat aacaccctg 28

[0153] SEQ ID NO.5(ompA-R):

[0154] cgaattctta agcctgcggc tgagtactt 30

[0155] SEQ ID NO.6(ompA,1008):

[0156] ccaagcttgc tccgaaagat aacacctggt acgtcggtgg taaactgggc tggtcccact60ttatcagcaa cagctttgaa gacatgggta caaccaagcc ccatccgaat cagctgggcg120ccggtgcttt cttcggttac caagccaacc cgtacctggg cttcgaaatg ggctacgact180ggctgggccg catgggctac accggtgacg tgaatgccaa attcaagtca cagggcgtac240agctggctgc caaactgagc tacccgctga tggacgatct ggacgtatac acccgcctgg300gcggcatggt atggcgttct gatatccacg gcgcagcaga cggcggcgac tatacttcaa360gccacgacac cggcgtatct ccgctggccg ctatcggcgt tgagtacgca ctgaacaaag420actgggctac ccgtctggac tatcagtatg tcaacaaggt tggcacccgc agcgaaaccg480gcgcacgtcc ggacaacacc atgctgagcc tgggcgttgt ataccgcttc ggtcaggatg540aagtcgcagc tccggcaccg atcccggctc cggctccggc tccggtcgtt gaaaccaagc600gtttcaccct gaagtctgac gttctgttca acttcaacaa atacaccctg aaagccgaag660gccgtcaggc gctggatcag ctgtacagcc agctgagcag catggacccg aaagacggtt720ctgtcgtcgt tctgggctac accgaccgca tcggttccga tcagtacaac ctgaagctgt780ctaagcaacg tgctcagacc gtggttgact acctggtatc taaaggtatc ccggcagaca840agatcgctgc ccgtggtatg ggtaaagctg atccggttaccggttcaacc tgtgataacg900tgaagccgcg tgctgccctg atcaactgcc tggcaccgga tcgtcgcgtt gttatcgaag960tgaaaggcat caaagaagaa gttactcagc cgcaggctta agaattcg

[0157] SEQ ID NO.7(CTB,312):

[0158] acacctcaaa atattactga tttgtgtgca gaataccaca acacacaaat acatacgcta60aatgataaga tattttcgta tacagaatct ctagctggaa aaagagagat ggctatcatt120acttttaaga atggtgcaac ttttcaagta gaagtaccag gtagtcaaca tatagattca180caaaaaaaag cgattgaaag gatgaaggat accctgagga ttgcatatct tactgaagct240aaagtcgaaa agttatgtgt atggaataat aaaacgcctc atgcgattgc cgcaattagt300atggcaaatt aa

[0159] SEQ ID NO.8(Translation,30):

[0160] 30. ggtggtggtg gttctggtgg tggtggttct

[0161] SEQ ID NO.9(ompA-linker-ctB,1344)

[0162] 60. aagcttgctc cgaagataa cacctggtac gtcggtggta aactgggctg gtcccacttt

[0163] atcagcaaca gctttgaaga catgggtaca accaagcccc atccgaatca gctgggcgcc120ggtgctttct tcggttacca agccaacccg tacctgggct tcgaaatggg ctacgactgg 180

[0164] ctgggccgca tgggctacac cggtgacgtg aatgccaaat tcaagtcaca gggcgtacag240ctggctgcca aactgagcta cccgctgatg gacgatctgg acgtatacac ccgcctgggc 300

[0165] ggcatggtat ggcgttctga tatccacggc gcagcagacg gcggcgacta tacttcaagc 360

[0166] cacgacaccg gcgtatctcc gctggccgct atcggcgttg agtacgcact gaacaaagac 420

[0167] tgggctaccc gtctggacta tcagtatgtc aacaaggttg gcacccgcag cgaaaccggc 480

[0168] gcacgtccgg acaacaccat gctgagcctg ggcgttgtat accgcttcgg tcaggatgaa 540

[0169] gtcgcagctc cggcaccgat cccggctccg gctccggctc cggtcgttga aaccaagcgt600ttcaccctga agtctgacgt tctgttcaac ttcaacaaat acaccctgaa agccgaaggc 660

[0170] cgtcaggcgc tggatcagct gtacagccag ctgagcagca tggacccgaa agacggttct720gtcgtcgttc tgggctacac cgaccgcatc ggttccgatc agtacaacct gaagctgtct 780

[0171] aagcaacgtg ctcagaccgt ggttgactac ctggtatcta aaggtatccc ggcagacaag 840

[0172] atcgctgccc gtggtatggg taaagctgat ccggttaccg gttcaacctg tgataacgtg 900

[0173] aagccgcgtg ctgccctgat caactgcctg gcaccggatc gtcgcgttgt tatcgaagtg 960

[0174] aaaggcatca aagaagaagt tactcagccg caggctggtg gtggtggttc tggtggtggt1020

[0175] ggttctacac ctcaaaatat tactgatttg tgtgcagaat accacaacac acaaatacat1080

[0176] acgctaaatg ataagatatt ttcgtataca gaatctctag ctggaaaaag agagatggct1140

[0177] atcattactt ttaagaatgg tgcaactttt caagtagaag taccaggtag tcaacatata1200

[0178] gattcacaaa aaaaagcgat tgaaaggatg aaggataccc tgaggattgc atatcttact1260

[0179] gaagctaaag tcgaaaagtt atgtgtatgg aataataaaa cgcctcatgc gattgccgca1320

[0180] attagtatgg caaattaaga attc 1344

[0181] SEQ ID NO.10 (upstream of amylase primer):

[0182] ccaatgaggt taagagtatt cc 22

[0183] SEQ ID NO.11 (downstream of amylase primer):

[0184] cgagaagcta tcaccgccca gc 22

[0185] SEQ ID NO.12:

[0186] cggcggccgc gctccgaaag ataacacctg 30

[0187] SEQ ID NO.13:

[0188] gggctcgaga gcctgcggct gagtaactt 29

[0189] At this point, those skilled in the art recognize that, although the embodiments of the present invention have been shown and described in detail herein, many other variations or modifications that conform to the principles of the present invention can still be directly determined or derived based on the contents disclosed in the present invention without departing from the spirit and scope of the present invention. Therefore, the scope of the present invention should be understood and recognized as covering all such other variations or modifications.

Claims

1. A recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on its surface, characterized in that: The recombinant Bacillus subtilis uses the spore capsid protein CotY as an anchor point, and uses a chemical transformation method to homologously double-cross recombine the coding genes of OmpA and CTB into the genome of Bacillus subtilis 168, thereby obtaining a recombinant Bacillus subtilis that can be stably inherited in Bacillus subtilis and display the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae on the surface of the spore.

2. A method for constructing a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on its surface, characterized in that: The construction method comprises the following steps: Step S1: The genome of Bacillus subtilis 168 was used as a template, cotY-F and cotY-R were used as primers, and Bam HI and Hind Ⅲ restriction sites were introduced at the 5' end of the upstream and downstream primers, respectively. The corresponding sites are underlined. The coding gene cotY containing the promoter encoding the spore capsid protein CotY was amplified by PCR. The sequence of the obtained PCR product is shown in the sequence table SEQ ID NO.

3. The PCR product was connected to pMD TM 19 Simple vector and transformed into competent cells for cloning to obtain the recombinant plasmid pMD-cotY; The primers are as follows: cotY-F: [5'-CG GGATCC TGACTGTGACCATCCGTTAG-3'], which is SEQ ID NO.1 cotY-R: [5'-CG AAGCTT TCCATTGTGATGATGCTTTTTA-3'], which is SEQ ID NO.2; Step S2: Using gene synthesis and TA cloning, the gene fragment encoding Vibrio cholerae enterotoxin B subunit was connected to the 3' end of the ompA gene through a linker to form a tandem ompA-linker-ctB gene fragment, and a Hind Ⅲ restriction site was introduced at the 5' end of the sequence, and a stop codon "TAA" and an EcoR Ⅰ restriction site were introduced at the 3' end, and then connected to pMD TM 19 Simple vector, and transformed into competent cells for cloning to obtain the recombinant plasmid pMD-ompA-linker-ctB; The Gene ID of the gene fragment encoding Vibrio cholerae enterotoxin B subunit is U25679.1, and the sequence is shown in SEQ ID NO.7; Step S3: The integration plasmid pDG364 and the recombinant plasmid pMD-cotY were double-digested with Bam HI and Hind Ⅲ, respectively, and the cotY fragment obtained by the digestion was connected with pDG364, and then transformed into competent cells for cloning to obtain the recombinant integration plasmid pDG364-cotY; Step S4: The recombinant integrative plasmid pDG364-cotY and the recombinant plasmid pMD-ompA-linker-ctB were double-digested with HindⅢ and EcoRⅠ, respectively, the ompA-linker-ctB fragment obtained by enzyme digestion was connected with pDG364-cotY, and transformed into competent cells for cloning to obtain the recombinant integrative plasmid pDG364-cotY-ompA-linker-ctB; Step S5: The recombinant integrative plasmid pDG364-cotY-ompA-linker-ctB was linearized by single enzyme digestion using restriction endonuclease Xba I, and the linearized plasmid was transferred into competent cells of wild-type Bacillus subtilis 168 by chemical transformation. The amylase encoding gene amyE was used as a homologous double crossover recombination site, and the cotY-ompA-linker-ctB fragment was inserted into the genome of Bacillus subtilis 168 to obtain the recombinant Bacillus subtilis that displays the outer membrane protein OmpA of Edwardsiella tarda and the Vibrio cholerae enterotoxin CTB fusion protein on the surface.

3. A method for constructing a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface as claimed in claim 2, characterized in that: The ompA gene in step S2 is a gene encoding the outer membrane protein OmpA of Edwardsiella tarda.

4. The method for constructing a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface as claimed in claim 2, characterized in that: The linker sequence in step S2 is shown as SEQ ID NO.8; the tandem ompA-linker-ctB gene fragment is shown as SEQ ID NO.

9.

5. The method for constructing a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface as claimed in claim 2, characterized in that: The competent cells in step S1 are Escherichia coli DH5α; the competent cells in step S2 are Escherichia coli DH5α.

6. A method for constructing a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface as claimed in claim 2, characterized in that: The competent cells in step S3 are Escherichia coli DH5α.

7. A method for constructing a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface as claimed in claim 2, characterized in that: In step S4, the obtained recombinant integration plasmid is transferred into Escherichia coli DH5α competent cells for cloning and amplification.

8. Use of the recombinant Bacillus subtilis displaying the fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface of any one of claims 1 to 7 in the preparation of biological products against Edwardsiella tarda infection.

9. Use of a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface of any one of claims 1 to 7 in the preparation of a vaccine against Edwardsiella tarda infection.

10. Use of the recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface of any one of claims 1 to 7 in the preparation of an oral vaccine-type microecological immune preparation against Edwardsiella tarda infection.

Images