Recombinant bacillus subtilis displaying on surface fusion protein of edwardsiella tarda outer membrane protein ompa and vibrio cholerae enterotoxin ctb, construction method and application

By constructing a fusion protein in Bacillus subtilis that displays the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae, the problems of time-consuming immunization routes and gastrointestinal degradation in existing vaccines were solved, achieving a highly efficient oral immunization effect and improving the immune response and survival rate against Edwardsiella tarda.

CN119614471BActive Publication Date: 2026-02-13FUJIAN LUODONG BIOTECHNOLOGY CO LTD +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411805442.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-10
Publication Date
2026-02-13
Estimated Expiration
2044-12-10

AI Technical Summary

Technical Problem

Existing Edwardsiella tarda vaccines have time-consuming and costly immunization routes that cause stress to fish. Oral immunoantigens are easily degraded in the digestive tract, which limits their widespread application.

Method used

By constructing a fusion protein in Bacillus subtilis that displays the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae, and using the spore capsid protein CotY as an anchor for homologous double cross recombination, recombinant Bacillus subtilis Et2 was obtained for oral immunization in fish and mammals.

Benefits of technology

It significantly improved the immune response of fish and mammals to Edwardsiella tarda, simplified the immunization procedure, reduced stress and labor costs, ensured an effective antigen concentration in the gut, and improved survival rate and survival time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614471B_ABST
    Figure CN119614471B_ABST
Patent Text Reader

Abstract

The application discloses a recombinant bacillus subtilis of surface display of a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB, a construction method and application. A homologous double cross recombinant of coding genes of OmpA and CTB is carried out into a genome of the bacillus subtilis 168 by taking the spore coat protein CotY as an anchor point, so that the recombinant bacillus subtilis capable of stably inheriting in the bacillus subtilis and displaying the Edwardsiella tarda outer membrane protein OmpA and the Vibrio cholerae enterotoxin CTB on a spore surface is obtained. After fish and mammals orally immunize the bacillus subtilis, the survival time and survival rate of the fish and mammals after infection of the Edwardsiella tarda are obviously improved. The recombinant bacillus subtilis is used as an oral vaccine type micro-ecological immunization preparation for preventing and treating the Edwardsiella tarda infection of the fish and mammals, so that the immunization procedure is obviously simplified, the immunization stress is reduced, the labor cost is saved, the effective concentration in the intestinal tract is ensured, and the specific immune response of the body is induced.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological vaccine technology, in particular to a recombinant Bacillus subtilis displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae toxin B subunit (CTB), a construction method and application thereof. BACKGROUND

[0002] Edwardsiella tarda is a gram-negative intracellular pathogen, which belongs to Enterobacteriaceae and can infect fish, amphibians, reptiles and mammals, causing Edwardsiella disease and leading to significant economic losses in commercial freshwater and marine fisheries worldwide.

[0003] As a gram-negative bacterium, the cell membrane of Edwardsiella tarda is composed of three layers of inner membrane, periplasm and outer membrane, of which the outer membrane is mainly composed of phospholipids, lipopolysaccharides and outer membrane proteins (OMPs). Outer membrane proteins play a key role in bacterial adaptive response and are highly conserved throughout evolution. Due to their highly immunogenic epitopes exposed on the cell surface, they are one of the best candidates for antigens today. Vibrio cholerae toxin B subunit (CTB) is the non-toxic part of Vibrio cholerae toxin, which has strong immunogenicity and adjuvant activity. By gene fusion or chemical manipulation, it can be combined with antigens to increase the immune response of mucosal surface antigens. At the same time, Vibrio cholerae toxin CTB can effectively improve the permeability of digestive tract mucosal cells after entering the digestive tract, maintain the integrity of vaccine antigens, reduce degradation loss and improve immune effect.

[0004] As a safe and effective alternative to antibiotics, vaccines are increasingly used in the control of bacterial diseases in modern aquaculture. Currently, Edwardsiella tarda vaccines mainly include inactivated whole cell vaccine, attenuated live vaccine, bacterial ghost vaccine, DNA vaccine and recombinant subunit vaccine, among which only a few inactivated whole cell vaccines and attenuated live vaccines have been approved for use in fish, and their application methods are mostly immersion immunization or injection immunization. These methods are time-consuming, high in cost and labor-intensive, and the stress caused by crowding, handling and injection on fish is also large. Therefore, the limitation of immunization route is also a major obstacle to the widespread use of these vaccines. Oral immunization has the advantages of convenient operation and no stress, but due to the acidic environment and rich digestive enzymes in the digestive tract, the antigen is partially degraded before reaching the uptake, presentation and transport site. Therefore, developing a new antigen presentation system to ensure that the antigen is not degraded in the digestive tract is an urgent need for the development of fish oral vaccines. SUMMARY

[0005] The present application aims to overcome the shortcomings of the prior art, and provides a recombinant Bacillus subtilis displaying surface slow Edwardsiella outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB, a construction method and application. The coding genes of OmpA and CTB are homologously double-crossed and recombined into the genome of Bacillus subtilis 168 by taking spore coat protein CotY as an anchor point, so that the recombinant Bacillus subtilis capable of stably inheriting in the Bacillus subtilis and displaying slow Edwardsiella outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface of spores is obtained. After fish and mammals are orally immunized with the recombinant Bacillus subtilis, the survival time and survival rate of the organisms after being infected with slow Edwardsiella are significantly improved. The recombinant Bacillus subtilis as an oral vaccine type microecological immunization preparation for preventing and treating slow Edwardsiella infection of fish and mammals can significantly simplify the immunization procedure, reduce immunization stress, save labor cost, ensure the effective concentration in the intestinal tract, and induce the organism to produce specific immune response.

[0006] To achieve the above technical effects, the following technical solutions are adopted:

[0007] The recombinant Bacillus subtilis displaying surface slow Edwardsiella outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB takes spore coat protein CotY as an anchor point, and the coding genes of OmpA and CTB are homologously double-crossed and recombined into the genome of Bacillus subtilis 168 by using a chemical transformation method, so that the recombinant Bacillus subtilis capable of stably inheriting in the Bacillus subtilis and displaying slow Edwardsiella outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the surface of spores is obtained.

[0008] The construction method of the recombinant Bacillus subtilis displaying surface slow Edwardsiella outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB comprises the following steps:

[0009] Step S1:

[0010] The genome of Bacillus subtilis 168 is taken as a template, cotY-F and cotY-R are taken as primers, and Bam HI and Hind III enzyme digestion sites are respectively introduced at the 5' ends of the upstream and downstream primers. The corresponding sites are indicated by underlines. The coding gene cotY of the spore coat protein CotY containing a promoter is subjected to PCR amplification, and the sequence of the obtained PCR product is shown in SEQ ID NO. 3 in the sequence table. The PCR product is connected to pMD TM 19Simple vector and transformed into a competent cell to obtain a recombinant plasmid pMD-cotY;

[0011] The primers are as follows:

[0012] cotY-F: [5'-CG GGATCCTGACTGTGACCATCCGTTAG-3') is SEQ ID NO. 1

[0013] cotY-R: [5'-CG AAGCTT TCCATTGTGATGATGCTTTTTA-3') is SEQ ID NO. 2;

[0014] Step S2:

[0015] The gene fragment encoding Vibrio cholerae enterotoxin B subunit is connected to the 3' end of the ompA gene by a linker to form a tandem ompA-linker-ctB gene fragment by means of gene synthesis and T-A cloning, and a Hind III restriction site is introduced at the 5' end of the sequence, a termination codon "TAA" and an EcoR I restriction site are introduced at the 3' end, and the fragment is connected to the pMD TM 19Simple vector, and transformed into competent cells to clone, to obtain the recombinant plasmid pMD-ompA-linker-ctB;

[0016] The gene fragment encoding Vibrio cholerae enterotoxin B subunit has a Gene ID of U25679.1, and the sequence is shown as SEQ ID NO. 7;

[0017] Step S3:

[0018] The cotY fragment obtained by double enzyme digestion of the integrated plasmid pDG364 and the recombinant plasmid pMD-cotY using Bam HI and Hind III is connected to pDG364, and transformed into competent cells to clone, to obtain the recombinant integrated plasmid pDG364-cotY;

[0019] Step S4:

[0020] The ompA-linker-ctB fragment obtained by double enzyme digestion of the recombinant integrated plasmid pDG364-cotY and the recombinant plasmid pMD-ompA-linker-ctB using Hind III and EcoR I is connected to pDG364-cotY, and transformed into competent cells to clone, to obtain the recombinant integrated plasmid pDG364-cotY-ompA-linker-ctB;

[0021] Step S5:

[0022] The recombinant integrated plasmid pDG364-cotY-ompA-linker-ctB is linearized by using the restriction endonuclease Xba I, the linear plasmid is transformed into the competent cells of the wild-type Bacillus subtilis 168 by the chemical transformation method, the cotY-ompA-linker-ctB fragment is inserted into the genome of the Bacillus subtilis 168 by taking the coding gene amyE of amylase as the homologous double cross recombination site, and the recombinant Bacillus subtilis for displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and the cholera enterotoxin CTB of Vibrio cholerae is obtained.

[0023] Further, the ompA gene in the step S2 is the coding gene for coding the outer membrane protein OmpA of Edwardsiella tarda.

[0024] Further, the connector sequence in the step S2 is shown as SEQ ID NO. 8; and the tandem ompA-linker-ctB gene fragment is shown as SEQ ID NO. 9.

[0025] Further, the competent cell in the step S1 is Escherichia coli DH5α; and the competent cell in the step S2 is Escherichia coli DH5α.

[0026] Further, the competent cell in the step S3 is Escherichia coli DH5α.

[0027] Further, the recombinant integrated plasmid obtained in the step S4 is transformed into the competent cells of Escherichia coli DH5α for cloning amplification.

[0028] The recombinant Bacillus subtilis for displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and the cholera enterotoxin CTB of Vibrio cholerae is applied to the preparation of a biological product for resisting Edwardsiella tarda infection.

[0029] The recombinant Bacillus subtilis for displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and the cholera enterotoxin CTB of Vibrio cholerae is applied to the preparation of a vaccine for resisting Edwardsiella tarda infection.

[0030] The recombinant Bacillus subtilis for displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and the cholera enterotoxin CTB of Vibrio cholerae is applied to the preparation of an oral vaccine type micro-ecological immunization preparation for resisting Edwardsiella tarda infection.

[0031] The present application has the following beneficial effects:

[0032] 1. The application uses genetic engineering means to connect the coding gene ompA of the outer membrane protein OmpA of Edwardsiella tarda and the coding gene ctB of the enterotoxin B subunit of Vibrio cholerae through a linker to the integrative plasmid pDG364, then uses the spore coat protein CotY as an anchor point, uses the amylase gene amyE on pDG364 as a homologous arm, and uses the method of homologous double cross recombination to embed the Edwardsiella tarda outer membrane protein ompA gene and the Vibrio cholerae enterotoxin ctB gene into the genome of the wild-type Bacillus subtilis 168, thereby obtaining the recombinant Bacillus subtilis Et2 which can stably inherit in Bacillus subtilis and display the Edwardsiella tarda outer membrane protein OmpA and the Vibrio cholerae enterotoxin CTB on the surface of the spore.

[0033] 2. The application test in mammals represented by mice shows that, compared with the recombinant Bacillus subtilis Et1 displaying only the Edwardsiella tarda outer membrane protein OmpA and the wild-type Bacillus subtilis 168, after oral immunization of the recombinant Bacillus subtilis Et2 by mixing, the IgG level of the mouse serum against the Edwardsiella tarda outer membrane protein OmpA is significantly improved, the sIgA content of the mouse small intestine contents against the Edwardsiella tarda outer membrane protein OmpA is significantly improved, the specific immune response of the mouse is induced, and the survival rate of the mouse after infection with Edwardsiella tarda is significantly improved.

[0034] 3. The application test in fish represented by zebrafish shows that, compared with the recombinant Bacillus subtilis Et1 displaying only the Edwardsiella tarda outer membrane protein OmpA and the wild-type Bacillus subtilis 168, after oral immunization of the recombinant Bacillus subtilis Et2 by mixing, the IgM level of the zebrafish serum against the Edwardsiella tarda outer membrane protein OmpA is significantly improved, the specific immune response of the zebrafish is induced, and the survival time and survival rate of the zebrafish after infection with Edwardsiella tarda are significantly improved. This provides a new solution for the prevention and treatment of fish Edwardsiella disease in the breeding process of tilapia, paralichthys olivaceus, scophthalmus maximus, cyprinus carpio, anguilla, silurus xiangjiangensis, pseudopercis strigata and salmon.

[0035] 4. The recombinant Bacillus subtilis Et2 of this invention, by stably displaying the fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the spore surface, can be directly added to fish feed. Compared with traditional injectable or immersion-based vaccines for fish, the oral vaccine-type probiotic recombinant Bacillus subtilis Et2 can significantly simplify the immunization procedure, reduce immune stress, and save labor costs. Furthermore, compared with common genetically engineered bacteria such as Lactobacillus, Lactococcus, or Enterococcus used as expression vectors, the spores of recombinant Bacillus subtilis Et2 can maintain immunogenicity even under extreme conditions, avoiding antigen inactivation or degradation caused by production, transportation, or the digestive tract environment, ensuring its effective concentration in the body, inducing specific mucosal immunity in the intestine, reducing losses during production and application, and ensuring economic benefits at each stage. Attached Figure Description

[0036] Figure 1 This is a schematic diagram of the integrative plasmid pDG364 according to an embodiment of the present invention;

[0037] Figure 2 This is a schematic diagram of the recombinant integrative plasmid pDG364-cotY-ompA according to an embodiment of the present invention;

[0038] Figure 3 This is a schematic diagram of the recombinant integrative plasmid pDG364-cotY-ompA-linker-ctB according to an embodiment of the present invention.

[0039] Figure 4 This is a schematic diagram of homologous double cross recombination in an embodiment of the present invention;

[0040] Figure 5 This is a schematic diagram illustrating the verification results of amylase activity of recombinant Bacillus subtilis in an embodiment of the present invention;

[0041] Figure 6 This is a schematic diagram of the PCR verification results of the integration site of recombinant Bacillus subtilis Et1 in an embodiment of the present invention;

[0042] Figure 7 This is a schematic diagram of the PCR verification results of the Et2 integration site in recombinant Bacillus subtilis according to an embodiment of the present invention;

[0043] Figure 8 This is a schematic diagram of the Western Blot results of prokaryotic expression of the outer membrane protein OmpA of Edwardsiella tarda in an embodiment of the present invention;

[0044] Figure 9 This is a schematic diagram of the immunofluorescence verification results of recombinant Bacillus subtilis in an embodiment of the present invention;

[0045] Figure 10IgG level of anti-E. tarda outer membrane protein OmpA in serum of mice in the embodiment of the present application;

[0046] Figure 11 sIgA level of anti-E. tarda outer membrane protein OmpA in small intestine content of mice in the embodiment of the present application;

[0047] Figure 12 Survival curve of mice after infection of E. tarda in the embodiment of the present application;

[0048] Figure 13 IgM level of anti-E. tarda outer membrane protein OmpA in serum of zebra fish in the embodiment of the present application;

[0049] Figure 14 Survival curve of zebra fish after infection of E. tarda in the embodiment of the present application. DETAILED DESCRIPTION

[0050] The present application will be further described below in conjunction with the accompanying drawings, and the protection scope of the present application is not limited to the following description:

[0051] Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0052] Microorganism and plasmid involved in the present application:

[0053] Escherichia coli BL21, Escherichia coli DH5α, plasmid pET-32a(+) and plasmid pMD TM19 Simple was purchased from TaKaRa Biotechnology (Beijing) Co., Ltd.; Bacillus subtilis 168 and plasmid pDG364 were purchased from the Bacillus Genetic Stock Center (http: / / www.bgsc.org); Edwardsiella tarda XYHZYQ was purchased from the Animal Microecology Research Center of Sichuan Agricultural University. These are strains in the existing technology and are described in "Cao,Y.,Wang,Z.,Dai,X.,Zhang,D.,Zeng,Y.,Ni,X.,&Pan,K.(2024).Evaluation ofprobiotic properties of a Brevibacillus laterosporus strain.FASEBJournal,38(5),e23530.doi:10.1096 / fj.202302408R".

[0054] Example 1:

[0055] The present invention discloses a method for preparing recombinant Bacillus subtilis Et1, an oral vaccine-type probiotic immunomodulator that displays the outer membrane protein OmpA of Edwardsiella tarda on its surface and has the function of preventing and treating Edwardsiella tarda infection in fish and mammals, comprising the following steps:

[0056] (1) Using the genome of Bacillus subtilis 168 as a template:

[0057] cotY-F[5'-CG GGATCC TGACTGTGACCATCCGTTAG-3'] (SEQ ID NO.1) and cotY-R[5'-CG AAGCTT Using primers TCCATTGTGATGATGCTTTTTA-3' (SEQ ID NO.2), Bam HI and HindIII restriction sites (underlined) were introduced at the 5' ends of the upstream and downstream primers, respectively, to amplify the cotY gene (containing the promoter) encoding the spore capsid protein CotY. The sequence of the obtained PCR product is shown in SEQ ID NO.3 of the sequence listing. The PCR product was ligated into pMD... TM The 19Simple vector was transformed into Escherichia coli DH5α competent cells, and the cells were screened and cloned in LB plates or broth containing 50 μg / mL of ampicillin sodium to obtain the recombinant plasmid pMD-cotY.

[0058] (2) Using the genome of Edwardsiella tarda XYHZYQ as a template:

[0059] ompA-F[5'-CC AAGCTT GCTCCGAAAGATAACACCTG-3'] (SEQ ID NO.4) and ompA-R[5'-C GAATTC Using primers [TTAAGCCTGCGGCTGAGTAACTT] (SEQ ID NO.5), HindIII and EcoRI restriction sites (underlined) and the stop codon "TTA" were introduced at the 5' ends of the upstream and downstream primers, respectively, to amplify the gene encoding the outer membrane protein OmpA. The obtained PCR product sequence is shown in the sequence listing SEQ ID NO.6. The PCR product was ligated into pMD... TM The 19Simple vector was transformed into Escherichia coli DH5α competent cells, and the cells were screened and cloned in LB plates or broth containing 50 μg / mL of ampicillin sodium to obtain the recombinant plasmid pMD-ompA.

[0060] (3) Figure 1 As shown (Bam HI, HindIII, EcoRI, and XbaI represent different restriction sites; cat represents the chloramphenicol resistance gene; amyE represents the amylase-encoding gene), the integrative plasmid pDG364 and the recombinant plasmid pMD-cotY were double-digested with Bam HI and HindIII, respectively. The cotY fragment obtained by restriction digestion was ligated to pDG364 and transformed into Escherichia coli DH5α competent cells. The cells were screened and cloned in LB agar plates or broth containing 50 μg / mL of ampicillin sodium to obtain the recombinant integrative plasmid pDG364-cotY.

[0061] (4) Figure 2 As shown (Bam HI, HindIII, EcoRI, and XbaI represent different restriction enzyme sites; cat represents the chloramphenicol resistance gene; amyE represents the amylase-encoding gene), the recombinant integrative plasmid pDG364-cotY and the recombinant plasmid pMD-ompA were double-digested with HindIII and EcoRI, respectively. The ompA fragment obtained by enzyme digestion was ligated into pDG364-cotY and transformed into Escherichia coli DH5α competent cells. The cells were screened and cloned in LB agar plates or broth containing 50 μg / mL of ampicillin sodium to obtain the recombinant integrative plasmid pDG364-cotY-ompA.

[0062] (5) Figure 4As shown, the recombinant integrative plasmid pDG364-cotY-ompA was linearized by single restriction endonuclease Xba I. The linear plasmid was then transformed into competent wild-type Bacillus subtilis 168 cells by chemical transformation. Using the amylase-encoding gene amyE as the homologous double crossover recombination site, the cotY-ompA fragment was inserted into the genome of Bacillus subtilis 168. The cells were screened and cloned in LB plates or broth containing 5 μg / mL chloramphenicol to obtain recombinant Bacillus subtilis Et1.

[0063] Example 2

[0064] The present invention discloses a method for preparing recombinant Bacillus subtilis Et2, an oral vaccine-type probiotic immunomodulator that displays the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae on its surface, and has the function of preventing and treating Edwardsiella tarda infection in fish and mammals. The method includes the following steps:

[0065] (1) Using the genome of Bacillus subtilis 168 as a template:

[0066] cotY-F[5'-CG GGATCC TGACTGTGACCATCCGTTAG-3'] (SEQ ID NO.1) and cotY-R[5'-CG AAGCTT Using primers TCCATTGTGATGATGCTTTTTA-3'](SEQ ID NO.2), Bam HI and HindIII restriction sites (underlined) were introduced at the 5' ends of the upstream and downstream primers, respectively, to amplify the cotY gene (containing the promoter) encoding the spore capsid protein CotY. The sequence of the obtained PCR product is shown in SEQ ID NO.3 of the sequence listing. The PCR product was ligated into pMD TM The 19Simple vector was transformed into Escherichia coli DH5α competent cells, and the cells were screened and cloned in LB plates or broth containing 50 μg / mL of ampicillin sodium to obtain the recombinant plasmid pMD-cotY.

[0067] (2) Using gene synthesis and TA cloning, the gene fragment encoding the B subunit of Vibrio cholerae enterotoxin (Gene ID: U25679.1, i.e., SEQ ID NO.7) was linked to the 3' end of the ompA gene encoding the outer membrane protein OmpA of Edwardsiella tarda via a linker (SEQ ID NO.8), forming a tandem ompA-linker-ctB gene fragment (SEQ ID NO.9). A HindIII restriction site was introduced at the 5' end of the sequence, and a stop codon "TAA" and an EcoRI restriction site were introduced at the 3' end. This fragment was then linked to pMD TMThe 19Simple vector was transformed into Escherichia coli DH5α competent cells, and the cells were screened and cloned in LB plates or broth containing 50 μg / mL of ampicillin sodium to obtain the recombinant plasmid pMD-ompA-linker-ctB.

[0068] (4) Figure 1 As shown (Bam HI, HindIII, EcoRI, and XbaI represent different restriction sites; cat represents the chloramphenicol resistance gene; amyE represents the amylase-encoding gene), the integrative plasmid pDG364 and the recombinant plasmid pMD-cotY were double-digested with Bam HI and HindIII, respectively. The cotY fragment obtained by restriction digestion was ligated to pDG364 and transformed into Escherichia coli DH5α competent cells. The cells were screened and cloned in LB agar plates or broth containing 50 μg / mL of ampicillin sodium to obtain the recombinant integrative plasmid pDG364-cotY.

[0069] (5) Figure 3 As shown (Bam HI, HindIII, EcoRI, and XbaI represent different restriction sites; cat represents the chloramphenicol resistance gene; amyE represents the amylase-encoding gene), the recombinant integrative plasmid pDG364-cotY and the recombinant plasmid pMD-ompA-linker-ctB were double-digested with HindIII and EcoRI, respectively. The ompA-linker-ctB fragment obtained by restriction digestion was ligated to pDG364-cotY and transformed into Escherichia coli DH5α competent cells. The cells were screened and cloned in LB agar plates or broth containing 50 μg / mL of ampicillin sodium to obtain the recombinant integrative plasmid pDG364-cotY-ompA-linker-ctB.

[0070] (6) Figure 4 As shown, the recombinant integrative plasmid pDG364-cotY-ompA-linker-ctB was linearized by single restriction endonuclease Xba I. The linear plasmid was then transformed into competent wild-type Bacillus subtilis 168 cells by chemical transformation. Using the amylase-encoding gene amyE as the homologous double crossover recombination site, the cotY-ompA-linker-ctB fragment was inserted into the genome of Bacillus subtilis 168. The cells were screened and cloned in LB plates or broth containing 5 μg / mL chloramphenicol to obtain recombinant Bacillus subtilis Et2.

[0071] Example 3

[0072] The amylase verification method of the two oral vaccine type microecological immunization preparations of recombinant Bacillus subtilis with the function of preventing and treating Edwardsiella tarda infection of fish and mammals, one recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda and one recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae, is as follows:

[0073] After the foreign gene fragment is inserted into the genome of the wild-type Bacillus subtilis 168, the recombinant Bacillus subtilis Et1 carrying the ompA or the recombinant Bacillus subtilis Et2 carrying the ompA-linker-ctB fragment is obtained, so that the amylase gene is deleted and the starch cannot be decomposed and utilized. The amylase activity analysis results of the recombinant Bacillus subtilis Et1 and the recombinant Bacillus subtilis Et2 are shown in Table 1. Figure 5 Figure 5 It can be known that the starch around the colonies of the wild-type Bacillus subtilis 168 is fully utilized after 24 h of culture, and a transparent starch hydrolysis circle is formed; the starch around the colonies of the recombinant Bacillus subtilis Et1 and the recombinant Bacillus subtilis Et2 is not utilized after 24 h of growth culture, and no starch hydrolysis circle is formed, which proves that the amylase expression genes of the two recombinant Bacillus subtilis are deleted, the purpose gene fragment is successfully homologously recombined into the genome of the wild-type Bacillus subtilis 168, and the genetically engineered new strain is obtained.

[0074] Example 4

[0075] The integration site verification of the two oral vaccine type microecological immunization preparations of recombinant Bacillus subtilis with the function of preventing and treating Edwardsiella tarda infection of fish and mammals, one recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda and one recombinant Bacillus subtilis Et2 displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae, of the present application comprises the following steps:

[0076] (1) The integration site of the ompA gene on the genome of the recombinant Bacillus subtilis Et1 is verified. The genomes of Bacillus subtilis 168 and the recombinant Bacillus subtilis Et1 are used as templates, and the PCR amplification is carried out by using ompA-F / ompA-R, amyE-F (SEQ ID NO. 10) / amyE-R (SEQ ID NO. 11), amyE-F / ompA-R and ompA-F / amyE-R as primers, and the PCR product size is detected by agarose gel electrophoresis. The detection results are shown in Table 2. Figure 6 (Track M is 250bp-15000bp DNA maker). According to Figure 6 ​As can be seen, except for the pair of primers amyE-F / amyE-R, the other three pairs of primers failed to successfully amplify products from the genome of Bacillus subtilis 168. When the pair of primers amyE-F / amyE-R was used, the size of the obtained PCR product was 556 bp, which was consistent with the expected size of the amyE gene and consistent with the theoretical sequence of amyE of wild-type Bacillus subtilis 168 (Gene ID: NZ_OZ024942.1, 328072-328627). When the genome of the recombinant Bacillus subtilis Et1 was used as the template, the sizes of the PCR products obtained from the four pairs of primers were 1008 bp, 3881 bp, 2326 bp and 2563 bp, respectively, which were consistent with the expectations, further confirming that the coding gene ompA of the expressed outer membrane protein OmpA of Edwardsiella tarda was successfully integrated into the amyE gene of wild-type Bacillus subtilis 168, and the recombinant Bacillus subtilis Et1 with the amyE gene of amylase expression deleted and the ompA gene of Edwardsiella tarda integrated into the genome was obtained.

[0077] (2) Verification of the integration site of the ompA-linker-ctB fragment on the genome of the recombinant Bacillus subtilis Et2. The genomes of Bacillus subtilis 168 and the recombinant Bacillus subtilis Et2 were used as the templates, and PCR amplification was performed with the primers ompA-F / ompA-R, amyE-F / amyE-R, amyE-F / ompA-R and ompA-F / amyE-R. The sizes of the PCR products were detected by agarose gel electrophoresis, and the detection results are shown in FIG. 3. Figure 7 (FIG. 3, lane M is a 250 bp-15000 bp DNA marker). According to Figure 7 As can be seen, except for the pair of primers amyE-F / amyE-R, the other three pairs of primers failed to successfully amplify products from the genome of Bacillus subtilis 168. When the pair of primers amyE-F / amyE-R was used, the size of the obtained PCR product was 556 bp, which was consistent with the expected size of the amyE gene and consistent with the theoretical sequence of amyE of wild-type Bacillus subtilis 168 (Gene ID: NZ_OZ024942.1, 328072-328627). When the genome of the recombinant Bacillus subtilis Et1 was used as the template, the sizes of the PCR products obtained from the four pairs of primers were 1008 bp, 3881 bp, 2326 bp and 2563 bp, respectively, which were consistent with the expectations, further confirming that the coding gene ompA of the expressed outer membrane protein OmpA of Edwardsiella tarda was successfully integrated into the amyE gene of wild-type Bacillus subtilis 168, and the recombinant Bacillus subtilis Et1 with the amyE gene of amylase expression deleted and the ompA gene of Edwardsiella tarda integrated into the genome was obtained.

[0078] Example 5

[0079] The present invention relates to two oral vaccine-type probiotic immunomodulators, recombinant Bacillus subtilis, for the prevention and treatment of Edwardsiella tarda infection in fish and mammals. Specifically, it includes the following steps for verifying the biological activity of the OmpA protein in recombinant Bacillus subtilis Et1 (surface displaying the Edwardsiella tarda outer membrane protein OmpA) and recombinant Bacillus subtilis Et2 (surface displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB):

[0080] (1) Prokaryotic expression of OmpA protein. Using the genome of Edwardsiella tarda XYHZYQ as a template, PompA-F[5'-CG GCGGCCGC GCTCCGAAAGATAACACCTG-3'](SEQ ID NO.12) and PompA-R[5'-GGG CTCGAG Using primers [AGCCTGCGGCTGAGTAACTT-3'](SEQ ID NO.13), NotⅠ and XhoⅠ restriction enzyme sites (corresponding sites are underlined) were introduced at the 5' ends of the upstream and downstream primers to amplify the OmpA protein encoding gene ompA. The PCR product of the ompA gene and the expression plasmid pET-32a(+) were double-digested with restriction endonucleases NotⅠ and XhoⅠ, respectively. The obtained ompA gene was ligated into pET-32a(+) and transformed into competent cells expressing host Escherichia coli DH5α. The cells were screened and cloned in LB agar plates or broth containing 50 μg / mL ampicillin sodium to obtain the recombinant expression plasmid pET-32a(+)-ompA.

[0081] (2) Expression and purification of OmpA protein. The recombinant expression plasmid pET-32a(+)-ompA was transformed into Escherichia coli BL21 competent cells, and the cells were plated on LB agar plates containing 50 μg / mL ampicillin sodium to obtain single colonies. The colonies were then inoculated into LB broth containing 50 μg / mL ampicillin sodium and induced overnight at 16°C with 0.25 mmol / L IPTG. The cells were collected, sonicated, and purified using a His-tagged column affinity chromatography kit (purchased from Cytiva, USA) to obtain purified OmpA protein.

[0082] (3) The purified OmpA protein was analyzed by Western blotting. The results are as follows: Figure 8As shown (lane M is 15 kDa-250 kDa protein Maker; lane 1 is the expression product of E. coli BL21 / pET-32a(+)-ompA; lane 2 is the expression product of E. coli BL21 / pET-32a(+)), it can be seen that the recombinant expression plasmid pET-32a(+)-ompA successfully expresses a specific band of about 57 kDa in size in E. coli BL21, which is consistent with the theoretical value.

[0083] (4) Preparation of mouse anti-OmpA serum. The purified OmpA protein was mixed with an equal volume of Freund's complete adjuvant (purchased from Sigma-Aldrich Company, USA) using the double-push method to prepare a Freund's complete adjuvant containing 0.5 g / mL of OmpA protein, and the mice were immunized by subcutaneous injection of the adjuvant (0.2 mL per mouse) at the first immunization in the first week; the purified OmpA protein was mixed with an equal volume of Freund's incomplete adjuvant (purchased from Sigma-Aldrich Company, USA) using the double-push method to prepare a Freund's incomplete adjuvant containing 0.5 g / mL of OmpA protein, and the mice were immunized by subcutaneous injection of the adjuvant (0.2 mL per mouse) at the second and third immunizations in the second and third weeks; the mouse anti-OmpA serum was obtained by eye blood collection one week after the third immunization.

[0084] (5) Immunofluorescence verification of the display of E. edwardsi OmpA on the surface of recombinant B. subtilis Et1 and recombinant B. subtilis Et2. B. subtilis 168, recombinant B. subtilis Et1 and recombinant B. subtilis Et2 were inoculated into sporulation medium and cultured at 150 r / min and 37°C for 48 h; the spores were collected and fixed on the surface of a glass slide, and then blocked in 3% BSA-PBS blocking solution (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.) at room temperature for 30 min, and washed with PBS (pH 7.4) for 5 times; the blocked sample was incubated with mouse anti-OmpA serum diluted with the blocking solution at room temperature for 1 h, and washed with PBS for 5 times; the sample was incubated with Cy3-labeled goat anti-mouse IgG antibody (diluted 1:200 with the blocking solution) at room temperature for 45 min in the dark, and washed with PBS for 5 times, and then observed and imaged under an immunofluorescence microscope after being covered with a cover glass. The verification results are shown in FIG. 5. Figure 9 (Proportion scale length is 100 μm), under the excitation of 532 nm laser (green light), only the recombinant B. subtilis Et1 and recombinant B. subtilis Et2 carried Cy3-labeled goat anti-mouse IgG secondary antibody, emitting orange-red fluorescence, indicating that E. edwardsi OmpA was successfully displayed on the surface of the recombinant B. subtilis Et1 and recombinant B. subtilis Et2 in a biologically active form, and could be recognized and combined with specific antibodies.

[0085] Example 6

[0086] The oral immunization effects of the recombinant Bacillus subtilis Et1 displaying the outer membrane protein OmpA of Edwardsiella tarda and the recombinant Bacillus subtilis Et2 displaying the outer membrane protein OmpA of Edwardsiella tarda and the CTB fusion protein of Vibrio cholerae on mice and other mammals include the following steps:

[0087] (1) 60 SPF female Kunming mice aged 21 days (weight 18.0 ± 2.0 g, purchased from Chengdu Dashuo Experimental Animal Co., Ltd.) were randomly divided into 4 groups according to Table 1, wherein group A was the control group, only fed with the basic diet, group B, group C and group D were respectively fed with the same amount of basic diet containing wild-type Bacillus subtilis 168, the same amount of basic diet containing recombinant Bacillus subtilis Et1 and the same amount of basic diet containing recombinant Bacillus subtilis Et2 (the amount of spores in feed was 2.0 × 10 6 CFU / g). During the experiment, the mice in each group were free to eat and drink, and the environmental temperature was controlled at 18-23°C.

[0088] Table 1 Oral immunization grouping design of mice

[0089]

[0090] (2) The whole test cycle was 42 days, on the 14th, 28th and 42nd day of the test, 5 mice were randomly selected from each group, blood was collected by eyeball, and the blood was placed at room temperature for 2 h, then placed at 4°C overnight, centrifuged at 4°C, 2500 r / min for 10 min, the serum was collected and stored at -80°C refrigerator; after collecting the blood, the mice were sacrificed by cervical dislocation, the small intestine was aseptically dissected, the small intestine contents were collected, 0.1 g / branch EP tube was used for packaging, 0.9 mL pre-cooled PBS was added, mixed evenly, centrifuged at 4°C, 4500 r / min for 10 min, the supernatant was collected and stored at -80°C refrigerator for standby.

[0091] (3) Indirect ELISA was used to detect the IgG level of anti-E. tarda outer membrane protein OmpA in mouse serum. The purified OmpA protein was diluted to 5 μg / mL with 0.05 mol / L carbonate buffer (pH 9.6) and added to 96-well high adsorption flat-bottom polystyrene enzyme-coated plates (purchased from Wuhan Sivier Biotechnology Co., Ltd.) at 100 μL per well, and then adsorbed and fixed at 37°C until the liquid was completely evaporated. The plates were washed three times with 300 μL per well of PBS containing 0.05% Tween 20 (pH 7.4) (PBST). 250 μL of blocking solution (3% BSA-PBS) was added to each well, and the plates were incubated at 37°C for 2 h, followed by three washes with PBST. Mouse serum was diluted 1:100 with the blocking solution, and 100 μL was added to each well, followed by incubation at 37°C for 2 h, and three washes with PBST. Rabbit anti-mouse IgG labeled with horseradish peroxidase (purchased from Santa Cruz Biotechnology, USA) was diluted 1:2000 with the blocking solution, and 100 μL was added to each well, followed by incubation at 37°C for 2 h, and three washes with PBST. 100 μL of TMB substrate solution (purchased from Shenguo Bioengineering (Shanghai) Co., Ltd.) was added to each well, and the plates were incubated at room temperature for 5-10 min in the dark. The reaction was stopped by adding 100 μL of 2 mol / L H2SO4 to each well. The absorbance of each well was measured at 450 nm using an enzyme-labeled instrument (Thermo Multiskan FC). The antibody level was expressed as the P / N value: P / N = sample well OD 450 / PBS OD 450 .

[0092] (4) The IgG level of anti-E. tarda outer membrane protein OmpA in mouse serum after oral immunization of mice and other mammals with recombinant B. subtilis Et1 displaying E. tarda outer membrane protein OmpA or recombinant B. subtilis Et2 displaying E. tarda outer membrane protein OmpA and CTB fusion protein of Vibrio cholerae enterotoxin is shown in Table 2, and the graph is plotted according to Table 2 Figure 10The same cluster data column is marked with different lowercase letters to indicate significant difference (p<0.05), and the same letter indicates no significant difference (p>0.05). Therefore, compared with the control group and the Bacillus subtilis 168 group, the serum OmpA specific IgG antibody level of the C group and the D group of mice fed with recombinant Bacillus subtilis is significantly increased (p<0.05), and gradually increases with the extension of the immune time. The specific IgG level of the mouse serum fed with recombinant Bacillus subtilis Et2 is always significantly higher than that of recombinant Bacillus subtilis Et1 (p<0.05), which proves that the recombinant Bacillus subtilis Et1 and Et2 displaying the surface of Edwardsiella tarda outer membrane protein OmpA can stimulate the mouse to produce high level of OmpA specific IgG antibody. The recombinant Bacillus subtilis Et2 fused with Vibrio cholerae enterotoxin CTB can enhance the immunogenicity of the antigen, and promote the mammal to obtain higher level of OmpA specific IgG antibody.

[0093] Table 2 IgG level of anti-Edwardsiella tarda outer membrane protein OmpA in mouse serum (P / N)

[0094]

[0095] Note: The same row data is marked with different lowercase letters on the right shoulder to indicate significant difference (p<0.05), and the same letter indicates no significant difference (p>0.05)

[0096] (5) Indirect ELISA detection of sIgA levels of OmpA, an anti-Edwards Edwardsiella tarda outer membrane protein, in mouse small intestinal contents. Purified OmpA protein was diluted to 5 μg / mL with 0.05 mol / L carbonate buffer (pH 9.6) and added to 100 μL per well of a 96-well high-adsorption flat-bottom polystyrene microplate (purchased from Wuhan Saiwei Biotechnology Co., Ltd.). The plate was fixed at 37°C until the liquid completely evaporated. The plate was washed three times with PBS (pH 7.4) washing buffer containing 0.05% Tween 20, 300 μL / well each time. 250 μL of blocking buffer (3% BSA-PBS) was added to each well, and the plate was blocked at 37°C for 2 h, followed by three washes with PBST. The mouse small intestinal contents supernatant was diluted 1:100 with blocking buffer, 100 μL per well, and incubated at 37°C for 2 h, followed by three washes with PBST. Horseradish peroxidase-labeled rabbit anti-mouse IgA (purchased from Santa Cruz Biotechnology, USA) was added to the blocking buffer. Dilute the sample 1:2000 with a solution from Biotechnology Co., Ltd., and incubate at 37°C for 2 hours. Wash three times with PBST. Add 100 μL / well of TMB substrate chromogenic solution (purchased from Sangon Biotech (Shanghai) Co., Ltd.), and incubate at room temperature in the dark for 5-10 minutes. Stop the reaction by adding 100 μL / well of 2 mol / L H2SO4. Measure the absorbance of each well at 450 nm using a Thermo Multiskan FC microplate reader. Antibody levels are expressed as P / N values: P / N = OD of sample well. 450 / PBS OD 450 .

[0097] (6) After oral administration to mice and other mammals, recombinant Bacillus subtilis Et1 surface-displayed with Edwardsiella tarda outer membrane protein OmpA or recombinant Bacillus subtilis Et2 surface-displayed with the fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB, the sIgA levels of anti-Edwards tarda outer membrane protein OmpA in the small intestinal contents of mice are shown in Table 3. Based on Table 3, the following plots were drawn... Figure 11The same cluster data column is marked with different lowercase letters to indicate significant difference (p<0.05), and the same letter indicates no significant difference (p>0.05). Therefore, compared with the control group and the Bacillus subtilis 168 group, the specific sIgA level of OmpA in the small intestinal contents of the C group and the D group of mice fed with the recombinant Bacillus subtilis was significantly increased (p<0.05), and gradually increased with the extension of the immune time. The specific sIgA level of OmpA in the small intestinal contents of the mice fed with the recombinant Bacillus subtilis Et2 was always significantly higher than that of the recombinant Bacillus subtilis Et1 (p<0.05), which proved that the recombinant Bacillus subtilis Et1 and Et2 displaying the surface of Edwardsiella tarda outer membrane protein OmpA could stimulate the production of high levels of OmpA specific sIgA antibodies in mice. The recombinant Bacillus subtilis Et2 fused with the cholera enterotoxin CTB could enhance the immunogenicity of the antigen and promote the production of higher levels of OmpA specific sIgA antibodies in mice and other mammals.

[0098] Table 3 sIgA level of OmpA specific to Edwardsiella tarda outer membrane protein in the small intestinal contents of mice (P / N)

[0099]

[0100] Note: The same row data is marked with different lowercase letters on the right shoulder to indicate significant difference (p<0.05), and the same letter indicates no significant difference (p>0.05).

[0101] Example 7

[0102] The effect verification of the recombinant Bacillus subtilis Et1 displaying the surface of Edwardsiella tarda outer membrane protein OmpA and the recombinant Bacillus subtilis Et2 displaying the surface of Edwardsiella tarda outer membrane protein OmpA and the cholera enterotoxin CTB fusion protein on the prevention and treatment of Edwardsiella tarda infection in mice and other mammals includes the following steps:

[0103] (1) 50 SPF female Kunming mice aged 21 days (weight 18.0±2.0 g, purchased from Chengdu Dashuo Experimental Animal Co., Ltd.) were randomly divided into 5 groups according to Table 4, in which the A- group and the A+ group were the negative control group and the positive control group respectively, and only fed with the basic diet, the B group, the C group and the D group were respectively fed with the same amount of basic diet containing wild-type Bacillus subtilis 168, the same amount of basic diet containing recombinant Bacillus subtilis Et1 and the same amount of basic diet containing recombinant Bacillus subtilis Et2 (the amount of spores in the feed was 2.0×10 6 CFU / g). During the experiment, the mice in each group were free to eat and drink, and the environmental temperature was controlled at 18-23°C.

[0104] Table 4 Oral immunization and Edwardsiella tarda challenge grouping and design of mice

[0105]

[0106]

[0107] (2) The entire experimental period was 45 days. On day 42, except for group A-, the mice in the other four groups were intraperitoneally injected with 0.5 mL / mouse of Edwardsiella tarda XYHZYQ bacterial suspension (7.6 × 10⁻⁶). 9 Mice in group A were challenged with a dose of saline solution (CFU / mL). Mice in group A were injected with the same dose of saline solution and observed for 72 hours. Mortality was recorded and the survival rate of the mice was calculated.

[0108] (3) Mice and other mammals were orally immunized with recombinant Bacillus subtilis Et1 (surface-displayed Edwardsiella tarda outer membrane protein OmpA) or recombinant Bacillus subtilis Et2 (surface-displayed Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB fusion protein). 42 days later, the mice were infected with Edwardsiella tarda. The mortality rate of the mice was as follows: Figure 12 As shown. According to Figure 12 It was found that none of the mice in the negative control group died within the 72-hour observation period, with a survival rate of 100%; all mice in the positive control group died within 48 hours of infection, with a survival rate of 0%; 80% of the mice in group B, orally immunized with wild-type Bacillus subtilis 168, died within 60 hours of infection, and only 20% survived within 72 hours; the survival rates of mice in groups C and D, orally immunized with recombinant Bacillus subtilis, were 50% and 60% within 72 hours, respectively. Therefore, compared with the positive control group, recombinant Bacillus subtilis Et1 and Et2, which exhibit the outer membrane protein OmpA of Edwardsiella tarda, can significantly improve the survival rate of mammals such as mice after infection with Edwardsiella tarda through oral immunization. Among them, recombinant Bacillus subtilis Et2, which is fused with Vibrio cholerae enterotoxin CTB, can further enhance the resistance of mice to Edwardsiella tarda.

[0109] Example 8

[0110] The oral immunogenicity of recombinant Bacillus subtilis Et1, which displays the outer membrane protein OmpA of Edwardsiella tarda, and recombinant Bacillus subtilis Et2, which displays the fusion protein of OmpA of Edwardsiella tarda and CTB enterotoxin of Vibrio cholerae, in zebrafish and other fish, according to the present invention, includes the following steps:

[0111] (1) 200 adult male zebrafish (purchased from Hubei Chuaxin Biotechnology Co., Ltd.) were randomly divided into 4 groups according to Table 5, wherein group A was the control group, only fed with the basic diet, group B, group C and group D were respectively fed with equal amount of basic diet containing wild-type Bacillus subtilis 168, equal amount of basic diet containing recombinant Bacillus subtilis Et1 and equal amount of basic diet containing recombinant Bacillus subtilis Et2 (the amount of spores in feed was 2.0 x 10 6 CFU / g), and the fish were fed daily according to 5% of the body weight of the zebrafish. During the experiment, the water temperature was constant at 22℃, the experiment lasted for 45 days, and after the end of the experiment, all the zebrafish were anesthetized, 10 zebrafish per repetition, tail was cut off to collect blood, blood samples of each repetition were mixed, and after standing at room temperature for 2h, they were placed at 4℃ overnight, centrifuged at 4℃, 2500r / min for 10min, the serum was collected and stored at -80℃ refrigerator for standby.

[0112] Table 5 Oral immunization grouping design of zebrafish

[0113]

[0114] (2) The IgM level of anti-E. tarda outer membrane protein OmpA in the serum of zebrafish was detected by indirect ELISA. The purified OmpA protein was diluted to 5 μg / mL with 0.05 mol / L carbonate buffer (pH 9.6), added to 96-well high adsorption flat-bottom polystyrene enzyme-labeled plates (purchased from Wuhan Saivier Biotechnology Co., Ltd.) at 100 μL per well, and fixed at 37℃ until the liquid evaporated completely; washed three times with 300 μL / well of PBS containing 0.05% Tween 20 (pH 7.4) (PBST); added 250 μL of blocking solution (3% BSA-PBS) per well, and incubated at 37℃ for 2h, and washed three times with PBST; the serum of zebrafish was appropriately diluted with the blocking solution, 100 μL per well, and incubated at 37℃ for 3h, and washed three times with PBST; the mouse anti-zebrafish IgM monoclonal antibody (purchased from Creative Diagnostics, USA) was diluted 1:33 with the blocking solution, and incubated at 37℃ for 1h, and washed five times with PBST; the horseradish peroxidase-labeled goat anti-mouse IgG (purchased from Santa Cruz Biotechnology, USA) was diluted 1:1000 with the blocking solution, and incubated at 37℃ for 1h, and washed three times with PBST; 100 μL / well of TMB substrate solution (purchased from Shengwo Bioengineering (Shanghai) Co., Ltd.) was added, and reacted at room temperature for 5-10min in the dark; 100 μL / well of 2 mol / L H2SO4 was added to terminate the reaction; and the absorbance of each well was determined at 450nm using an enzyme-labeled instrument (Thermo Multiskan FC). The antibody level was represented by P / N value: P / N = sample well OD 450 / PBS OD 450 .

[0115] (3) The IgM levels against OmpA in the serum of zebrafish after oral immunization of zebrafish with recombinant B. subtilis Et1 displaying OmpA on the surface or recombinant B. subtilis Et2 displaying OmpA and CTB of Vibrio cholerae on the surface are shown in Table 6, and the IgM levels against OmpA in the serum of zebrafish are plotted according to Table 6 Figure 13 (Data columns marked with different lowercase letters indicate significant differences (p<0.05), and marked with the same letter indicate no significant difference (p>0.05)), and it can be seen that, compared with the control group and the B. subtilis 168 group, the OmpA-specific IgM levels in the serum of zebrafish in groups C and D fed with recombinant B. subtilis are significantly increased (p<0.05), and the OmpA-specific IgM level in the serum of zebrafish fed with recombinant B. subtilis Et2 is significantly higher than that of recombinant B. subtilis Et1 (p<0.05), which proves that both recombinant B. subtilis Et1 and Et2 displaying OmpA on the surface can stimulate zebrafish to produce high levels of OmpA-specific IgM antibodies, and the recombinant B. subtilis Et2 displaying OmpA and CTB of Vibrio cholerae on the surface can enhance the immunogenicity of the antigen and promote zebrafish to obtain higher levels of OmpA-specific IgM antibodies.

[0116] Table 6 IgM levels against OmpA in the serum of zebrafish

[0117]

[0118] Note: Different lowercase letters marked on the right shoulder of the same column of data indicate significant differences (p<0.05), and the same letter indicates no significant difference (p>0.05)

[0119] Example 9

[0120] The effect verification of a recombinant B. subtilis Et1 displaying OmpA on the surface and a recombinant B. subtilis Et2 displaying OmpA and CTB of Vibrio cholerae on the surface on zebrafish and other fish for preventing and treating Edwardsiella tarda infection includes the following steps:

[0121] (1) 240 adult male zebrafish (purchased from Hubei Chuaxin Biotechnology Co., Ltd.) were randomly divided into 5 groups according to Table 7, wherein the A- group and the A+ group were negative and positive control groups respectively, and only fed with the basic diet, the B group, the C group and the D group were fed with the basic diet containing wild-type Bacillus subtilis 168, the same amount of basic diet containing recombinant Bacillus subtilis Et1 and the same amount of basic diet containing recombinant Bacillus subtilis Et2 (the amount of spores in feed was 2.0×10 6 CFU / g) respectively, and fed according to 5% of the body weight of zebrafish every day. During the experiment, the water temperature was constant at 22℃, and the experimental period was 60 days. The zebrafish in each group were fed until the 45th day, and then 5 μL / zebrafish of Edwardsiella tarda XYHZYQ bacterial solution (1.0×10 9 CFU / mL) was injected intraperitoneally to challenge the attack of the zebrafish in the remaining 4 groups except the A- group, and the zebrafish in the A- group were injected with the same dose of normal saline. The survival rate of zebrafish was recorded for 15 days.

[0122] Table 7 Oral immunization of zebrafish and grouping and design of Edwardsiella tarda challenge

[0123]

[0124]

[0125] (2) Zebrafish and other fish orally immunized with recombinant Bacillus subtilis Et1 displaying Edwardsiella tarda outer membrane protein OmpA or recombinant Bacillus subtilis Et245 displaying Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB fusion protein were infected with Edwardsiella tarda after 45 days, and the death of zebrafish was as shown in Figure 14 Table 8. According to the results, the recombinant Bacillus subtilis Et1 and the recombinant Bacillus subtilis Et245 could effectively protect zebrafish from Edwardsiella tarda infection. Figure 14It can be seen that the negative control group did not die in the 15-day observation period, and the survival rate was 100%; the positive control group died after 12 days of challenge, i.e. the survival rate was 0%; the B group of zebrafish orally immunized with wild-type Bacillus subtilis 168 died in the third day after challenge, and 27.08% (13 / 48) of the zebrafish died successively until the 13th day, and all the 48 zebrafish died, i.e. the survival rate was 0%; the survival rates of the C group and the D group of zebrafish orally immunized with recombinant Bacillus subtilis were 72.92% (35 / 48) and 85.42% (41 / 48) respectively in the 15-day observation period, wherein 12.50% (6 / 48) of the C group of zebrafish fed with recombinant Bacillus subtilis Et1 died in the third day after challenge, and 4.17% (2 / 48) of the D group of zebrafish fed with recombinant Bacillus subtilis Et2 died after 8 days of challenge. Therefore, compared with the positive control group and the wild-type Bacillus subtilis 168, the recombinant Bacillus subtilis Et1 and Et2 displaying the outer membrane protein OmpA of Edwardsiella tarda on the surface can significantly improve the survival rate of fish such as zebrafish after infection with Edwardsiella tarda by oral immunization, wherein the recombinant Bacillus subtilis Et2 fused with the enterotoxin CTB of Vibrio cholerae can further enhance the resistance of zebrafish to Edwardsiella tarda and prolong the survival time of zebrafish after infection with Edwardsiella tarda.

[0126] In summary, the present application discloses a recombinant Bacillus subtilis displaying the fusion protein of the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae on the surface, a construction method and an application in resisting Edwardsiella tarda infection. The technology uses the spore coat protein CotY as an anchor point, and homologous double cross-recombines the coding genes of OmpA and CTB into the genome of Bacillus subtilis 168 by chemical transformation, to obtain the recombinant Bacillus subtilis Et2 which can be stably inherited in Bacillus subtilis and display the outer membrane protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae on the spore surface. Compared with the recombinant Bacillus subtilis Et1 displaying only the outer membrane protein OmpA of Edwardsiella tarda and the wild-type Bacillus subtilis 168, the recombinant Bacillus subtilis Et2 can significantly improve the level of specific antibodies against OmpA protein in the body of fish and mammals after oral administration, and improve the survival time and survival rate of the body after infection with Edwardsiella tarda. The recombinant Bacillus subtilis Et2 as an oral vaccine type microecological immunization preparation for preventing and treating Edwardsiella tarda infection in fish and mammals can significantly simplify the immunization procedure, reduce immunization stress, save labor cost, ensure the effective concentration in the intestinal tract, and induce specific immune response of the body.

[0127] SEQ ID NO. 1 (cotY-F):

[0128] cgggatcctg actgtgacca tccgttag 28

[0129] SEQ ID NO. 2 (cotY-R):

[0130] cgaagctttc cattgtgatg atgcttttta 30

[0131] SEQ ID NO. 3 (cotY, 1134):

[0132] cgggatcctg actgtgacca tccgttagat gacaaagaga aagataaaga aaaacacgaa 60

[0133] agaaaatgtc attgcgacgt ttgctgtaat ggcaatggtt tttttggcaa cgacaacgcc 120

[0134] ttcatcgacc aagatctagc tcaagcaaat ctcaacaaac aagtttcaga tgaaacgatt 180

[0135] attattagag attcttgtga catcaatgtt acatctacag acgttcaagc cgtaacatca 240

[0136] gttgtaacag cacttaatgc cgctgtcgta acggcaactc tgacatcaat tgcagacggc 300

[0137] gtaattgccg aattagtcgc acaagatttg ttacagctta cagctaacaa acaagtaaac 360

[0138] cgccaaaaac ttctcatcga atgttcccgc ggcgtaaacg tcacaacagt agatgccgat 420

[0139] atcgcaaccc ttatttctac agcaacaaat acactcgtag ccatcctagt tatcactctt 480

[0140] gtcctctagg acctaaaagc agagctaaaa acgctctgct ttttcttatt ttccaagcat 540

[0141] atgatgaata tatagacgtt cacccacacc aagtggggca cgggtacata tgttgttaag 600

[0142] gactaaagtc aaatacccta taaagaagga gctgaaatca atgagctgcg gaaaaaccca 660

[0143] tggccggcat gagaactgtg tatgcgatgc agtggaaaag attttagcag agcaggaggc 720

[0144] agttgaagaa cagtgtccga ctggctgcta taccaacctt ttaaacccta cgattgctgg 780

[0145] aaaagacaca attccgtttc tcgtttttga taaaaaaggc ggattgttct ccacattcgg 840

[0146] aaacgtaggg ggatttgtgg atgatatgca atgctttgaa tccattttct tccgcgtcga 900

[0147] aaaattatgc gattgctgtg caacactgtc tattttacgc ccggtcgatg tcaaaggcga 960

[0148] taccttaagt gtttgccacc cttgcgaccc ggatttcttc gggctagaaa aaacagattt1020

[0149] ctgcattgaa gtggatctcg gatgcttctg cgcgattcag tgcctgtcac cagagctagt1080

[0150] TGA CAG AAC ATC GCC TCA CAA AGA TAA AAA GCA TCA CAC AAT GGA AAGC TTCG 1134

[0151] SEQ ID NO. 4 (ompA-F):

[0152] CCA AGC TTG CTC CAA AGA TAA CAC CTG 28

[0153] SEQ ID NO. 5 (ompA-R):

[0154] CGA ATTC TTC AAG CCT GCG GC TGA GTA CCT 30

[0155] SEQ ID NO. 6 (ompA, 1008):

[0156] ccaagcttgc tccgaaagat aacacctggt acgtcggtgg taaactgggc tggtcccact 60 ttatcagcaa cagctttgaa gacatgggta caaccaagcc ccatccgaat cagctgggcg 120 ccggtgcttt cttcggttac caagccaacc cgtacctggg cttcgaaatg ggctacgact 180 ggctgggccg catgggctac accggtgacg tgaatgccaa attcaagtca cagggcgtac 240 agctggctgc caaactgagc tacccgctga tggacgatct ggacgtatac acccgcctgg 300 gcggcatggt atggcgttct gatatccacg gcgcagcaga cggcggcgac tatacttcaa 360 gccacgacac cggcgtatct ccgctggccg ctatcggcgt tgagtacgca ctgaacaaag 420 actgggctac ccgtctggac tatcagtatg tcaacaaggt tggcacccgc agcgaaaccg 480 gcgcacgtcc ggacaacacc atgctgagcc tgggcgttgt ataccgcttc ggtcaggatg 540 aagtcgcagc tccggcaccg atcccggctc cggctccggc tccggtcgtt gaaaccaagc 600 gttcaccct gaagtctgac gttctgttca acttcaacaa atacaccctg aaagccgaag 660 gccgtcaggc gctggatcag ctgtacagcc agctgagcag catggacccg aaagacggtt 720 ctgtcgtcgt tctgggctac accgaccgca tcggttccga tcagtacaac ctgaagctgt 780 ctaagcaacg tgctcagacc gtggttgact acctggtatc taaaggtatc ccggcagaca 840 agatcgctgc ccgtggtatg ggtaaagctg atccggttaccggttcaacc tgtgataacg 900 tgaagccgcg tgctgccctg atcaactgcc tggcaccgga tcgtcgcgtt gttatcgaag 960 tgaaaggcat caaagaagaa gttactcagc cgcaggctta agaattcg 1008

[0157] SEQ ID NO. 7 (CTB, 312):

[0158] acacctcaaa atattactga tttgtgtgca gaataccaca acacacaaat acatacgcta 60aatgataaga tattttcgta tacagaatct ctagctggaa aaagagagat ggctatcatt 120acttttaaga atggtgcaac ttttcaagta gaagtaccag gtagtcaaca tatagattca 180caaaaaaaag cgattgaaag gatgaaggat accctgagga ttgcatatct tactgaagct 240aaagtcgaaa agttatgtgt atggaataat aaaacgcctc atgcgattgc cgcaattagt 300atggcaaatt aa 312

[0159] SEQ ID NO. 8 (linker, 30):

[0160] ggtggtggtg gttctggtgg tggtggttct 30

[0161] SEQ ID NO. 9 (ompA-linker-ctB, 1344):

[0162] aagcttgctc cgaaagataa cacctggtac gtcggtggta aactgggctg gtcccacttt 60

[0163] GCTGGGCCGCA TGGGCTACAC CGGTGACGTG AATGCCAAAT TCAAGTCACA GGGCgtacag 240 CTGGCTGCCA AACTGAGCTA CCCGCTGATG GACGATCTGG ACgtatacac CCgcctgggc 300

[0164] CTGGGCCGCA TGGGCTACAC CGGTGACGTG AATGCCAAAT TCAAGTCACA GGGCgtacag 240 CTGGCTGCCA AACTGAGCTA CCCGCTGATG GACGATCTGG ACgtatacac CCgcctgggc 300

[0165] GGCATGGTAT GGCgttctga tatccacggc gcagcagacg gcggcgacta tacttcaagc 360

[0166] CACGACACCG GCgtatctcc gctggccgct atcggcgttg agtacgcact gaacaaagac 420

[0167] TGGGCTACCC GTCTGGACTA TCAGtatgtc aacaaggttg gcacccgcag cgaaaccggc 480

[0168] GCACGTCCGG ACAACACCAT GCTGagcctg ggcgttgtat accgcttcgg tcaggatgaa 540

[0169] GTCGCAGCTC CGGCACCgat CCCGGCTCCG GCTCCGGCTC CGGTCgttga aaccaagcgt 600 TTCACCCTGA AGTCTGACGT TCTGTTCAAC TTCAACAAAT ACACCCTGAA AGCCGAAGGC 660

[0170] GTCAGGCGC TGGATCAGCT GTACAGCCAG CTGAGCAGCA TGGACCCGAA AGACG GTTCT 720

[0171] AAGCAACGTG CTCAGACCGT GGTTCGCTAC CTGGTATCTA AAGGTATCCC GGCAGACAAG 840

[0172] ATCGCTGCCG TGGTATGGGT AAAGCTGATC CGGTTACCGG TTCAACCTGT GATAACGTG 900

[0173] AAGCCGCGTG CTGCCCTGAT CAACTGCCTG GCACCAGATC GTCGCCTGT TATCGAAGTG 960

[0174] AAAGGCGTCA AAGAAAGTAC TCAGCCGCAG GCTGGTGGTG GTGGTTCTGG TGGTGGT 1020

[0175] GCTTCTACAC CTCAAATAAT ACTGATTGTG TGTCAAAATC CACAACACAC AAATACTAT 1080

[0176] ACGCTAAATG ATAAGATATT TTCGTATACA GAATCTCTAG CTGAAAAAAG AGAGATGGCT 1140

[0177] ATCATTACTT TTAAGAATGG TCACTTTTTC AAGTAGAAGT ACCAGGTAGT CAACATATA 1200

[0178] GATTACAAAA AAAAGCGATT GAAAGGATGA AGGATACCTG AGGATTGCAT ATCTTACT 1260

[0179] GAAGCTAAAG TCGAAAAGTT ATGTGTATGG AATAATAAAA CGCCTCATGC GATTGCCGCA 1320

[0180] attagtatgg caaattaaga attc 1344

[0181] SEQ ID NO. 10 (amylase primer upper):

[0182] ccaatgaggt taagagtatt cc 22

[0183] SEQ ID NO. 11 (amylase primer lower):

[0184] cgagaagcta tcaccgccca gc 22

[0185] SEQ ID NO. 12:

[0186] cggcggccgc gctccgaaag ataacacctg 30

[0187] SEQ ID NO. 13:

[0188] gggctcgaga gcctgcggct gagtaactt 29

[0189] To the extent any of the foregoing descriptions of the present application (e.g., the detailed description of the application, the abstract, the claims, etc.) contain terms or phrases that are not explicitly recited in the specification, it is intended that such terms or phrases be construed in accordance with the meaning of the terms or phrases as they would be understood by one of ordinary skill in the art.

Claims

1. A recombinant Bacillus subtilis strain displaying a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on its surface, characterized in that, The recombinant Bacillus subtilis was obtained by using the spore capsid protein CotY as an anchor point and employing a chemical transformation method to homologously double-cross recombine the coding genes of OmpA and CTB into the genome of Bacillus subtilis 168. This resulted in a recombinant Bacillus subtilis that can be stably inherited within Bacillus subtilis and displays Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on the spore surface. The method for constructing the recombinant Bacillus subtilis includes the following steps: Step S1: Using the genome of Bacillus subtilis 168 as a template, and cotY-F and cotY-R as primers, the genomes of Bacillus subtilis 168 were introduced at the 5' ends of the upstream and downstream primers, respectively. Bam HI and Hind III restriction enzyme sites, the corresponding sites are underlined; for the gene encoding the promoter-containing gene encoding the spore capsid protein CotY. cotY PCR amplification was performed, and the sequence of the obtained PCR product is shown in SEQ ID NO.3 of the sequence listing; the PCR product was ligated into the pMD™19 Simple vector and transformed into competent cells to obtain the recombinant plasmid pMD- cotY; The primers are shown below: cotY-F:[5'-CG GGATCC [TGACTGTGACCATCCGTTAG-3'] is SEQ ID NO.1 cotY-R: [5'-CG AAGCTT [TCCATTGTGATGATGCTTTTTA-3'] is SEQ ID NO.2; Step S2: Using gene synthesis and TA cloning, the gene fragment encoding the B subunit of Vibrio cholerae enterotoxin was linked to [a specific gene] via a linker. ompA The 3' end of the gene forms a tandem. ompA -linker- ctB Gene fragments, and introduced at the 5' end of the sequence. Hind III restriction enzyme site, with a stop codon "TAA" introduced at the 3' end. EcoR I. The restriction enzyme sites were ligated into the pMD™19 Simple vector and transformed into competent cells to obtain the recombinant plasmid pMD- ompA- linker- ctB; The gene fragment encoding the B subunit of Vibrio cholerae enterotoxin has the Gene ID U25679.1 and its sequence is shown in SEQ ID NO.7; Step S3: use Bam HI and Hind III. The integration plasmid pDG364 and the recombinant plasmid pMD- were digested separately with two enzymes. cotY The enzyme digestion obtained cotY The fragment was linked to pDG364 and transformed into competent cells to be cloned, obtaining the recombinant integrative plasmid pDG364- cotY; Step S4: use Hind III and EcoR I. Double digestion of the recombinant integrated plasmid pDG364- cotY and recombinant plasmid pMD- ompA- linker- ctB The enzyme digestion obtained ompA- linker- ctB Fragment and pDG364- cotY The plasmid was ligated, transformed into competent cells, and cloned to obtain the recombinant integrative plasmid pDG364- cotY-ompA- linker- ctB ; Step S5: Use restriction endonucleases Xba I paired with the recombinant integrative plasmid pDG364- cotY-ompA- linker- ctB Linearization was achieved through single-enzyme digestion, and the linear plasmid was transferred into competent wild-type Bacillus subtilis 168 cells via chemical transformation, using the amylase-encoding gene. amyE For homologous double cross recombination sites, cotY-ompA- linker- ctB The fragment was inserted into the genome of Bacillus subtilis 168 to obtain recombinant Bacillus subtilis with the surface displaying the fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB. The concatenated subsequence in step S2 is shown in SEQ ID NO. 8; the tandem... ompA -linker- ctB The gene fragment is shown in SEQ ID NO.

9.

2. The recombinant Bacillus subtilis exhibiting a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on its surface as described in claim 1, characterized in that, In step S2 ompA The gene is the encoding gene for the outer membrane protein OmpA in Edwardsiella tarda.

3. The recombinant Bacillus subtilis exhibiting a surface fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB as described in claim 1, characterized in that... In step S1, the competent cells are Escherichia coli DH5α; in step S2, the competent cells are Escherichia coli DH5α.

4. The recombinant Bacillus subtilis exhibiting a fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB on its surface as described in claim 1, characterized in that, In step S3, the competent cells are Escherichia coli DH5α.

5. A recombinant Bacillus subtilis strain displaying the fusion protein of Edwardsiella tarda outer membrane protein OmpA and Vibrio cholerae enterotoxin CTB as described in claim 1, characterized in that, In step S4, the obtained recombinant integrative plasmid is transferred into Escherichia coli DH5α competent cells for cloning and amplification.

6. The use of recombinant Bacillus subtilis with a surface display of the Edwardsiella tarda outer membrane protein OmpA and the Vibrio cholerae enterotoxin CTB fusion protein, as described in any one of claims 1-5, in the preparation of a biological product for treating Edwardsiella tarda infection.

7. The use of recombinant Bacillus subtilis with a surface display of the Edwardsiella tarda outer membrane protein OmpA and the Vibrio cholerae enterotoxin CTB fusion protein, as described in any one of claims 1-5, in the preparation of a vaccine against Edwardsiella tarda infection.

8. The use of recombinant Bacillus subtilis with a surface display of the fusion protein OmpA of Edwardsiella tarda and the enterotoxin CTB of Vibrio cholerae, as described in any one of claims 1-5, in the preparation of an oral vaccine-type probiotic for the treatment of Edwardsiella tarda infection.

Citation Information

Patent Citations

  • Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof

    CN102604993A

  • Helicobacter pylori oral vaccine based on bacillus subtilis carrier

    CN107184967A

  • E.tarda (edwardsiella tarda) ompA (outer-membrane protein A) with immune protection function

    CN108359683A

  • Bacillus subtilis genome in-situ integrated spore surface display vector and application thereof

    CN119020388A