Method for constructing IL-11 knock-in mouse model and application

Abstract

The invention discloses a method for constructing an IL-11 knock-in mouse model and application of the IL-11 knock-in mouse model. The invention provides a specific DNA molecule. The specific DNA molecule sequentially comprises the following elements from upstream to downstream: an upstream homologous arm, an mTFP1 coding gene, a P2A self-shearing peptide coding gene, a Cre recombinase coding gene, a WPRE-polyA and a downstream homologous arm. The invention also provides a method for preparing the recombinant mouse, which comprises the following step: replacing the target segment in the mouse genome DNA with the specific DNA molecule to obtain the recombinant mouse. The invention constructs an IL-11-Cre tool mouse based on a Cre-LoxP recombination system, and the IL-11-Cre tool mouse can be used for solving the scientific problem of an IL-11 + regulation molecular mechanism in the occurrence and progress process of important diseases. The application disclosed by the invention is helpful for further exploring the action mechanism of IL-11 in the occurrence and development process of diseases in the future so as to find a new treatment target and develop a more effective treatment strategy.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, specifically to the field of animal model preparation, and specifically relates to a method and application of constructing an IL-11 knock-in mouse model. Background Art

[0002] IL-11 is a member of the IL-6 cytokine family. More and more studies have found that IL-11 plays an important role in pathological processes such as inflammation and fibrosis, and is considered a potential drug development target for the treatment of cancer and pulmonary fibrosis, even surpassing transforming growth factor-β (TGF-β), which has long been considered the main culprit of cancer metastasis and pathological fibrosis.

[0003] The IL-11 gene consists of 5 exons and 4 introns, encoding a 23kDa protein. IL-11 was initially purified from the culture supernatant of the PU-34 stromal cell line and was found to be able to replace IL-6 in stimulating the proliferation of plasmacytoma cells. Subsequently, a series of in vitro studies have shown that IL-11 has a wide range of activities, including stimulating platelet production and erythropoiesis, regulating macrophage differentiation and maturation, and inducing CD4 + Th2 and / or Th17 polarization of T cells, stimulation of B cell IgG production, and protection of endothelial cells from inflammation-related damage, etc. In addition, IL-11 can also regulate neurogenesis, increase osteoclast development, inhibit adipogenesis, and regulate epithelial cell proliferation and apoptosis, etc. Based on these research evidences, in 2012, the FDA approved recombinant human IL-11 (Neumega) as a treatment method to support platelet reconstruction after chemotherapy.

[0004] Evidence from human patient samples and genetically modified mouse models indicate that IL-11 and its signaling pathway also play an important role in the occurrence and progression of diseases such as rheumatoid arthritis, diabetes, asthma, chronic obstructive pulmonary disease, and pancreatitis. Summary of the invention

[0005] The purpose of the present invention is to provide a method for constructing an IL-11 knock-in mouse model and its application.

[0006] The invention provides a specific DNA molecule, which comprises the following elements in sequence from upstream to downstream: an upstream homology arm, a Cre recombinase encoding gene and a downstream homology arm.

[0007] Specifically, the specific DNA molecule includes the following elements from upstream to downstream: an upstream homology arm, a Cre recombinase encoding gene, WPRE-polyA and a downstream homology arm.

[0008] Specifically, the specific DNA molecule includes the following elements from upstream to downstream: an upstream homology arm, an mTFP1 encoding gene, a P2A self-cleavage peptide encoding gene, a Cre recombinase encoding gene, WPRE-polyA and a downstream homology arm.

[0009] Specifically, the specific DNA molecule is composed of the following elements from upstream to downstream: an upstream homology arm, an mTFP1 encoding gene, a P2A self-cleavage peptide encoding gene, a Cre recombinase encoding gene, WPRE-polyA and a downstream homology arm.

[0010] Specifically, the upstream homology arm is shown in positions 1-1756 in SEQ ID NO:1.

[0011] Specifically, the downstream homology arm is shown in positions 4173-5897 in SEQ ID NO:1.

[0012] Specifically, the Cre recombinase encoding gene is shown in positions 2531-3583 of SEQ ID NO:1.

[0013] Specifically, the mTFP1 encoding gene is as described in SEQ ID NO: 1 at positions 1757-2464.

[0014] Specifically, the P2A self-cleaving peptide encoding gene is shown in positions 2465-2530 of SEQ ID NO:1.

[0015] Specifically, the WPRE-polyA is shown in positions 3584-4172 of SEQ ID NO:1.

[0016] Specifically, the specific DNA molecule is shown in SEQ ID NO:1.

[0017] The present invention also protects a kit for constructing a recombinant mouse, which comprises any of the above-mentioned specific DNA molecules.

[0018] Specifically, the kit also includes Cas9 protein, CrRNA and tracrRNA.

[0019] The crRNA is shown in SEQ ID NO:4.

[0020] The tracrRNA is shown in SEQ ID NO:5.

[0021] Specifically, the kit further comprises a primer pair consisting of a primer shown in SEQ ID NO: 6 and a primer shown in SEQ ID NO: 7.

[0022] Specifically, the kit further comprises a primer pair consisting of a primer shown in SEQ ID NO: 8 and a primer shown in SEQ ID NO: 9.

[0023] Specifically, the kit further comprises a primer pair consisting of a primer shown in SEQ ID NO: 10 and a primer shown in SEQ ID NO: 11.

[0024] The recombinant mouse is a recombinant mouse obtained by replacing the target segment in the mouse genomic DNA with the specific DNA molecule. The target segment is a segment in the mouse genomic DNA starting from the upstream homologous arm and ending at the downstream homologous arm. The target segment is located on chromosome 7. The recombinant mouse can be a heterozygous recombinant mouse obtained by replacing the target segment in one chromosome 7 of the mouse with the specific DNA molecule. The recombinant mouse can be a homozygous recombinant mouse obtained by replacing the target segments in a pair of chromosomes 7 (a pair of homologous chromosomes) of the mouse with the specific DNA molecule.

[0025] The present invention also provides a method for preparing a recombinant mouse, comprising the following steps: replacing the target segment in the mouse genomic DNA with the specific DNA molecule to obtain a recombinant mouse. The target segment is a segment in the mouse genomic DNA starting from the upstream homologous arm and ending at the downstream homologous arm. The target segment is located on chromosome 7. The method comprises the following steps: replacing the target segment in one chromosome 7 of the mouse with the specific DNA molecule to obtain a heterozygous recombinant mouse. The method comprises the following steps: replacing the target segments in a pair of chromosomes 7 (a pair of homologous chromosomes) of the mouse with the specific DNA molecule to obtain a homozygous recombinant mouse.

[0026] The target segment is located in chromosome 7. The recombinant mouse can be a heterozygous recombinant mouse obtained by replacing the target segment in one chromosome 7 of the mouse with the specific DNA molecule. The recombinant mouse can be a homozygous recombinant mouse obtained by replacing the target segments in a pair of chromosomes 7 (a pair of homologous chromosomes) of the mouse with the specific DNA molecule.

[0027] Specifically, the method comprises the following steps: co-introducing the specific DNA molecule, Cas9 protein, CrRNA and tracrRNA into mice, thereby replacing the target segment in the mouse genomic DNA with the specific DNA molecule. Specifically, the method comprises the following steps: co-introducing the specific DNA molecule, Cas9 protein, CrRNA and tracrRNA into mice, and then screening recombinant mice in which the target segment in the genomic DNA is replaced with the specific DNA molecule.

[0028] Specifically, the method comprises the following steps: introducing the specific DNA molecule, Cas9 protein, CrRNA and tracrRNA into a mouse fertilized egg, thereby replacing the target segment in the mouse genomic DNA with the specific DNA molecule. Specifically, the method comprises the following steps: introducing the specific DNA molecule, Cas9 protein, CrRNA and tracrRNA into a mouse fertilized egg, and then screening the recombinant mice in which the target segment in the genomic DNA is replaced with the specific DNA molecule from the mice developed from the fertilized eggs. Specifically, the method also includes the following steps: screening homozygous recombinant mice from the offspring mice obtained by mating heterozygous recombinant mice.

[0029] The screening specifically includes the following steps: using mouse genomic DNA as a template, and performing PCR amplification using primer pair 1 (a primer pair consisting of primers shown in SEQ ID NO: 6 and primers shown in SEQ ID NO: 7) and primer pair 2 (a primer pair consisting of primers shown in SEQ ID NO: 8 and primers shown in SEQ ID NO: 9); if an amplification product of 1882 bp is obtained by using primer pair 1 and an amplification product of 823 bp is not obtained by using primer pair 2, the mouse is a homozygous recombinant mouse; if an amplification product of 1882 bp is obtained by using primer pair 1 and an amplification product of 823 bp is obtained by using primer pair 2, the mouse is a heterozygous recombinant mouse.

[0030] Specifically, any of the above mice is a C57BL / 6N mouse.

[0031] The present invention also provides a method for preparing a modeling tool mouse, comprising the following steps: Recombinant mice were prepared according to the above method; The recombinant mice are mated with other mice to obtain offspring mice; Screening of modeling tool mice from offspring mice.

[0032] The other mice are Cre recombinase reporter mice.

[0033] The other mice are mice having a Cre recombinase reporter element.

[0034] Specifically, the other mice are B6-ROSA26-CAG-LSL-tdTomato mice.

[0035] Screening modeling tool mice from offspring mice means: screening mice having the specific DNA molecule and the Cre recombinase reporter element from offspring mice, which are modeling tool mice.

[0036] The method for screening mice having the specific DNA molecule is as follows: using mouse genomic DNA as a template, a primer pair consisting of a primer shown in SEQ ID NO: 6 and a primer shown in SEQ ID NO: 7 is used for PCR amplification; if an amplification product of 1882 bp is obtained, the mouse is a mouse having the specific DNA molecule.

[0037] A method for screening mice with a Cre recombinase reporter element: using mouse genomic DNA as a template, PCR amplification is performed using primers consisting of primers shown in SEQ ID NO: 10 and primers shown in SEQ ID NO: 11; if an amplification product of 196 bp is obtained, the mouse is a mouse with a Cre recombinase reporter element.

[0038] The present invention also provides a method for constructing a model mouse, comprising the following steps: Modeling tool mice were prepared according to the above method; The disease model is induced in modeling tool mice to obtain mice with disease phenotypes, which are model mice.

[0039] Specifically, the model mouse may be a colitis model mouse.

[0040] Specifically, the model mouse can be an inflammatory pathology model mouse or a fibrosis pathology model mouse.

[0041] Specifically, "inducing a disease model in modeling tool mice to obtain mice with a disease phenotype" may be: using sodium dextran sulfate to induce modeling tool mice to obtain mice with a colitis phenotype.

[0042] The present invention also provides the use of a recombinant mouse prepared by any of the above methods, a modeling tool mouse prepared by any of the above methods, or a model mouse prepared by any of the above methods in studying the molecular mechanism of IL-11 regulation during the occurrence and progression of a disease.

[0043] The present invention also provides a method for studying whether IL-11 is involved in the occurrence and development of a disease, comprising the following steps: Modeling tool mice were prepared according to the above method; The modeling tool mice were divided into two groups. The disease phenotype was induced in the experimental group, and the control group was not induced. The difference in fluorescence signals between the control group and the experimental group was compared. If the fluorescence signal of the experimental group was significantly enhanced compared with the control group, it indicated that IL-11 was involved in the occurrence and development of the disease.

[0044] Specifically, the fluorescent signal is a red fluorescent signal.

[0045] Specifically, the fluorescent signal is a cyan fluorescent signal.

[0046] Specifically, the mouse may be a BALB / c mouse, an NCG mouse, an FVB mouse, a C3H mouse, a DBA mouse or a C57BL / 6 mouse.

[0047] The model mice can be used to study IL-11 + Genetic lineages of cells in development and disease provide new insights into IL-11 + Lays the foundation for the role of cells in disease and trauma.

[0048] The present invention constructs an IL-11-Cre tool mouse based on the Cre-LoxP recombination system, which can be used to solve the scientific problem of the IL-11+ regulatory molecular mechanism in the occurrence and progression of important diseases. The present invention is helpful to further explore the mechanism of action of IL-11 in the occurrence and development of diseases in the future, to find new therapeutic targets, and to develop more effective therapeutic strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Schematic diagram of the components and working principle of TFP1-2A-Cre-WPRE-polyA.

[0050] Figure 2 This is a photo after immunofluorescence staining in Example 4. DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0052] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples are repeated three times, and the results are averaged.

[0053] Example 1: Preparation of functional DNA molecules The functional DNA molecule is a linear double-stranded DNA molecule, as shown in SEQ ID NO:1.

[0054] In SEQ ID NO: 1, nucleotides 1-1756 constitute the upstream homology arm (1756 bp), nucleotides 1757-2464 encode mTFP1, nucleotides 2465-2530 encode the P2A self-cleaving peptide, nucleotides 2531-3583 encode the Cre recombinase, nucleotides 3584-4172 constitute WPRE-polyA, and nucleotides 4173-5897 constitute the downstream homology arm (1725 bp).

[0055] mTFP1, the full name of which is monomeric teal fluorescent protein 1, is a fluorescent protein derived from marine organisms. It can be excited to emit bright cyan fluorescence with an emission wavelength ranging from 450 to 512 nanometers. P2A self-cleaving peptide (porcine teschovirus-1 2A peptide) is from porcine teschovirus and has the property of "self-cleavage", which can cause the protein chain to be cut at the 2A sequence to produce two independent proteins. Cre recombinase is a type I topoisomerase from bacteriophage P1, which can catalyze site-specific recombination of DNA between loxP sites. WPRE, the full name of which is woodchuck hepatitis virus posttranscriptionalregulatory element, is a commonly used transcription enhancer element that has the function of enhancing the expression of exogenous genes. PolyA, the full name of which is polyadenylation signal, can trigger the 3' end cleavage of mRNA and the addition of polyadenylic acid tail to form a mature mRNA molecule.

[0056] The double-stranded DNA molecule shown in SEQ ID NO: 1 was artificially synthesized and named mTFP1-2A-Cre-WPRE-polyA. The upstream homology arm corresponds to the upstream of the Il11 gene coding region in the mouse genomic DNA (1756 bp upstream of the start codon), and the downstream homology arm corresponds to the Il11 gene coding region in the mouse genomic DNA (the start codon ATG is counted as the 1st to 3rd positions of the coding region, and the downstream homology arm corresponds to the 5th to 1729th positions of the coding region). After homologous recombination between mTFP1-2A-Cre-WPRE-polyA and the mouse genomic DNA, the segment from the upstream homology arm to the downstream homology arm in the mouse genomic DNA was replaced (the replaced segments are, from upstream to downstream, upstream homology arm, atga, downstream homology arm), thereby destroying the expression of the endogenous Il11 gene, and the expression of mTFP1 and Cre was initiated by the endogenous Il11 gene transcriptional regulatory elements.

[0057] The Il11 gene in mouse cDNA is shown in SEQ ID NO: 2, the start codon corresponds to positions 156-158 of SEQ ID NO: 2, and the stop codon corresponds to positions 753-755 of SEQ ID NO: 2. The Il11 gene in mouse genomic DNA (located on chromosome 7) is shown in SEQ ID NO: 3, the start codon corresponds to positions 4893-4895 of SEQ ID NO: 3, and the stop codon corresponds to positions 9310-9312 of SEQ ID NO: 3.

[0058] Example 2: Obtaining recombinant mice Cas9 protein solution (EnGen Spy Cas9 NLS nuclease): NEB, product catalog number M0646M. Target sequence: CTTACAGTTCATGTCCCCAC AGG CRISPR-Cas9 technology was used to integrate mTFP1-2A-Cre-WPRE-polyA into the target site in genomic DNA to obtain recombinant mice.

[0059] 1. Preparation of RNP complex Artificially synthesized crRNA (single-stranded RNA molecule, as shown in SEQ ID NO: 4) and tracrRNA (single-stranded RNA molecule, as shown in SEQ ID NO: 5).

[0060] CrRNA: 5'-CUUACAGUUCAUGUCCCCACGUUUUAGA GCUAUGCUGUUU UG-3'; tracrRNA: 5'- AAACAGCAUAGC AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCCGGUGCU-3'.

[0061] Prepare solution in tube 1: add 0.8µL 100pmol / µL crRNA to 5.2µL RNase-free water, then add 0.6µL 100pmol / µL tracrRNA, mix well and incubate for 5min, then add 0.2µL 20µM Cas9 protein solution, mix well and incubate for 10min to obtain solution in tube 1.

[0062] Prepare solution in tube 2: Take mTFP1-2A-Cre-WPRE-polyA (linear double-stranded DNA molecule) prepared in Example 1 and adjust the DNA concentration to 15 ng / µL with RNase-free water.

[0063] Mix 2 volumes of the solution in tube 1 and 3 volumes of the solution in tube 2 to obtain the RNP complex.

[0064] 2. Preparation of F0 mice 1. Take 3-4 week old female C57BL / 6N mice, inject 10 IU pregnant mare serum (PMSG) into each mouse intraperitoneally, and 46-48 hours later inject 10 IU human chorionic gonadotropin (HCG) into each mouse intraperitoneally, and then mate with adult fertile male C57BL / 6N mice. The fertilized female mice are the donor mice.

[0065] 2. Take adult fertile female C57BL / 6N mice and mate them with vasectomized male mice. The female mice that show pregnancy changes (pseudo-pregnant female mice) are surrogate mice. Vasectomized male mice: adult fertile male C57BL / 6N mice that have undergone vasectomy.

[0066] 3. On the second day after step 1, the donor mice were killed and fertilized eggs were collected from the oviduct.

[0067] 4. Take the fertilized eggs obtained in step 3, inject the RNP complex prepared in step 1 (inject until the nuclear region swells significantly), and then place the fertilized eggs in M16 medium (Sigma, product catalog number M7292) and culture for 0.5-1h.

[0068] 5. After completing step 4, transplant the fertilized eggs into the oviduct of the surrogate mouse obtained in step 2 (25 fertilized eggs are transplanted into each surrogate mouse), and then raise the surrogate mouse normally to produce offspring mice after 19-20 days.

[0069] 6. The offspring mice obtained in step 5 were numbered after clipping their paws one week after birth and PCR identified at 1-2 weeks of age. Mice with positive PCR identification were the founder mice (also known as F0 mice).

[0070] PCR identification method: Take tail tissue, extract genomic DNA, and use the primer pair consisting of IL-11-cre-F1 and IL-11-cre-R1 for PCR amplification. If an amplification product of about 1882 bp is shown, the PCR identification is positive.

[0071] IL-11-cre-F1 (SEQ ID NO: 6): 5'-TACCCATCCACTCACCACT-3'; IL-11-cre-R1 (SEQ ID NO: 7): 5'-TTCACGATGCCCTTGTCC-3'.

[0072] 7. Identify whether the first founder mouse is homozygous or heterozygous The tail tissue was taken, genomic DNA was extracted, and PCR amplification was performed using a primer pair consisting of F1 and R1; if the amplified product showed a marked band (823 bp) by electrophoresis, the founder mouse was heterozygous; if the amplified product did not show the marked band, the founder mouse was homozygous.

[0073] F1 (SEQ ID NO: 8): 5'-GGGTGAGTCAGGATGTGTCAGGC-3'; R1 (SEQ ID NO: 9): 5'-GCCACCAAGCTCAAGTATCACAC-3'.

[0074] The identification results showed that all the founder mice obtained were heterozygous.

[0075] 3. Obtaining Offspring Mice Of the offspring mice (F1 generation mice) obtained by mating male F0 mice with female C57BL / 6N mice, 50% were heterozygous recombinant mice.

[0076] Of the offspring mice (F1 generation mice) obtained by mating female F0 mice with male C57BL / 6N mice, 50% were heterozygous recombinant mice.

[0077] Of the offspring mice (F2 generation mice) obtained by mating F1 generation male recombinant mice with F1 generation female recombinant mice of the same litter, 25% were homozygous recombinant mice and 50% were heterozygous recombinant mice.

[0078] F1 generation heterozygous recombinant mice can be used directly as experimental mice or continue to be subcultured to establish strains. F2 generation heterozygous recombinant mice can be used directly as experimental mice or continue to be subcultured to establish strains. F2 generation homozygous recombinant mice can be used directly as experimental mice or continue to be subcultured to establish strains.

[0079] Method for identifying homozygous recombinant mice and heterozygous recombinant mice: take tail tissue, extract genomic DNA, and perform PCR amplification using primer pair 1 (primer pair composed of IL-11-cre-F1 and IL-11-cre-R1, primer sequence see 6 in step 2) and primer pair 2 (primer pair composed of F1 and R1, primer sequence see 7 in step 2), respectively; if the electrophoresis of the amplification product using primer pair 1 shows a 1882 bp marker band and the electrophoresis of the amplification product using primer pair 2 does not show a 823 bp marker band, the mouse is a homozygous recombinant mouse; if the electrophoresis of the amplification product using primer pair 1 shows a 1882 bp marker band and the electrophoresis of the amplification product using primer pair 2 shows a 823 bp marker band, the mouse is a heterozygous recombinant mouse.

[0080] Homozygous recombinant mice are also called IL-11-mTFP1-Cre KI / KI homozygous mice. IL-11-mTFP1-CreKI / KI homozygous mice can develop and reproduce normally without obvious growth defects.

[0081] Example 3: Obtaining hybrid mice B6-ROSA26-CAG-LSL-tdTomato mice: Strain name: B6.Cg- Gt(ROSA)26Sor tm9(CAG -tdTomato)Hze ; Common name: Ai9 or Ai9 (RCL-tdT); Background: C57BL / 6NCrl. This mouse is a commercially available mouse strain of Beijing Weitongda Biotechnology Co., Ltd., and is sold as a heterozygous mouse (fertile). The Rosa26 site in one chromosome 6 DNA of this mouse is integrated with the following DNA segments: a STOP element with loxP on one side located upstream and a red fluorescent protein variant (tdTomato) located downstream. The STOP element prevents the transcription of the tdTomato (no red fluorescence is displayed). When the Cre recombinase is present, the DNA between the loxP sites undergoes site-specific recombination under the action of the Cre recombinase, and the STOP element is removed, thereby expressing tdTomato (displaying red fluorescence).

[0082] 1. The F2 generation IL-11-mTFP1-Cre KI / KI homozygous mice (female mice) obtained in Example 2 were mated with B6-ROSA26-CAG-LSL-tdTomato mice (male mice) to obtain offspring mice.

[0083] 2. From the offspring mice obtained in step 1, screen the mice with mTFP1-2A-Cre-WPRE-polyA and tdTomato, IL-11-mTFP1-Cre-Rosa26 LSL-tdTomato Mouse, referred to as IL-11 tdTomato Mouse.

[0084] The method for screening mice with mTFP1-2A-Cre-WPRE-polyA is as follows: the tail tissue is taken, genomic DNA is extracted, and PCR amplification is performed using a primer pair consisting of IL-11-cre-F1 and IL-11-cre-R1 (primer sequences are shown in step 2, 6 of Example 2); if the amplified product electrophoresis shows a 1882 bp marker band, the mouse is a mouse with mTFP1-2A-Cre-WPRE-polyA.

[0085] Method for screening mice with tdTomato: take tail tissue, extract genomic DNA, and use primer pair consisting of F2 and R2 for PCR amplification; if electrophoresis of the amplified product shows a 196bp marker band, the mouse is a tdTomato mouse.

[0086] R2 (SEQ ID NO: 10): 5'-GGCATTAAAGCAGCGTATCC-3'; F2 (SEQ ID NO: 11): 5'-CTGTTCCTGTACGGCATGG-3'.

[0087] IL-11 tdTomato Mice can be used as tool mice to verify whether the Il11 gene is involved in the occurrence and development of the disease. The principle is as follows: Cre recombinase is expressed under the action of the regulatory element upstream of the coding region in the endogenous Il11 gene in chromosome 7; Cre recombinase catalyzes site-specific recombination of DNA between loxP sites in chromosome 6, and the STOP element is removed, so that tdTomato is expressed (displaying red fluorescence); therefore, the number and signal intensity of cells with red fluorescence can reflect whether the endogenous Il11 gene (the regulatory element upstream of the coding region of the endogenous Il11 gene) is induced by the disease or other substances, thereby judging whether the endogenous Il11 gene is involved in the occurrence and development of the disease or whether it is involved in the body's response to other substances.

[0088] Example 4: Construction of Colitis Model Animals 1. Group processing The IL-11 obtained in Example 3 tdTomato Mice (8 weeks old) were divided into two groups, with 2 mice in each group.

[0089] Experimental group: From day 1 to day 15, 1.5 g / 100 mL dextran sulfate sodium aqueous solution was used as drinking water; from day 16 to day 17, distilled water was used as drinking water; Control group: distilled water was used as drinking water from day 1 to day 17; Mice had free access to drinking water.

[0090] 2. Detection After completing the grouping process in step 1, the mice were killed, colon tissues were taken and paraffin sections were prepared, and then tissue in situ immunofluorescence staining was performed. Immunofluorescence staining used an antibody against tdTomato (RFP Antibody Pre-adsorbed), Rockland Immunochemicals, product catalog number 600-401-379.

[0091] Results Figure 2 (Scale bar: 500 μm). Compared with the control group, the number of cells with red fluorescence in the colon of the experimental group increased significantly, indicating that the expression of the Il11 gene is involved in the occurrence and development of colitis. IL-11 The expression of genes plays a key role in maintaining colonic homeostasis and colonic diseases.

[0092] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A specific DNA molecule, which includes the following elements from upstream to downstream: an upstream homology arm, a Cre recombinase encoding gene and a downstream homology arm; The upstream homology arms are shown at positions 1-1756 in SEQ ID NO: 1, the Cre recombinase encoding gene is shown at positions 2531-3583 in SEQ ID NO: 1, and the downstream homology arms are shown at positions 4173-5897 in SEQ ID NO:

1.

2. The specific DNA molecule according to claim 1, characterized in that: It includes the following elements from upstream to downstream: upstream homology arm, mTFP1 encoding gene, P2A self-cleavage peptide encoding gene, Cre recombinase encoding gene, WPRE-polyA and downstream homology arm; The upstream homology arm is shown at positions 1-1756 in SEQ ID NO: 1, the mTFP1 encoding gene is shown at positions 1757-2464 in SEQ ID NO: 1, the P2A self-cleavage peptide encoding gene is shown at positions 2465-2530 in SEQ ID NO: 1, the Cre recombinase encoding gene is shown at positions 2531-3583 in SEQ ID NO: 1, the WPRE-polyA is shown at positions 3584-4172 in SEQ ID NO: 1, and the downstream homology arm is shown at positions 4173-5897 in SEQ ID NO:

1.

3. A kit for constructing a recombinant mouse, comprising the specific DNA molecule according to claim 1 or 2.

4. The kit according to claim 3, characterized in that: The kit also includes Cas9 protein, CrRNA and TracrRNA; the CrRNA is shown in SEQ ID NO: 4, and the TracrRNA is shown in SEQ ID NO:

5.

5. A method for preparing a recombinant mouse, comprising the following steps: replacing a target segment in the mouse genomic DNA with the specific DNA molecule described in claim 1 or 2 to obtain a recombinant mouse; the target segment is a segment in the mouse genomic DNA starting from an upstream homology arm and ending at a downstream homology arm; the upstream homology arm is as described in claim 1, and the downstream homology arm is as described in claim 1.

6. The method according to claim 5, characterized in that: The method comprises the following steps: introducing a specific DNA molecule, a Cas9 protein, a CrRNA and a tracrRNA into a mouse together, thereby replacing the target segment in the mouse genomic DNA with the specific DNA molecule to obtain a recombinant mouse; the specific DNA molecule is as described in claim 1 or 2; the CrRNA is as shown in SEQ ID NO: 4, and the TracrRNA is as shown in SEQ ID NO:

5.

7. A method for preparing a modeling tool mouse, comprising the following steps: Prepare a recombinant mouse according to the method of claim 5 or 6; The recombinant mice are mated with other mice to obtain offspring mice; Screening of modeling tool mice from offspring mice.

8. A method for constructing a model mouse, comprising the following steps: Prepare a modeling tool mouse according to the method of claim 6; The disease model is induced in modeling tool mice to obtain mice with disease phenotypes, which are model mice.

9. Use of the recombinant mouse prepared by the method of claim 5 or 6, the modeling tool mouse prepared by the method of claim 7, or the model mouse prepared by the method of claim 8 in studying the molecular mechanism of IL-11 regulation during the occurrence and progression of a disease.

10. A method for studying whether IL-11 is involved in the occurrence and development of a disease, comprising the following steps: Prepare a modeling tool mouse according to the method of claim 7; The modeling tool mice were divided into two groups. The disease phenotype was induced in the experimental group, and the control group was not induced. The difference in fluorescence signals between the control group and the experimental group was compared. If the fluorescence signal of the experimental group was significantly enhanced compared with the control group, it indicated that IL-11 was involved in the occurrence and development of the disease.

Images