Anti-CD3 nucleic acid aptamers for cell targeting and labeling

Abstract

The present application provides high affinity nucleic acid aptamer sequences that recognize CD3 protein complexes on the surface of a cell. The nucleic acid aptamer can be used as a targeting part of a delivery carrier, or used as a molecular component for immunotherapy and immunodiagnosis, or used for separating and purifying CD3 + T cells in a subject, or characterizing CD3 + T cells in a subject.

Description

[0001] The present invention is a divisional application of a case with an application date of July 27, 2020, an application number of 202080063162.3, and an invention name of “Anti-CD3 nucleic acid aptamers for cell targeting and labeling”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Application No. 62 / 879,401, filed on July 26, 2019; U.S. Provisional Application No. 62 / 879,413, filed on July 26, 2019; and PCT Application No. PCT / IB2019 / 000890, filed on July 26, 2019. Each of the above applications is incorporated herein by reference in its entirety. Background Art

[0004] Cluster of differentiation 3 (CD3) is a protein complex containing one γ subunit, one δ subunit, and two ε subunits, which binds to the T cell receptor (TCR) to form CD3γε and CD3δε heterodimers and transmits intracellular signals when the TCR binds to the peptide-MHC complex. The CD3 subunits are highly homologous, each with a small cytoplasmic domain and a transmembrane domain containing negatively charged residues, through which it associates with the positively charged residues in the transmembrane region of the TCR. The TCR contains α, β, ζ, and η subunits and exists as an αβ heterodimer associated with a ζζ homodimer or a ζη heterodimer. The TCR then associates with CD3γε and CD3δε heterodimers.

[0005] Aptamers are short single-stranded oligonucleotides with a unique three-dimensional configuration. Like antibodies, aptamers bind to targets with high specificity and can often modulate the biological activity of the target. Aptamers have many advantages over antibodies, including lack of immunogenicity, controllable and inexpensive chemical synthesis, high stability, and good tissue penetration. Aptamers can also be attached to nanoparticles, drugs, imaging agents, and other nucleic acids that serve as targeting moieties. Summary of the invention

[0006] This technology provides DNA and RNA aptamers that bind to CD3 and can be used to target, label or sort T cells.

[0007] Therefore, in one aspect, the technology provides a nucleic acid aptamer that binds to a CD3ε / γ or CD3ε / δ protein complex. The nucleic acid aptamer comprises a polynucleotide having any one of the several nucleic acid sequences described herein.

[0008] Another aspect of the present invention is a method for labeling, purifying or sorting cells expressing CD3. The cells are incubated with anti-CD3 nucleic acid aptamers carrying a marker (such as a fluorescent marker or a radioisotope).

[0009] Another aspect of the technology is a delivery vector for targeting T cells in vitro or in vivo, which comprises the above-mentioned anti-CD3 nucleic acid aptamer.

[0010] Another aspect of the present technology is a method of targeting a delivery vector to a subject's T cells. The method includes administering the delivery vector to the subject.

[0011] In addition, the technology provides a pharmaceutical composition comprising the above-mentioned drug delivery carrier.

[0012] The present technology can be further summarized into the following list of features.

[0013] 1. A method comprising the sequence GX1X2TX3GX4X5X6X7X8X9GGX 10 CTGG nucleic acid aptamer, wherein X1 is G or A; X2 and X6 are A, T or G; X3 is T, or G; X4 and X9 are G or C; X5 is C or T; X7 is T, G or C; and X8 and X9 are T, G or C. 10 is C, T or A (SEQ ID NO: 109) or a variant thereof; and wherein the nucleic acid aptamer binds to CD3ε / γ or CD3ε / δ.

[0014] 2. A nucleic acid aptamer comprising the sequence GGGX1TTGGCX2X3X4GGGX5CTGGC, wherein X1 and X2 are A, T or G; X3 is T, C or G; X4 and X5 are A, T or C (SEQ ID NO: 110) or a variant thereof, wherein the nucleic acid aptamer binds to CD3ε / γ or CD3ε / δ.

[0015] 3. A nucleic acid aptamer comprising the sequence GX1TTX2GX3X4X5X6CX7GGX8CTGGX9G, wherein X1 is A or G; X2 is T or G; X3, X7 and X9 are G or C; X4 is T or C; X5 is A or T; X6 is T, C or G; X8 is A or C (SEQ ID NO: 111) or a variant thereof, wherein the nucleic acid aptamer binds to CD3ε / γ or CD3ε / δ.

[0016] 4. A nucleic acid aptamer comprising the sequence GGGTTTGGCAX1CGGGCCTGGC, wherein X1 is G, C or T (SEQ ID NO: 112) or a variant thereof, wherein the nucleic acid aptamer binds to CD3ε / γ or CD3ε / δ.

[0017] 5. A nucleic acid aptamer comprising the sequence GCAGCGAUUCUX1GUUU, wherein X1 is U or has no base (SEQ ID NO: 113) or a variant thereof, wherein the nucleic acid aptamer binds to CD3ε / γ or CD3ε / δ.

[0018] 6. A nucleic acid aptamer according to any one of 1-5, wherein the nucleic acid aptamer binds to human CD3ε / γ and / or CD3ε / δ with a dissociation constant of about 0.2 pM to about 250 nM.

[0019] 7. A nucleic acid aptamer according to any one of 1-5, wherein the nucleic acid aptamer binds to a non-human form of CD3ε / γ and / or CD3ε / δ with a dissociation constant of about 20 nM to about 800 nM.

[0020] 8. The nucleic acid aptamer according to any one of 1-7, comprising a sequence selected from SEQ ID NO: 1 to 108.

[0021] 9. A nucleic acid aptamer according to any one of 1 to 8, comprising a variant of the sequence, wherein one or more bases are substituted by non-naturally occurring bases, or wherein one or more of the bases are deleted or the corresponding nucleotides are substituted by linkers.

[0022] 10. The nucleic acid aptamer according to feature 9, wherein the one or more non-naturally occurring bases are selected from methylinosine, dihydrouridine, methylguanosine and thiourea.

[0023] 11. The nucleic acid aptamer according to any one of 1 to 10 binds to CD3+ T cells but does not activate CD3+ T cells.

[0024] 12. A vector for delivering a reagent, a dye, a functional group for covalent coupling or a bioactive agent to a T cell, wherein the vector comprises a nucleic acid aptamer having any one of the features described in 1-11.

[0025] 13. The carrier according to feature 11 or feature 12, comprising a nanoparticle polymer.

[0026] 14. The carrier of feature 13, wherein the nanoparticle polymer comprises poly(β-amino ester) (PBAE).

[0027] 15. The vector according to feature 13 or feature 14, wherein the nucleic acid aptamer is covalently linked to the polymer.

[0028] 16. A vector according to any one of features 13-15, wherein the agent is a T cell modulator or imaging agent.

[0029] 17. A vector according to feature 16, wherein the T cell regulator is a viral vector carrying a transgene; wherein the viral vector is coated with the polymer; and wherein the nucleic acid aptamer is covalently linked to the polymer.

[0030] 18. The vector according to feature 17, wherein the viral vector is a lentiviral vector.

[0031] 19. The vector according to feature 17 or feature 18, wherein the transgene encodes a chimeric antigen receptor.

[0032] 20. A vector according to feature 16, wherein the T cell regulator is selected from dasatinib, a MEK1 / 2 inhibitor, a PI3K inhibitor, an HDAC inhibitor, a kinase inhibitor, a metabolic inhibitor, a GSK3β inhibitor, a MAO-B inhibitor and a Cdk5 inhibitor.

[0033] 21. A method of delivering an agent to T cells of a subject, the method comprising administering to the subject the vector of any one of features 16-20.

[0034] 22. A pharmaceutical composition comprising the carrier according to any one of features 16 to 20 and one or more excipients.

[0035] 23. A method for isolating T cells from a subject, the method comprising isolating T cells from the subject using the vector of any one of features 1-12. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The first 45 nucleic acid sequences (SEQ ID NO: 1-45, from top to bottom) of anti-CD3 DNA aptamers (clusters) obtained by SELEX of a mixture of recombinant human CD3ε / γ and human CD3ε / δ proteins are shown. Each complex was prepared as a C-terminal Fc fusion. hIgG1 Fc was used as a counter target. In a given round of SELEX, the clusters are arranged from top to bottom in descending order of frequency of occurrence.

[0037] Figure 2A-2E is a bar graph showing the Figure 1) obtained by PCR and binding of aptamers Cluster_1 (SEQ ID NO: 1), Cluster_1s (SEQ ID NO: 46, equivalent to Cluster_1 in which the 5' and 3' flanking regions have been removed), Cluster_2 (SEQ ID NO: 2), Cluster_3 (SEQ ID NO: 3) and Cluster_21 (SEQ ID NO: 21) to Jurkat cells (human CD3 positive cells). For comparison, the binding of the aptamers to Ramos cells (human CD3 negative cells; control) is also shown. The binding was detected at three aptamer concentrations of 3nM, 10nM and 30nM.

[0038] Figures 3A-3E is a bar graph showing the Figure 1 ) obtained by binding of nucleic acid aptamers CELTIC_1 (SEQ ID NO: 1), CELTIC_1s (SEQ ID NO: 46), CELTIC_2 (SEQ ID NO: 2), CELTIC_3 (SEQ ID NO: 3) and CELTIC_21 (SEQ ID NO: 21) to Jurkat cells (CD3 positive cells). For comparison, the binding of the nucleic acid aptamers to Ramos cells (human CD3 negative cells; control) is also shown. Binding was detected at the following nucleic acid aptamer concentrations: 1 nM, 2.5 nM, 5 nM, 7.5 nM and 10 nM.

[0039] Figures 4A-4C Is a sensorgram showing the results of binding of each of the biotinylated aptamers CELTIC_1 (SEQ ID NO: 1), CELTIC_3 (SEQ ID NO: 3) and CELTIC_21 (SEQ ID NO: 21) immobilized on a Series Sensor SA Chip to CD3ε / γ (left column), CD3ε / δ (middle column) and control hIgG1 Fc (right column). Binding was detected by surface plasmon resonance using a single cycle kinetic protocol. Nucleic acid aptamers were injected continuously at concentrations of 3nM, 10nM, 30nM, 50nM and 100nM.

[0040] Figures 5A-5FIt is a bar graph, which shows the results of each nucleic acid aptamer CELTIC_2 (SEQ ID NO: 2), CELTIC_3 (SEQ ID NO: 3) and CELTIC_21 (SEQ ID NO: 21) and their shorter versions CELTIC_2s (SEQ ID NO: 47), CELTIC_3s (SEQ ID NO: 48) and CELTIC_21s (SEQ ID NO: 49) lacking flanking region nucleotides and binding to Jurkat cells (CD3 positive cells). Binding was detected when the nucleic acid aptamer concentration was 3nM, 10nM and 30nM. Figures 5A and 5D show the binding of CELTIC_2 and CELTIC_2s to cells, respectively. Figures 5B and 5E show the binding of CELTIC_3 and CELTIC_3s to cells, respectively. Figures 5C and 5F show the binding of CELTIC_21 and CELTIC_21s to cells. The binding of nucleic acid aptamers to Ramos cells (CD3 negative cells; control) is used for comparison.

[0041] Figure 6 The sequence alignment of Cluster 1, 2, 3 and 21 (corresponding to SEQ ID NO: 1, 2, 3 and 21, respectively) and the sequence alignment of Cluster 1, 2 and 3 are shown to show the core regions of homology. The multiple sequence alignment uses the ClustalW algorithm. The conserved nucleotides found in each Cluster are marked with *.

[0042] Fig. 7A and 7B The SELEX program ( Figure 1 ) obtained several other Clusters ( Fig. 7A SEQ ID NOs: 11, 7, 5, 9, 22, 2, 17, 14, 15, 20, 18, 12, 1, 8, 13, 3, 4, 6, 19, 10 and 16 from top to bottom, Figure 7B The DNA sequences of SEQ ID NO: 1-22 from top to bottom in the table, and the sequence alignment excluding and including sequence Cluster 21 (respectively Fig. 7A and Figure 7B ). Multiple sequence alignment was performed using the ClustalW algorithm. Conserved nucleotides found in each Cluster are marked with *. Figure 7C The SELEX program ( Figure 1 ) and the base distribution determined by MEME (Multiple EM for Motif Elicitation).

[0043] 8A-8G are bar graphs showing the binding results of nucleic acid aptamers (without 5' and 3' flanking regions) CELTIC_4s (SEQ ID NO: 50), CELTIC_5s (SEQ ID NO: 51), CELTIC_6s ​​(SEQ ID NO: 52), CELTIC_9s (SEQ ID NO: 53), CELTIC_11s (SEQ ID NO: 54), CELTIC_19s (SEQ ID NO: 55) and CELTIC_22s (SEQ ID NO: 56) obtained by the SELEX program to Jurkat cells (CD3 positive cells) to evaluate the binding saturation and K D The binding was tested at three aptamer concentrations of 3 nM, 10 nM and 30 nM. For comparison, the binding of the aptamer to Ramos cells (CD3 negative cells; control) is also shown.

[0044] Figures 9A and 9B are bar graphs showing the comparison of the binding results of several selected nucleic acid aptamers to Jurkat cells (CD3 positive cells) and Ramos cells (CD3 negative cells, control) at concentrations of 3 nM (Figure 9A) and 10 nM (Figure 9B). Anti-CD3 OKT3 monoclonal antibody (32 nM) was used as a positive control.

[0045] Figures 10A-10D show the stability of nucleic acid aptamers CELTIC_1s (Figure 10A), CELTIC_4s (Figure 10B), CELTIC_11s (Figure 10C) and CELTIC_19s (Figure 10D) in the presence of serum. After the nucleic acid aptamers were incubated in serum, SELEX buffer containing 5% serum or RPMI medium containing 10% serum at 37°C for different times (24h, 4h, 2h, 1h, 30min, 10min or 0h), the integrity of the nucleic acid aptamers was detected by agarose gel electrophoresis.

[0046] Figures 11A and 11B are bar graphs showing the stability of nucleic acid aptamers CELTIC_1s, CELTIC_4s, CELTIC_9s, CELTIC_11s, CELTIC_19s and CELTIC_22s in the presence of serum. Stability was detected by incubating nucleic acid aptamers in serum or SELEX buffer containing 5% serum for different times (24h, 4h, 2h, 1h, 0.5h, 10min or 0h) at 37°C, and then detecting the binding of nucleic acid aptamers to Jurkat cells (CD3 positive cells) by flow cytometry. Anti-CD3 OKT3 monoclonal antibody (32nM) was used as a positive control.

[0047] Fig.12is a bar graph showing the Figure 1 Figure 2. Results of binding of aptamers CELTIC_1s, CELTIC_4s, CELTIC_9s and CELTIC_19s obtained by PCR to peripheral blood mononuclear cells isolated from healthy donors. Binding was detected at the following aptamer concentrations: 3 nM, 10 nM, 30 nM, 100 nM and 300 nM. Anti-CD3 OKT3 monoclonal antibody (32 nM) was used as a positive control.

[0048] Figures 13A-13D is a bar graph showing the Figure 1 The results of binding of nucleic acid aptamers CELTIC_1s, CELTIC_4s, CELTIC_9s and CELTIC_19s to mouse CD3-positive EL4 cells were obtained to estimate the binding saturation and K D Binding was tested at the following aptamer concentrations: 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM. For comparison, binding of aptamers at a concentration of 300 nM to human Jurkat cells and binding of anti-CD3145-2C11 monoclonal antibody (32 nM) to human Jurkat cells are also shown (gray bars).

[0049] Figures 14A-14L show images of human lymphocytes activated by anti-CD3 DNA aptamers at a concentration of 1 μm, measured by the secretion of cytokines. After incubation of aptamers at 37°C for different times (0h, 3h, 19h, 27h or 48h) in RPMI medium containing 10% serum in the presence of co-stimulatory anti-CD28 antibodies, the secreted cytokine levels were detected by ELISA. Figures 14A, 14B and 14C show the secretion of IFN-γ, IL-2 and TNF-α by aptamer CELTIC_1s, respectively. Figures 14D, 14E and 14F show the secretion of IFN-γ, IL-2 and TNF-α after treatment with aptamer CELTIC_4s, respectively. Figures 14G, 14H and 14I show the secretion of IFN-γ, IL-2 and TNF-α after treatment with aptamer CELTIC_11s, respectively. Figures 14J, 14K and 14L show the secretion of IFN-γ, IL-2 and TNF-α after treatment with nucleic acid aptamer CELTIC_19s, respectively. For comparison, the activation of anti-CD3 monoclonal antibodies in the presence or absence of co-stimulatory anti-CD28 antibodies is also shown.

[0050] Figures 15A-15C are bar graphs showing the activation of human lymphocytes by anti-CD3 DNA aptamers at a concentration of 1 μm by detecting the expression of CD25 and CD69 activation markers. After incubation of nucleic acid aptamers at 37°C for 48 hours with or without co-stimulatory anti-CD28 antibodies in RPMI medium containing 10% serum, the levels of CD25 and CD69 surface markers on CD4 and CD8 positive T lymphocytes were detected by flow cytometry. Figure 15A shows the expression results obtained by treating cells with only CELTIC_1s, CELTIC_4s, CELTIC_11s or CELTIC_19s. Figure 15B shows the expression results obtained by treating cells with the same nucleic acid aptamers mixed with co-stimulatory anti-CD28 antibodies. Figure 15C shows the expression results obtained after treating cells with fresh nucleic acid aptamer solutions mixed with anti-CD28 antibodies after incubation for 3h, 19h and 27h to keep the reagent concentration constant.

[0051] Figures 16A-16C are bar graphs showing the activation of human lymphocytes by anti-CD3 DNA aptamers at a concentration of 1 μm, detected by the secretion of cytokines. After incubation of nucleic acid aptamers with co-stimulatory anti-CD28 antibodies at 37°C for 48 hours in RPMI medium containing 10% serum, the levels of secreted cytokines were detected by human Th1 / Th2 flow cytometer microsphere array (Cytometric Bead Array). Figure 16A shows the secretion of IL-2, IL-4, IL-5, IL-10 and TNF-α when cells were treated with CELTIC_1s, CELTIC_4s, CELTIC_11s or CELTIC_19s alone. Figure 16B shows the cytokine secretion profile of cells treated with the same nucleic acid aptamers mixed with co-stimulatory anti-CD28 antibodies. FIG. 16C shows the cytokine secretion profiles obtained after treating cells with fresh nucleic acid aptamer solution mixed with anti-CD28 antibody added to the culture medium after incubation for 3 h, 19 h, and 27 h to keep the reagent concentration constant.

[0052] Figures 17.1A-17.3B are bar graphs showing the expression of Figure 1) The results of binding of nucleic acid aptamers CELTIC_1s, CELTIC_4s, CELTIC_11s and CELTIC_19s and antibodies against CD3 epitopes to Jurkat cells (CD3 positive cells) were obtained to understand the region of CD3 recognized by nucleic acid aptamers. Binding was performed in the presence of saturating concentrations of competitors. In Figures 17.1A, 17.2A and 17.3A, the binding of PE-labeled CD3-specific monoclonal OKT3, UCHT1 and HIT3a antibodies was detected at one concentration (0.1 nM for OKT3 and HIT3a or 1 nM for UCHT1) and in the presence or absence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a or 10 nM for UCHT1) or biotinylated nucleic acid aptamers (300 nM). In Figures 17.1B, 17.2B and 17.3B, binding of biotinylated aptamers at a concentration of 300 nM was tested in the presence or absence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin.

[0053] Figure 17.4 is a bar graph showing the results corresponding to the SELEX( Figure 7C ) during the first 45 sequence families isolated during the binding results of nucleic acid aptamers CELTIC_core and Jurkat cells (CD3 positive cells). For comparison, the binding of nucleic acid aptamers to Ramos cells (CD3 negative cells; control) is also shown. Binding is detected at the following nucleic acid aptamer concentrations: 3nM, 5nM, 10nM, 20nM, 30nM, 40nM, 50nM, 75nM and 100nM. Anti-CD3OKT3 monoclonal antibody (32nM) is used as a positive control.

[0054] Figure 17.5 The sequences of different variants (1 to 13) of the nucleic acid aptamer CELTIC_core (sequence at the top, SEQ ID NO: 57) are listed (SEQ ID NO: 58-71, respectively), corresponding to the computationally conserved motifs found in the top 45 sequence families isolated during SELEX ( Figure 7C ). The underline indicates the position in the sequence where the base was replaced by the C3 spacer, thus forming an abasic site. The mutation introduced in the original core sequence is highlighted in bold.

[0055] Figures 17.6A-17.6N are bar graphs showing the relationship between CELTIC_core( Figure 17.5) compared to the binding of modified aptamers CELTIC_core1, CELTIC_core2, CELTIC_core3, CELTIC_core4, CELTIC_core5, CELTIC_core6, CELTIC_core7, CELTIC_core8, CELTIC_core9, CELTIC_core10, CELTIC_core11, CELTIC_core12, CELTIC_core13 and CELTIC_coreT to Jurkat. Binding was detected at two aptamer concentrations (50nM and 100nM) and compared with cell staining obtained using CELTIC_core (50 and 100nM) and full-length CD3_CELTIC_1s (10 and 50nM). For comparison, the binding of aptamers to Ramos cells (CD3 negative cells; control) is also shown. Anti-CD3 OKT3 monoclonal antibody (32nM) was used as a positive control.

[0056] Fig.18 Different variants of nucleic acid aptamer CELTIC_core ("0", SEQ ID NO: 57) are listed (1 to 44, SEQ ID NO: 58-102, including Figure 17.5 17.6A to 17.6N) corresponding to the computationally conserved motifs found in the top 45 sequence families obtained during SELEX ( Figure 7C ). Underlining refers to the position in the sequence where the base has been replaced by the C3 spacer, thus creating an abasic site. The mutation introduced in the original core sequence is highlighted in bold.

[0057] 19A-19D are bar graphs showing the relationship between CELTIC_core( Figure 17.5) compared to the results of the binding of modified aptamers CELTIC_core14 to CELTIC_core44 to Jurkat cells (CD3 positive cells). The binding was detected at two aptamer concentrations of 50nM (Figure 19.A for mutants 14 to 37; Figure 19.C for mutants 38 to 44) and 100nM (Figure 19.B for mutants 14 to 37; Figure 19.D for mutants 38 to 44), and compared with the cell staining obtained using CELTIC_core (50 and 100nM) and full-length CD3_CELTIC_1s and CD3_CELTIC_19s (10 and 50nM). For comparison, the binding of aptamers to Ramos cells (CD3 negative cells; control) is also shown. Anti-CD3 OKT3 and anti-CD19 monoclonal antibodies (each 32nM) are used as positive controls.

[0058] Fig. 20 Summarizes the nucleic acid aptamer CELTIC_core (SEQ ID NO: 57) ( Figure 17.5 ), compared with the results of binding of nucleic acid aptamers CELTIC_core 1 to CELTIC_core 44 (SEQ ID NO: 58-102) carrying the above modifications to Jurkat cells (CD3 positive cells).

[0059] Figures 21A-21F are bar graphs showing the binding results of nucleic acid aptamers CELTIC_core 12, CELTIC_core40HEGt, CELTIC_core 42HEGt to Jurkat cells (CD3 positive cells) and CD3 epitope-specific antibodies in the presence of saturating concentrations of competitors to understand the CD3 region recognized by nucleic acid aptamers. Figures 21A, 21C and 21E, in the presence or absence of saturating concentrations of unlabeled antibodies (32nM and 10nM for OKT3 and HIT3a, respectively) or biotinylated nucleic acid aptamers (300nM), tested the binding of PE-labeled monoclonal OKT3, UCHT1 and HIT3a antibodies to CD3 at a single concentration (0.1nM for OKT3 and HIT3a, 1nM for UCHT1). Figures 21.B, 21.D and 21.F, Binding of biotinylated aptamers at a concentration of 300 nM was tested in the presence or absence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) and in the presence of PE-labeled streptavidin. The results were compared to cell staining obtained with full-length CD3_CELTIC_1s.

[0060] Figures 22A-22F show the stability of nucleic acid aptamers CELTIC_core HEG (Figure 22A), CELTIC_core12 (Figure 22B), CELTIC_core 24HEG (Figure 22C), CELTIC_core 29HEG (Figure 22D), CELTIC_core 40HEG (Figure 22E) and CELTIC_core 42HEG (Figure 22F) in the presence of serum. After the nucleic acid aptamers were incubated at 37°C for different times (24h, 4h, 2h, 1h, 30min, 10min or 0h) in serum, SELEX buffer containing 5% serum or RPMI medium containing 10% serum, the integrity of the nucleic acid aptamers was detected by agarose gel electrophoresis.

[0061] 23A-C are bar graphs showing the expression of nucleic acid aptamers CELTIC_core HEG, CELTIC_core 12 ( FIG. 23A ), CELTIC_core 24HEG, CELTIC_core 29HEG ( FIG. 23B ), CELTIC_core 40HEG, and CELTIC_core 42HEG in the presence of serum. Fig.23C ) stability. The aptamers were incubated in serum or SELEX buffer containing 5% serum at 37°C for different time periods (24h, 4h, 2h, 1h, 0.5h, 10min or 0h) to detect stability, and then the binding of the aptamers to Jurkat cells (CD3 positive cells) was detected by flow cytometry. Anti-CD3 OKT3 monoclonal antibody (32nM) was used as a positive control.

[0062] Figure 24A-D The stability of nucleic acid aptamers CELTIC_core 40HEG (FIG. 24A), CELTIC_core40HEGt (FIG. 24B), CELTIC_core 42HEG (FIG. 24C) and CELTIC_core42HEGt (FIG. 24D) in the presence of serum is shown. After the nucleic acid aptamers were incubated in serum, SELEX buffer containing 5% serum or RPMI medium containing 10% serum at 37°C for different times (24h, 4h, 2h, 1h, 30min, 10min or 0h), the integrity of the nucleic acid aptamers was detected by agarose gel electrophoresis.

[0063] Figure 25A-25B is a bar graph showing the stability of nucleic acid aptamers CELTIC_core40HEG, CELTIC_core 40HEGt (Figure 25A), CELTIC_core 42HEG and CELTIC_core42HEGt (Figure 25B) in the presence of serum. The nucleic acid aptamers were incubated at 37°C for different times (24h, 4h, 2h, 1h, 0.5h, 10min or 0h) in serum or SELEX buffer containing 5% serum to detect stability, and then the combination of nucleic acid aptamers and Jurkat cells (CD3 positive cells) was detected by flow cytometry. Anti-CD3 OKT3 monoclonal antibody (32nM) was used as a positive control.

[0064] Fig.26 It is a bar graph, which shows the result of binding of chemically modified aptamer CELTIC_core42HEG (5' end is tetrazine group, 3' end is biotin) with Jurkat cells (CD3 positive cells) at the end. Binding was detected at the following aptamer concentrations: 15nM, 25nM, 35nM, 50nM and 75nM, and compared with the cell staining obtained by biotin-modified aptamer CELTIC_core42HEG at 3' or 5' end. For comparison, the binding of aptamers to Ramos cells (CD3 negative cells; control) is also shown. Anti-CD3 OKT3 and anti-CD19 monoclonal antibodies (each 32nM) are used as positive controls.

[0065] Fig. 27 The comparison of the nucleic acid sequences (SEQ ID NO: 103-107, from top to bottom) of the five most common anti-CD3 RNA aptamers (Cluster) obtained by SELEX on a mixture of recombinant CD3ε / γ and CD3ε / δ proteins is shown, each protein prepared as a C-terminal Fc fusion. hIgG1 Fc was used as the reverse target. The last three rounds of SELEX were targeted with Jurkat (CD3 positive) cells and Ramos (CD3 negative) cells as the reverse target. Multiple sequence alignment was performed using the ClustalW algorithm. Conserved nucleotides found in each Cluster are marked with *.

[0066] Fig.28 The core sequence (SEQ ID NO: 108) obtained in the first 5 clusters obtained by the SELEX program and the base distribution confirmed by MEME (Multiple Em for Motif Elicitation) are shown. Fig. 27 ).

[0067] Figures 29A-29B show the sequences of ARACD3-0010209 (SEQ ID NO: 103), ARACD3-0270039 (SEQ ID NO: 105), ARACD3-2980001 (SEQ ID NO: 104), ARACD3-3130001 (SEQ ID NO: 106) and ARACD3-3700006 (SEQ ID NO: 107) and the secondary structures predicted by Mfold. The numbers indicate the base numbers of the aptamers lacking the nucleotides in the flanking regions. It also describes the secondary structures of the core sequences found in the 5 Clusters obtained by SELEX. The secondary structures of the core sequences were obtained by SELEX at 37°C, 1M Na + The secondary structure and free energy of each aptamer were calculated by Quikfold 3.0 (Zuker et al., 2003).

[0068] 30A-30E are bar graphs showing the Fig. 27 ) obtained by combining the aptamers ARACD3-0010209, ARACD3-0270039, ARACD3-2980001, ARACD3-3130001 and ARACD3-3700006 with Jurkat cells (CD3 positive cells). For comparison, the combination of aptamers and Ramos cells (CD3 negative cells; control) is also shown. The combination is detected at three aptamer concentrations of 30nM, 100nM and 300nM.

[0069] Figures 31A-31C show the sensorgrams of the results of the biotinylated aptamers ARACD3-3700006, ARACD3-0010209, and ARACD3-3130001 binding to CD3ε / γ (left column), CD3ε / δ (middle column) and control hIgG1 Fc (right column) fixed on the Series Sensor SAChip. The binding was detected by surface plasmon resonance using a single cycle kinetic scheme. Continuous loading of aptamers was performed at concentrations of 3nM, 10nM, 30nM, 100nM and 300nM.

[0070] Figure 32A-32C shows the stability and integrity of anti-CD3 RNA aptamers ARACD3-3700006 and ARACD3-0010209 in the presence of serum. Figure 32A (bar graph) shows that the aptamers were incubated at 37°C for different times (24h, 4h, 2h, 1h, 30min, 10min or 0h) in serum or DPBS medium containing 5% serum to detect stability, and then the binding of the aptamers to Jurkat cells (CD3 positive cells) was detected by flow cytometry. Figure 32B-C shows the integrity of the aptamers detected by agarose gel electrophoresis after incubating the aptamers in serum, DPBS buffer containing 5% serum or RPMI medium containing 10% serum at 37°C for different times (24 hours, 4 hours, 2 hours, 1 hour, 30 minutes, 10 minutes or 0 hours).

[0071] Fig.33 The SELEX program ( Fig. 27 ) The binding results of the aptamers ARACD3-3700006 and ARACD3-0010209 obtained with peripheral blood mononuclear cells isolated from healthy donors. The binding was tested at the following aptamer concentrations: 3nM, 10nM, 30nM, 100nM and 300nM.

[0072] 34A-34B are bar graphs showing the Fig. 27 ) The obtained nucleic acid aptamers ARACD3-3700006 and ARACD3-0010209 were bound to mouse CD3-positive EL4 cells to estimate the binding saturation and K D Results. Binding was detected at the following aptamer concentrations: 3nM, 10nM, 30nM, 100nM and 300nM. For comparison, binding of aptamers at 300nM concentration to human Jurkat cells is also shown.

[0073] Figure 35A-35F is a curve diagram, which shows the activation of lymphocytes by anti-CD3 RNA aptamers at a concentration of 1 μm, detected by the secretion of cytokines. In RPMI culture medium containing 10% serum, in the presence of costimulatory anti-CD28 antibodies, the nucleic acid aptamers were incubated at 37 ° C for different time periods (0h, 16h, 24h or 48h), and the level of secreted cytokines was detected by ELISA. Figures 35A, 35B and 35C respectively show the secretion of IFN-γ, IL-2 and TNF-α after being treated by nucleic acid aptamer ARACD3-3700006. Figures 35D, 35E and 35F respectively show the secretion of IFNγ, IL-2 and TNF-α after being treated by nucleic acid aptamer ARACD3-0010209. For comparison, the activation of anti-CD3 monoclonal antibodies in the presence or absence of costimulatory anti-CD28 antibodies is also shown.

[0074] Figures 36A-36C are bar graphs showing the activation of human lymphocytes by anti-CD3 RNA aptamers at a concentration of 1 μm, detected by the expression of CD25 and CD69 activation markers. After incubation of the nucleic acid aptamers at 37°C for 48 hours in RPMI medium containing 10% serum, in the presence or absence of co-stimulatory anti-CD28 antibodies, the levels of CD25 and CD69 surface markers on CD4 and CD8 positive T lymphocytes were detected by flow cytometry. Figure 36A shows the expression results obtained with only ARACD3-3700006 or ARACD3-0010209. Figure 36B shows the expression results obtained after the cells were treated with the same nucleic acid aptamer mixed with co-stimulatory anti-CD28 antibodies. Figure 36C shows the expression results obtained after the cells were treated with fresh nucleic acid aptamer solutions mixed with anti-CD28 antibodies after 3h, 19h and 27h of culture to keep the reagent concentration constant.

[0075] Figures 37A-37C are bar graphs showing the activation of human lymphocytes by anti-CD3 RNA aptamers at a concentration of 1 μm, detected by the secretion of cytokines. In RPMI medium containing 10% serum, in the presence of co-stimulatory anti-CD28 antibodies, after incubation of nucleic acid aptamers at 37 ° C for 48 h, secreted cytokine levels were detected using human Th1 / Th2 flow cytometry microsphere arrays. Figure 37A shows the secretion of IFN-γ, IL-2, IL-4, IL-5, IL-10 and TNF-α by cells treated with ARACD3-3700006 or ARACD3-0010209 alone. Figure 37B shows the cytokine secretion profile of cells treated with the same nucleic acid aptamers mixed with co-stimulatory anti-CD28 antibodies. Figure 37C shows the cytokine secretion profile obtained after the cells were treated with the same nucleic acid aptamers mixed with co-stimulatory anti-CD28 antibodies after 3 h, 19 h and 27 h of culture, and the fresh nucleic acid aptamer solution was mixed with anti-CD28 antibodies and added to the culture medium to keep the reagent concentration constant.

[0076] 38A-38F are bar graphs showing the expression of Fig. 27 ) The results of binding of nucleic acid aptamers ARACD3-3700006 and ARACD3-0010209 to Jurkat cells (CD3 positive cells) and antibodies specific to CD3 epitopes in the presence of saturating concentrations of competitors in order to understand the region of CD3 recognized by nucleic acid aptamers. In Figures 38A, 38C and 38E, the binding of PE-labeled CD3-specific monoclonal OKT3, UCHT1 and HIT3a antibodies was detected at one concentration (0.1 nM for OKT3 and HIT3a, 1 nM for UCHT1), in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1) or biotinylated nucleic acid aptamers (300 nM). In Figures 38B, 38D and 38F, binding of biotinylated aptamers at a concentration of 300 nM was tested in the absence or presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a, 10 nM for UCHT1), and in the presence of PE-labeled streptavidin. DETAILED DESCRIPTION

[0077] The present technology relates to anti-CD3 nucleic acid aptamers, and discloses a method for isolating CD3-specific nucleic acid aptamers, as well as various uses of anti-CD3 nucleic acid aptamers, including as a targeting portion of a delivery vehicle for a therapeutic agent targeting T cells and as a component of a pharmaceutical composition.

[0078] The embodiments of the anti-CD3 nucleic acid aptamers of the present technology can be described using several consensus sequences. DNA aptamers may include the following consensus sequences or variants thereof:

[0079] 1.GX1X2TX3GX4X5X6X7X8X9GGX 10 CTGG, wherein X1 is G or A; X2 and X6 are A, T or G; X3 is T or G; X4 and X9 are G or C; X5 is C or T; X7 is T, G or C; X8 and X9 are G or C; 10 is C, T or A (SEQ ID NO: 109).

[0080] 2. GGGX1TTGGCX2X3X4GGGX5CTGGC wherein X1 and X2 are A, T or G; X3 is T, C or G; X4 and X5 are A, T or C (SEQ ID NO: 110).

[0081] 3. GX1TTX2GX3X4X5X6CX7GGX8CTGGX9G, wherein X1 is A or G; X2 is T or G; X3, X7 and X9 are G or C; X4 is T or C; X5 is A or T; X6 is T, C or G; X8 is A or C (SEQ ID NO: 111).

[0082] 4. GGGTTTGGCAX1CGGGCCTGGCG, wherein X1 is G, C or T (SEQ ID NO: 112).

[0083] 5. GCAGCGAUUCUX1GUUU wherein X1 is U or abase (SEQ ID NO: 113).

[0084] Nucleic acid aptamers are DNA and RNA oligonucleotides with secondary and tertiary structures, which can be given high affinity to target molecules and specifically bind to target molecules. It is known to use molecular capture technology to produce nucleic acid aptamers (see AD Ellington and JW Sostak. Nature 346: 818-822, 1990; and C. Tuerk and L. Gold. Science 249: 505-510, 1990). Nucleic acid aptamers can be used as targeting devices to deliver molecular preparations to specific target sites. Some tumors are associated with specific antigens, and based on these antigens, tumor binding nucleic acid aptamers can be designed to assist in tumor targeting for diagnosis or treatment purposes.

[0085] Typically, known methods can be used to identify and separate nucleic acid aptamers from a nucleic acid sequence library. The nucleic acid sequence library is incubated with the target molecule, the oligonucleotide after binding is selected, and amplified in the next step, for example, by polymerase chain reaction (PCR). The affinity column composed of the target molecule is used to further purify the product. The nucleic acid aptamer can include DNA, RNA or PNA, and the base can be natural or non-natural. Natural bases include adenine (A), guanine (G), cytosine (C), thymine (T), inosine (I) and uracil (U). Non-natural bases include, for example, methylinosine, dihydrouridine, methylguanosine, thiouridine, 2'-O-methylpurine, 2'-fluoropyrimidine and many other bases known to those of ordinary skill in the art. PNA bases can include natural or non-natural bases connected to amides (peptide-like backbones). The backbone of the nucleic acid sequence can be an amide as in PNA, or a phosphodiester, phosphorothioate, phosphorothioate, methylene phosphorothioate as in DNA or RNA, or modifications of these chemical structures.

[0086] The nucleic acid sequence of the nucleic acid aptamer may only contain a target binding sequence, and the target binding sequence may include a constant region and a variable region or only include a variable region. The constant region sequence can be used to promote the binding, amplification, replication or cleavage of the target binding sequence.

[0087] Nucleic acid aptamers can be coupled to agents delivered to a target or target site for various purposes, such as detection, imaging, diagnosis, treatment or prevention. The agents include cells, nanoparticles, hormones, vaccines, haptens, toxins, enzymes, immune system modulators, antioxidants, vitamins, functional agents of the hematopoietic system, proteins (such as streptavidin or avidin or their mutations), metals and other inorganic substances, viral particles, antigens (such as amino acids), peptides, sugars and polysaccharides, receptors, paramagnetic and fluorescent labels, pharmaceutical compounds, radioactive isotopes and radionuclides (such as 93P, 95mTc, 99Tm, 186Re, 188Re, 189Re, 111In, 14C, 38).

[0088] Drug compounds that can be coupled to nucleic acid aptamers include, for example, conventional chemotherapeutic drugs, antibiotics, corticosteroids, mutagens (eg, nitroureas), antimetabolites, and hormone antagonists.

[0089] Macromolecules that can be coupled to nucleic acid aptamers include mitogens, cytokines, and growth factors. Potentially useful cytokines include tumor necrosis factor (TNF), interleukins (IL-1, IL-2, IL-3, etc.), interferon proteins, INFN-α, INF-β, and IFN-M, hormones (including glucocorticoids), cytarabine, and antiviral drugs (such as acyclovir and ganciclovir).

[0090] Well-known methods, including chemical and biotechnology, can be used to couple nucleic acid aptamers to reagents, which can generate covalent bonds and non-covalent bonds (C.-PD Tu et al., Gene 10: 177-83, 1980; AS Boutorine et al., Anal. Biochem. Bioconj. Chem. 1: 350-56, 1990; SL Commerford Biochem, 10: 1993-99, 1971; DJ Hnatowich et al., J. Nucl. Med. 36: 2306-14, 1995). Covalent bonds can be formed using, for example, chemical conjugation reactions, chelating agents or bonds formed by phosphodiester bonds. Non-covalent bonds include molecular interactions, such as the interaction between streptavidin and biotin, hydrogen bonds and other forms of ionic interactions. Exemplary chelators include DTPA, SHNH and multidentate chelators (such as N2S2 and N3S) (AR Fritzberg et al., J. Nucl. Med. 23: 592-98, 1982). Aptamers can also be bound to cell surfaces or nanoparticles to guide cells or nanoparticles to specific locations in vitro or in vivo.

[0091] Nucleic acid aptamers are selected using a method called ligand selection evolution by exponential enrichment (SELEX) (Ellington et al., 1990; Tuerk et al., 1990). SELEX is a method for screening very large oligonucleotide combinatorial libraries through an iterative process of in vitro selection and amplification. The method includes selection from a mixture of candidates and stepwise iterative structural improvements, using the same general selection theme to achieve almost any desired binding affinity and selectivity criteria. Starting with a mixture of nucleic acids, preferably including fragments of random sequences, the method includes the following steps: contacting the mixture with the target under conditions that are conducive to binding, partitioning (i.e., separating) unbound nucleic acids from those nucleic acids that have bound to the target molecule, dissociating nucleic acid-target pairs, amplifying nucleic acids dissociated from nucleic acid-target pairs to produce a ligand-rich nucleic acid mixture, and then repeating the steps of binding, separation, dissociation and amplification, the number of cycles being determined as needed.

[0092] SELEX is based on the understanding that in a nucleic acid mixture containing a large number of possible sequences and structures, there is a wide range of binding affinities for a given target. A nucleic acid mixture containing, for example, a 20-nucleotide random fragment can have 420 candidate possibilities. Those random fragments with higher affinity constants for the target are most likely to bind. After separation, dissociation and amplification, a second nucleic acid mixture is produced to enrich the candidates with higher binding affinity. Additional rounds of selection gradually favor the best ligand until the resulting nucleic acid mixture is mainly composed of only one or a few sequences. It can then be cloned, sequenced, and tested separately for its binding affinity as a pure ligand.

[0093] The selection and amplification cycles are repeated until the desired target is reached. In the most common case, selection / amplification is continued until the binding strength is not significantly improved after repeating the cycle. The iterative selection / amplification method is sensitive enough to separate a single sequence variant in a mixture containing at least 65,000 sequence variants. The method can even be used to isolate a single sequence variant in a mixture containing 10 14 In principle, this method can be used to isolate a small number of high-affinity sequences from a mixture of about 10 18 The nucleic acids of the test mixture preferably include random sequence portions as well as conserved sequences required for efficient amplification. Nucleic acid sequence variants can be generated in a variety of ways, including synthesis of random nucleic acid sequences and sequence size selection from randomly cut cellular nucleic acids. The variable sequence portion can contain completely or partially random sequence; it can also contain sub-portions of conserved sequence combined with random sequence. Sequence variation in the test nucleic acid can be introduced or increased by mutagenesis before or during selection / amplification iterations.

[0094] In many cases, it is not necessary to repeat the SELEX steps until a single nucleic acid ligand is identified. The target-specific nucleic acid ligand solution can include a family of nucleic acid structures or motifs, which have many conserved sequences and many sequences that can be substituted or added without significantly affecting the affinity of the nucleic acid ligand to the target. By terminating the SELEX process before completion, the sequences of many members of the family of nucleic acid ligand solutions can be determined, thereby determining a comprehensive description of the nucleic acid ligand solution.

[0095] After SELEX has resolved the description of the nucleic acid ligand family, in some cases, it may be necessary to specifically conduct a further series of SELEX analyses based on the information received during the SELEX experiment. For example, in the second series of SELEX, the conserved regions of the nucleic acid ligand family can be fixed, while all other positions in the ligand structure are random. In alternative embodiments, the sequences of the most representative members of the nucleic acid ligand family can be used as the basis of the SELEX method, in which the original nucleic acid sequence library is not completely random, but is biased towards containing the most common ligands. Through these methods, the SELEX process can be optimized to obtain the most preferred nucleic acid ligands.

[0096] The nucleic acid aptamer of the present invention can have any desired length. The nucleic acid aptamer can include at least about 15 oligonucleotides. Preferably, the nucleic acid aptamer can include up to about 80 nucleotides.

[0097] Modern techniques allow the identification or generation of products with any desired equilibrium constant (K D In some embodiments, the equilibrium constant (K D ) include about 1 pM to about 10.0 μM; about 1 pM to about 1.0 μM; about 1 pM to about 100 nM; about 100 pM to about 10.0 μM; about 100 pM to about 1.0 μM; about 100 pM to about 100 nM; or about 1.0 nM to about 10.0 μM; about 1.0 nM to about 1.0 μM; about 1 nM to about 200 nM; about 1.0 nM to about 100 nM; about 500 nM to about 10.0 μM; or about 500 nM to about 1.0 μM.

[0098] The target molecule may include a small molecule, a protein or a nucleic acid. For the nucleic acid aptamers described herein, the target molecule is CD3ε / γ and / or CD3ε / δ protein.

[0099] The nucleic acid aptamer of the present invention can be used in a pharmaceutical composition.

[0100] definition

[0101] Nucleic acid refers to single-stranded or double-stranded DNA, RNA, XNA and any chemical modifications thereof.

[0102] Nucleic acid aptamers (or ligands) refer to nucleic acids that bind to another molecule (target). In a candidate nucleic acid population, the binding affinity of the nucleic acid aptamers is greater than the binding affinity of the population. In multiple candidate nucleic acid aptamer sequences, more than one nucleic acid aptamer may exist for a given target. The binding affinity of the nucleic acid aptamers to the target molecule may be different from each other.

[0103] Variants of nucleic acid sequences, such as aptamer sequences, can include sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% sequence identity (as determined by a sequence identity algorithm, such as the BLAST algorithm). Variants can also include substitution of one or more bases with non-naturally occurring bases, or deletion of one or more bases, optionally substitution of nucleotides with linkers or bonds. Variants can also include modified nucleic acid backbones, such as those found in peptide nucleic acids (PNAs).

[0104] Multiple candidate nucleic acid aptamer sequences are multiple nucleic acids with different sequences, from which the desired nucleic acid aptamer can be selected. The source of the candidate sequence can be from naturally occurring nucleic acids or fragments thereof, chemically synthesized nucleic acids, enzymatically synthesized nucleic acids, or nucleic acids prepared by a combination of the foregoing techniques.

[0105] The target molecule refers to any compound of interest that requires a ligand. The target molecule can be a protein, peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc., without limitation. The target can also be a cell expressing the desired protein, and the desired aptamer specifically binds to it. Using cells to select aptamers can be called cell-SELEX (Chen C et al., npj Precision Oncology (2017) 1-37). Cell-SELEX targets living cells. Aptamers bind to living cell membrane proteins. The procedure of cell-SELEX includes positive selection and negative selection. For positive selection, a single-stranded DNA or RNA library is incubated with target cells, and the bound sequences are collected. The bound sequences are cultured with negative cells, and the unbound sequences are collected for amplification, sequencing and cloning. After several alternating cycles, aptamers are obtained. The present disclosure includes selecting anti-CD3 aptamers by binding to living cells as targets. CD3-positive Jurkat cells and CD3-negative Ramos cells were used for positive and negative selection, respectively.

[0106] Separation (or partitioning) refers to any process by which a ligand bound to a target molecule (referred to herein as an aptamer-target pair or sequence-target complex) can be separated from nucleic acids that are not bound to the target molecule. Separation can be accomplished by various methods known in the art. Nucleic acid-protein pairs can be bound to nitrocellulose filters, while unbound nucleic acids cannot bind. Columns that specifically retain sequence-target complexes (or specifically retain bound aptamers complexed with attached targets) can be used for separation. Liquid-liquid separations as well as filtration gel retardation and density gradient centrifugation can also be used. The choice of separation method will depend on the properties of the target and sequence-target complex, and can be performed according to principles and properties known to those of ordinary skill in the art.

[0107] Amplification refers to any process or combination of process steps that increases the number of copies or copy numbers of a molecule or class of molecules. In the embodiments disclosed herein, the amplification of RNA molecules is performed by sequences that are contained in three reactions: preparing cDNA copies of the selected RNA, using polymerase chain reaction to increase the number of copies of each cDNA, and transcribing the cDNA copies to obtain RNA molecules with the same sequence as the selected RNA. It will be appreciated by those skilled in the art that any reaction or combination of reactions known in the art can be appropriately used, including direct DNA replication, direct RNA amplification, etc. The amplification method should be such that the ratio of the amplified mixture substantially represents the ratio of the different sequences in the initial mixture.

[0108] "Random" is a term used to describe nucleic acid fragments that can have any possible sequence in principle over a given length. Random sequences will have various lengths, ranging from about 8 to more than 100 nucleotides, as desired. Chemical or enzymatic reactions that generate random sequence fragments may not produce mathematically random sequences because of the possibility of unknown biases or nucleotide preferences. The term "random" is used instead of "random" to reflect the possibility of such deviations from ideality. In currently known techniques, such as sequential chemical synthesis, there are no large biases. For short fragments of 20 nucleotides or less, any small bias that may exist will have negligible consequences. The longer the sequence synthesized in a single run, the greater the impact of any bias.

[0109] Bias can be intentionally introduced into a random sequence, for example, by changing the molar ratio of the precursor nucleoside (or deoxynucleoside) triphosphates of the synthesis reaction. Intentional bias may be required, for example, to make the base ratio close to the ratio of each base in a given organism, to affect the sequence secondary structure, or to affect the sequence melting pH or pH sensitivity. A sequence may prefer to contain a higher percentage of AT than CG base pairs, thereby reducing its melting pH.

[0110] Example

[0111] Example 1: Anti-CD3 DNA aptamers

[0112] Libraries and primers

[0113] Single-stranded DNA (ssDNA) library designed for the selection of DNA aptamers was purchased from TriLink Biotechnologies. The library is composed of a 40-nucleotide random region (N40), with two constant regions on both sides: 5'-TAGGGAAGAGAAGGACATATGAT-(N40)-TTGACTAGTACAT GACCACTTGA-3' (SEQ ID NO: 114), as the template for PCR amplification. The primer sequences of PCR reaction are: 5'-TAGGGAAGAGAAGGACATATGAT-3' (SEQ ID NO: 115) (forward primer) and 5' biotin-TCAAGTGGTCATGTACTAGTCAA-3' (SEQ ID NO: 116) (reverse primer). In the process of selection, according to the manufacturer's scheme, the library is amplified using AmpliTaq Gold 360 polymerase kit (Applied Biosystems) in Eppendorf Mastercycler Nexus. The following conditions were used: polymerase activation, initial denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 45°C for 30 s (increment of 0.2°C per PCR cycle), extension at 72°C for 1.5 min, and final extension at 72°C for 7 min. ssDNA libraries were generated by sequential selection of amplified double-stranded DNA (dsDNA) using streptavidin-coupled magnetic beads with a reverse primer modified with biotin at the 5' end. Both primers were HPLC grade purified primers purchased from Eurogentec.

[0114] Selection of aptamers

[0115] The SELEX process consisted of six rounds of selection and was performed on recombinant CD3 protein ε chains composed of CD3ε / γ (CD3ε / γ) and CD3ε / δ (CD3ε / δ) dimers purchased as C-terminal fusions with a constant human immunoglobulin G1 Fc domain. Therefore, the Fc fragment of human immunoglobulin G1 (IgG1Fc) was used for negative selection. All proteins were purchased from AcroBiosystems. Each round of selection included the following steps: counter-selection, incubation of the ssDNA library with the target, PCR amplification of the sequence that recognizes the target, and separation of dsDNA on streptavidin-modified magnetic beads. Before each cycle, the ssDNA library (initial cycle 2.5 nmol) was denatured at 95°C for 5 min and then immediately cooled at 4°C in a selection (SELEX) buffer (20 mM HEPES, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2 and 1.5 mM CaCl2, pH 7.2, free of DNase and RNase, purchased from Sigma-Aldrich) for 5 min. To eliminate Fc domain-specific sequences, the ssDNA library was incubated with IgG1-Fc protein (0.5 nmol, 1 μM) at 37°C for 90 min in a thermal cycler (Eppendorf Mastercycler Nexus). The reaction mixture was then filtered through a nitrocellulose acetate membrane (0.45 micron HAWP membrane, 25 mm diameter, Millipore), the membrane was inserted into a 25 mm diameter support filter holder of Millipore, and washed with selection buffer. Before filtering, the HAWP membrane was soaked in the selection buffer for at least 30 min. After filtration, the membranes attached with IgG1-Fc / ssDNA complexes and nonspecific ssDNA sequences bound to the filter were discarded. The filtrate containing unbound sequences was concentrated using a 10kDa AMICON Ultra-15 MWCO filter and then incubated with the positive target. In the first cycle, nucleic acid aptamers were selected against recombinant CD3ε / γ (0.15nmol, 0.3μM) and CD3ε / δ (0.15nmol, 0.3μM) domains, and the aptamers were run in a thermal cycler at a volume of 500μL for 120 minutes at 37°C. Starting from the second round, CD3ε / γ and CD3ε / δ were used alternately in each cycle. The reaction mixture was then filtered through a nitrocellulose acetate membrane. The filter was washed with 8mL of selection buffer to remove all low affinity and low specificity sequences attached to the protein. The ssDNA bound to the protein retained on the filter was eluted by incubating the membrane in 1mL 7M urea at 75°C for 5min (twice).The recovered ssDNA solution was diluted twice in DNase- and RNase-free water (Invitrogen) and concentrated using a 10 kDa AMICON Ultra-4 MWCO filter. The sequence was rediluted in water and reconcentrated. The resulting solution was purified on a Micro Bio-Spin P-6 column (in SSC buffer, Bio-Rad) and precipitated in ethanol (HPLC grade, Fisher) and sodium acetate (ThermoScientific, Waltham, Massachusetts, USA) at pH 5.2 in the presence of 5 μL linear polyacrylamide (Invitrogen). After incubation at -25°C for about 1 h, the eluted ssDNA was centrifuged at 21,000 g for 20 minutes at 4°C, the supernatant was discarded, and the pellet containing the ssDNA was diluted with 200 L of DNase- and RNase-free water and placed in air for 20 min to evaporate the ethanol. The selected ssDNA sequence was amplified in the presence of an unmodified forward primer and a biotinylated reverse primer in a PCR reactor (AmpliTaq Gold 360, Applied Biosystems). The optimal number of PCR cycles was selected for each round of selection. To this end, after the amplification process, the dsDNA samples obtained after multiple PCR cycles were migrated on an agarose gel (3% TBE buffer containing SYBRSafe, Invitrogen). The PCR reaction was stopped when a band corresponding to the dsDNA appeared on the agarose gel. The PCR mixture with the amplified dsDNA was then collected, diluted with water to a final volume of 15 mL and concentrated using a 10 kDa AMICON Ultra-15 MWCO membrane. The concentrated samples were stored at -20 °C in aliquots for sequencing analysis. In order to purify and generate ssDNA chains for the next round of selection, the remaining samples were bound to streptavidin-coated magnetic beads (MyOne Streptavidin Dynabeads) via the biotin present on the amplified dsDNA. According to the manufacturer's protocol, incubate for 18 min at room temperature in binding buffer (1 M NaCl, 5 mM Tris, 0.5 mM EDTA at pH 8.0, free of DNase and RNase, purchased from Sigma-Aldrich). 3 mg of magnetic beads were used for 20 μg of dsDNA. Then, the magnetic beads with dsDNA were separated from the solution and washed five times with binding buffer (twice the volume of binding buffer used for incubation) to eliminate any remaining non-specifically bound library species and PCR reaction residues. Separation of DNA strands was performed by denaturation under alkaline conditions and by incubating the modified beads in a 50 mM NaOH (BioUltra from Sigma-Aldrich) solution for 3 min.As a result, the biotinylated DNA strands remained attached to the magnetic beads, and the unmodified strand of interest was released into the solution and recovered. The obtained single-stranded DNA was then diluted in water to a final volume of 4 mL and concentrated using a 10 kDa AMICON Ultra-4 MWCO to remove NaOH. The exchange of the selection buffer was performed using a micro bio-spin column (P-6; BioRad). The quality of the recovered ssDNA library was analyzed by analyzing the migration of ssDNA on an agarose gel (3% TBE buffer), and its concentration was calculated by detecting the absorbance at 260 nm using NanoDrop One (ThermoScientific, Waltham, Massachusetts, USA).

[0116] During successive rounds of SELEX, the stringency of selection was gradually increased (see Table 1). For example, the concentrations of the target and ssDNA library were reduced, the incubation time with the protein was shortened, the volume of buffer used for membrane washing after selection was increased, and a nonspecific competitor (yeast total RNA, Sigma-Aldrich) was added for the last round of selection.

[0117] Table 1: SELEX conditions used for each round of DNA aptamer selection

[0118]

[0119]

[0120] The PCR aliquots obtained after each SELEX cycle and the initial ssDNA library were analyzed by next generation sequencing using the Illumina NextSeq MidOutput (150 cycles) system. The analysis was performed at the New York University Center for Genome Technology. The data from high-throughput sequencing was analyzed using the Galaxyproject website. Based on the sequencing results, aptamer candidates were selected for affinity and specificity testing.

[0121] The nucleic acid sequences of these aptamers are Figure 1 , 6 7A-7B. DNA aptamers were obtained from Eurogentec Kaneka (Liege, Belgium) with or without flanking regions for PCR amplification as HPLC-RP purified single-stranded oligonucleotides synthesized by standard solid phase phosphoramidite chemistry. Biotin was added to the 5' end of the aptamer as biotin-triethylene glycol (biotin-TEG), and a 16-atom mixed polarity spacer was introduced between the aptamer sequence and the biotin label. For all aptamers, the manufacturer verified their molecular weight, purity and integrity by HPLC-MS.

[0122] The same synthetic approach was followed to introduce mutations in the core sequence CELTIC_core, such as Figure 17.5 and Fig.18 As shown. During solid phase synthesis, abasic sites were created at different positions of the core sequence by adding a C3 spacer. When required, an additional hexaethylene glycol (HEG) linker was inserted between the 5' terminal modification functional group and the first nucleotide at the 5' position of the nucleic acid aptamer to minimize steric hindrance. Further modifications of the core sequence variants included the addition of 3'-3'-deoxythymidine as a strategy to enhance resistance to nuclease degradation.

[0123] Finally, the 5' end of the aptamer was functionalized with a primary amine via a C6 amino modifier added to the terminal phosphate. The tetrazine functional group was added to tetrazine-PEG5-NHS ester via standard NHS / EDC chemistry, introducing a 16-atom mixed polar spacer between the aptamer sequence and the tetrazine tag.

[0124] Example 2: Anti-CD3 RNA aptamers

[0125] Libraries and primers

[0126] The initial RNA library template and primers were synthesized by IDT (Coralville, Iowa City, USA) and designated as ssDNA: 5'-CCTCTCTATGGGCAGTCGGTGAT-(N20)-TTTCT GCAGCGATTCTTGTTT-(N10)-GGAGAATGAGGAACCCAGTGCAG-3' (SEQ ID NO: 117); 5'-TAATACGACTCACTATAGGGCCTCTCTATGGGCAGT CGGTGAT-3' (SEQ ID NO: 118) (forward primer); 5'-CTGCACTGGGTTCCTCAT TCTCC-3' (reverse primer) (SEQ ID NO: 119). Two short "blocking" sequences complementary to the 5'- and 3'-constant primer regions were synthesized (purchased from IDT) to minimize the effect of primers on secondary structure: 5'-ATCACCGACTGCCCATAGAGAGG-3' (SEQ ID NO: 120) (forward blocking sequence); 5'-CTGCACTGGGTTCCTCATTCTCC-3' (SEQ ID NO: 121) (reverse blocking sequence). Another biotinylated "capture" sequence complementary to the constant central region of the library was also synthesized by IDT: 5'-Biotin-GTC-PEG-6Spacer-CAAGAATCGCTGCAG-3' (SEQ ID NO: 122). All materials were ordered in the order of 250 nmole and purified by desalting.

[0127] The RNA library used for RNA aptamer selection was modified with 2'-fluoro-(2'-F-) pyrimidine to improve its stability in the final application. T7 primers were bound to the library template sequence and primer extension was performed using Taq DNA polymerase (Clontech, Mountain View, CA, USA). Primer extension material was transcribed using the T7 transcription kit (Epicentre, Madison, WI, USA) and purified on denaturing polyacrylamide using 8 M urea (Sequel NE reagent, parts A and B) purchased from American Bioanalytical (Natick, MA, USA). During selection, libraries were reverse transcribed using SuperScript IV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol and amplified using Titanium Taq DNA polymerase from Clontech. During selection, libraries were amplified using the following PCR protocol (95°C, 10 sec; 60°C, 30 sec; initial hot start activation at 95°C for 60 sec). They were then amplified using The RNA library was transcribed using the T7 transcription kit and purified on polyacrylamide gel (PAGE). The gel elution buffer used for library recovery after overnight purification at 4°C was prepared as 0.5M NH4OAc, 1mM EDTA (all purchased from Teknova), 0.2% SDS (purchased from Amresco), pH 7.4.

[0128] Selection of RNA aptamers

[0129] RNA library screening was performed using the melting-off approach in 9 rounds. Rounds 1-6 of selection were performed with the recombinant ε chain of the CD3 protein as the target and the IgG1 Fc fragment as the reverse target using the same materials as the selection of DNA aptamers. From round 7, Jurkat cells (human acute T-cell leukemia cell line-ATCC TIB-152) expressing CD3 protein and Ramos cells (human Burkitt's lymphoma cell line-ATCC CRL-1596) used for the negative selection step (cell-SELEX) were screened. The cell line was obtained from the American Type Cell Collection and cultured in RPMI-1640 medium (Gibco Invitrogen), supplemented with 10% FBS (Gibco Invitrogen) and 1% penicillin / streptomycin (Gibco Invitrogen). All selections were performed in 1X RPMI medium supplemented with 10% serum matrix, and each SELEX cycle included the following steps: immobilization of RNA library on streptavidin-coated magnetic beads, counter-selection, incubation with target, reverse transcription of target recognition sequence, PCR amplification and transcription into RNA. Before each round, streptavidin-coated magnetic beads (MyOne Streptavidin T1 Dynabeads) were washed with 200 μL PBS-T (final concentration of 0.01% Tween 20, pH 7.4) buffer. TM , usually per 20 μg Dynabead TMThe RNA library was pre-washed three times with 1 pmol of biotinylated material (the amount varied depending on the required stringency). The RNA library was renatured with primer blocking sequences and capture sequences twice the molar amount of the library in serum-free 1X RPMI medium (denaturation at 90°C for 1 minute, annealing at 60°C for 5 minutes, and 5 minutes at 23°C). This was done to minimize the effect of the constant primer region on the secondary structure of the aptamer, allowing the magnetic beads to capture the library through the streptavidin-biotin binding interaction and protecting the ends of the aptamer from the effects of exonucleases. After renaturation, the library was captured on the magnetic beads by incubation at room temperature for 15 minutes. The magnetic beads were then separated from the solution and washed three times with 200 μL of selection buffer at 37°C to eliminate any remaining PBS-T and non-specifically bound library species. The magnetic beads with the RNA library were incubated for 30 minutes at 37°C for counter-selection in 200 μL of the reverse target preparation to release non-specific sequences from the magnetic beads. Nonspecific library members were then discarded, and the beads were washed 6 times with 200 μL of selection buffer for 7 min. Positive selection consisted of incubating the magnetic bead RNA library at 37 ° C for 30 minutes with 200 μL of positive preparation. In the first cycle, nucleic acid aptamers were selected for recombinant CD3ε / γ domains and CD3ε / δ domains (0.1 μM each), and starting from the second round, CD3ε / γ domains and CD3ε / δ domains were used alternately. In the sixth round, the library was divided into two positive conditions (for CD3ε / γ or CD3ε / δ, respectively) before selection for cells to ensure that responses to both recombinant proteins could be observed. The sixth round of positive libraries were then pooled together during the recovery period and then cell selection was performed. For the cell-SELEX round, the target and anti-target cells were thawed, precipitated by centrifugation at 5000×g, and washed twice with selection buffer before being suspended with 200 μL of selection buffer. The number of cells used for incubation was 15×10 6 (for counter-selection) and 1×10 6 -15×10 6(For positive selection). After the positive selection is completed, the supernatant containing the sequence that can recognize the target is separated from the magnetic beads and recovered. The supernatant is then subjected to a second magnetic separation to ensure that the magnetic beads have been completely removed. For the cell-SELEX cycle, after the second magnetic separation, the targeted Jurkat cells are precipitated by centrifugation at 5000×g. The precipitated cells are washed once with 200 μL of selection buffer to remove low-affinity and low-specificity nucleic acid aptamer species. The library is recovered from the cells by heat denaturation at 70°C. The library recovered in each round was protein precipitated, ethanol precipitated, and sample concentrated using MPC reagent (Lucigen Corp, Millerton, Wisconsin, USA), and purified with 10% denatured polyacrylamide containing 8 M urea. The library was then reverse transcribed using SuperScript IV reverse transcriptase according to the manufacturer's instructions, using Taq DNA polymerase was used for amplification according to the manufacturer's instructions. Transcription was performed using a T7 transcription kit. The transcription product was then purified using 10% denaturing polyacrylamide gel electrophoresis (PAGE) containing 8 M urea. Gel slices were cut and eluted overnight in a gel elution buffer at 4°C. The RNA library concentration was calculated by measuring the absorbance at 260 nm using NanoDrop-1000.

[0130] During successive rounds of SELEX, the concentration of the RNA library was gradually reduced. Additional parallel evaluations and “cross-fitness tests” were performed to facilitate the identification of good aptamer candidates during bioinformatic analysis after selection was completed.

[0131] The aptamer candidates were selected by next generation sequencing using the MiniSeq Mid Output (150 cycles) system (Illumina). Several aptamers were selected for further testing. To this end, 2'-deoxy-2'-fluorothymidine modified RNA aptamers were purchased from Integrated DNA Technologies (IDT, Coralville, USA). Biotin was added to the 5' end of the aptamer as biotin-triethylene glycol (biotin-TEG), and a 16-atom mixed polarity spacer was introduced between the aptamer sequence and the biotin label. The molecular weight, purity and integrity were verified by HPLC-MS. The nucleic acid sequences of these aptamers are as follows Fig. 27 shown.

[0132] Example 3: Detection of affinity and specificity of anti-CD3 DNA aptamers for CD3 protein expressed on cells

[0133] Flow cytometry was used to evaluate the affinity and specificity of candidate DNA aptamers for CD3 protein expressed on cells. These studies were performed on CD3-positive Jurkat (human acute T-cell leukemia cell line - ATCC TIB-152), EL4 (lymphoma mouse cell line - ATCC CRL-2638), and CD3-negative Ramos (human Burkitt's lymphoma cell line - ATCC CRL-1596) cells by incubating them with biotinylated candidate nucleic acid aptamers in selection (SELEX) buffer supplemented with 5% FBS. Cells were cultured in RPMI-1640 medium (Gibco Invitrogen) supplemented with 10% FBS (Gibco Invitrogen) and 1% penicillin / streptomycin (Gibco Invitrogen) before use. Jurkat, EL4, and Ramos cells (2.5×10 5Cells / well) were inoculated into 96-well plates and centrifuged at 2500 rpm for 2 min. The supernatant was discarded and the precipitated cells were washed twice with 200 μL of SELEX-5% FBS buffer preheated at 37°C. After each wash, centrifugation was performed at 2500 rpm for 2 min. The candidate aptamers were denatured at 95°C for 5 min and then immediately placed on ice at 4°C for 5 min. The test samples were then diluted in two different concentration ranges: 3, 10, 30 nM and 1, 2.5, 5, 7.5, 10 nM, and 100 nM phycoerythrin-labeled streptavidin (Streptavidin-PE, eBioscience) was then added to each solution. For incubation with EL4 cells, the aptamers were also diluted to 100 and 300 nM. Jurkat, EL4, and Ramos cells were resuspended in DNA diluent (100 μL / well) and cultured for 30 min at 37°C in 5% CO2 humidified gas. As a control, the cells were incubated with CD3 monoclonal antibody (PE-labeled, OKT3 human anti-CD3, Invitrogen), PE-streptavidin or their respective buffers without other reagents. After incubation, the cells were centrifuged at 2500 rpm for 2 min, and the supernatant containing unbound sequences was discarded. The precipitated cells were washed with SELEX-5% FBS buffer (200 μL / well) and centrifuged twice to remove all weakly linked and non-specifically linked sequences. The cells were then washed with 1 mg / mL salmon sperm DNA solution (100 μL / well) at 37°C and 5% CO2 humidified gas. After 30 min, the salmon sperm solution was removed by centrifugation at 2500 rpm for 2 min, and the cells were washed twice with SELEX-5% buffer (200 μL / well) and then centrifuged. Jurkat, EL4 and Ramos cells with attached DNA sequences were then fixed (BD CellFIX solution #340181) and fluorescent positive cells in the YL-1 channel were counted by flow cytometry (AttuneNXT Invitrogen.).

[0134] Figure 2A-2EThe results of the binding studies are shown. Five aptamers were analyzed: CELTIC_1, CELTIC_1s, CELTIC_2, CELTIC_3, and CELTIC_21. CELTIC_1s differs from CELTIC_1 in that it lacks certain flanking region nucleotides. For comparison, the binding of aptamers to CD3-negative Ramos cells (human Burkitt's lymphoma cell line - ATCC CRL-1596) was also tested. All aptamers preferentially bound to CD3-positive cells. CELTIC_3 showed saturated binding at 10 nM, and it showed significant binding at 3 nM, with greater specificity. Based on these results, the apparent K of CELTIC_3 binding to Jurkat cells was D Between 3 nM and 10 nM. These aptamers were also tested at lower concentrations for binding to Jurkat cells, which confirmed that they preferentially bind to Jurkat cells. Figures 3A-3E In another cell binding assay, the binding of aptamers CELTIC_2, CELTIC_3, and CELTIC_21 to cells was compared with the binding of their shorter versions CELTIC_2s, CELTIC_3s, and CELTIC_21s to cells. When the flanking regions were removed, an increase in the specificity of the aptamers was observed, see Figures 5A-5F . In another cell binding assay, the binding of nucleic acid aptamers CELTIC_4s, CELTIC_5s, CELTIC_6s, CELTIC_9s, CELTIC_11s, CELTIC_19s and CELTIC_21s to cells was detected, showing that their specificity for Jurkat cells was higher than that for Ramos cells. The binding of nucleic acid aptamers at concentrations of 3nM, 10nM and 30nM was detected, see Figures 8A to 8G. Figures 9A and 9B show a comparison of the results of binding of all nucleic acid aptamers to Jurkat and Ramos cells at concentrations of 3nM and 10nM, respectively. In another cell binding assay, the binding of nucleic acid aptamers CELTIC_1s, CELTIC_4s, CELTIC_9s and CELTIC_19s to mouse EL4 cells was evaluated. Figures 13A-13D Results of binding studies are shown. The dose-dependent staining of cells obtained in this assay demonstrated that these aptamers have cross-specificity and can recognize both human and mouse CD3 proteins.

[0135] The same experimental setup was used to evaluate the binding affinity and specificity of the nucleic acid aptamer CELTIC_core, which corresponds to the calculated conserved motifs found in the top 45 sequence families isolated during SELEX ( Figure 7C ).like Figure 17.4 As shown in Figure 2, shortening the aptamer to a strictly conserved 21 nucleotides greatly improved the recognition specificity for the CD3 receptor. For each concentration tested, the signal on CD3-positive Jurkat cells was detected when the signal on CD3-negative Ramos cells was negligible. The improvement in specificity comes at the expense of affinity, because when the parental sequences such as CELTIC_1s, CELTIC_4s, CELTIC_9s and CELTIC_19s have a significant difference in apparent K D The signal saturates above 10 nM, and the apparent K D More than 50nM.

[0136] Since this conserved motif exhibits GGG / C repeats, defining the so-called "G-quadruplex" organization, we designed a set of mutants to conclusively confirm the importance of the G residues in the predicted conformation, identify key positions involved in binding specificity and affinity, and introduce mutations that could improve the properties of the aptamers. Several sequence variants CELTIC_core_1 to CELTIC_core_13 ( Figure 17.5 ) and tested at concentrations of 50 and 100 nM on Jurkat and Ramos cells. For comparison, the unmodified core sequence CELTIC_core (50 and 100 nM) and full-length CD3_CELTIC_1s (10 and 50 nM) were included in these analyses. The results shown in Figures 17.6.A to 17.6.N show that each modification has a significant and unpredictable effect on the biological activity of the nucleic acid aptamer: the addition of GC or G at the 3' end of the conserved motif (CELTIC_core_1 or CELTIC_core_4) leads to a loss of specificity. Some mutations disrupt the interaction with the CD3 receptor (CELTIC_core_2, CELTIC_core_5, CELTIC_core_6, and CELTIC_core_13). Loss of binding also occurred when the G / C nucleotides at certain positions were replaced by abasic sites (CELTIC_core_7 to CELTIC_core_11), creating an abasic site at position 16 of the aptamer resulting in better affinity but reduced specificity.

[0137] The addition of a TTT triplet at the 5'-end (CELTIC_core_T) had no effect on the binding properties of the core sequence, indicating that some space could be introduced between the biotin label and the aptamer without any steric hindrance. This observation prompted us to further evaluate all sequence variants with a HEG linker at the 5'-end that introduced a longer C18 spacer. Sequence variants from CELTIC_core_14 to CELTIC_core_44 were synthesized ( Fig.18 ), and tested with a concentration of 50 and 100 nm on Jurkat and Ramos cells, as previously described (Figure 19A-D). As a comparison, unmodified core sequences CELTIC_core (50 and 100 nM), full-length CD3_CELTIC_1s and CD3_CELTIC_19s (10 and 50 nM) were included in these analyses. For most positions, abasic sites or base substitutions destroyed the binding of core sequences to the CD3 receptors expressed on the surface of Jurkat cells. The removal of 10 and 12 nucleosides reduced affinity (CELTIC_core_23 and CELTIC_core_25), while the same modification of 11 (CELTIC_core_24) or 16 (CELTIC_core_29) (not a part of the GGG / C triplet defining the "G-quadruplex" framework) produced nucleic acid aptamers that were equal or improved in affinity and specificity, respectively. Unexpectedly, replacing the original C at position 16 with G reduced the affinity of the aptamer (CELTIC_core_39), while replacing it with A had no effect (CELTIC_core_38), while replacing it with T resulted in a higher affinity and specificity (CELTIC_core_40). Simultaneous modification of positions 11 and 16 either increased affinity and specificity (CELTIC_core_42) or decreased affinity (CELTIC_core_44). All these results from conformation-function studies (summarized in Fig. 20 ) showed that an improved version of the core sequence could be empirically designed by replacing positions outside the GGG / C triplet and introducing abasic sites to form a "G-quadruplex" structure.

[0138] Example 4: Detection of affinity and specificity of anti-CD3 RNA aptamers for CD3 protein expressed on cells

[0139] The binding of anti-CD3 RNA aptamers to Jurkat and EL4 cells was evaluated to determine the apparent K of their binding. D The binding was generally performed as described in Example 3, except that DPBS was used instead of SELEX buffer. The aptamers were used at three concentrations: 30 nM, 100 nM, and 300 nM. For incubation of the aptamers with EL4 cells, they were also diluted to 3 nM and 10 nM. The results of the binding studies are shown in Table 3. Figure 30A-EAs shown. Five aptamers were analyzed: ARACD3-3700006, ARACD3-0010209, ARACD3-3130001, ARACD3-2980001, and ARACD3-0270039. The binding of nucleic acid aptamers to CD3-negative Ramos cells (control) was also tested to evaluate the specificity of nucleic acid aptamers. In another cell binding assay, the binding of nucleic acid aptamers ARACD3-3700006 and ARACD3-0010209 to mouse EL4 cells was evaluated. The results of the binding study are shown in Figure 34A-B The dose-dependent staining of cells obtained in this experiment showed that these aptamers have cross-specificity and can recognize both human and mouse CD3 proteins.

[0140] Example 5: Binding of anti-CD3 DNA aptamers detected by surface plasmon resonance

[0141] Binding affinity detection was performed using a BIAcore T200 instrument (GE Healthcare). To analyze the interaction between aptamers and CD3 protein, 1000 resonance units of biotinylated aptamers were immobilized on S-series sensor chips SA (GE Healthcare) according to the manufacturer's instructions (GE Healthcare). SELEX buffer was used as running buffer. In the "single kinetic cycle" mode, the interaction was detected by injecting different concentrations of human CD3ε / γ, CD3ε / δ, IgG1 Fc and mouse CD3ε / δ (Sino Biological) at a flow rate of 30μl / min. The highest protein concentration used was 100nM. Other concentrations were obtained by 3-fold dilution. The kinetic data of all interactions were evaluated using the BIAcore T200 evaluation software. Figures 4A-4C Examples of binding curves obtained from these assays are shown. Table 3 below provides K values ​​obtained from surface plasmon resonance assays. D A summary of values.

[0142] Table 3: K values ​​of the top five anti-CD3 DNA aptamers detected by surface plasmon resonance D value

[0143]

[0144]

[0145] K binding to human and mouse CD3ε / δ DComparison of the values ​​showed that the aptamer can also bind to mouse CD3ε / δ, but with lower affinity. In addition, it was observed that CELTIC_1s (CD3-1s) bound to the CD3 protein more strongly than the aptamer CELTIC_1 (CD3-1 in Table 1). Table 4 below provides the K values ​​obtained from another set of surface plasmon resonance measurements. D It includes the K values ​​of the top five aptamers with and without flanking regions. D value.

[0146] Table 4: K values ​​of the top 5 anti-CD3 DNA aptamers with or without (s) flanking regions detected by surface plasmon resonance D Based on the recorded sensorgrams, the data were calculated using the steady-state analysis mode.

[0147]

[0148] Tables 5 and 6 below provide K values ​​of other aptamers. D The K values ​​listed in Tables 4 and 5 are D The values ​​were obtained by testing in steady-state analysis mode, and the K values ​​in Tables 3 and 6 are D Values ​​were obtained by performing the assay in kinetic analysis mode.

[0149] Table 5: K values ​​of different anti-CD3 DNA aptamers without flanking regions detected by surface plasmon resonance D Based on the recorded sensorgrams, the data were calculated using the steady-state analysis mode.

[0150]

[0151]

[0152] Table 6: K values ​​of different anti-CD3 DNA aptamers without flanking regions detected by surface plasmon resonance D The data were calculated using the kinetic analysis mode based on the recorded sensorgrams.

[0153]

[0154] Entries labeled with "*" refer to overestimated values ​​due to suboptimal fit of the sensorgram. NA = Not applicable, as no interaction was observed.

[0155] Example 6: Binding of anti-CD3 RNA aptamers detected by surface plasmon resonance

[0156] Surface plasmon resonance was used to detect the binding of anti-CD3 RNA aptamers to purified recombinant human CD3ε / γ and CD3ε / δ proteins. Binding studies were generally performed as described in Example 5, except that the SELEX buffer was replaced with DPBS. The highest protein concentration used was 300nM. Other concentrations were obtained by 3-fold dilution. The binding of anti-CD3 RNA aptamers to hIgG1 Fc was used as a control. Its binding to mouse CD3ε / δ (mCD3ε / δ) was also detected. The results of these studies are shown in Table 7 below.

[0157] Table 7: K values ​​of different anti-CD3 RNA aptamers detected by surface plasmon resonance D The data were calculated using the kinetic analysis mode based on the recorded sensorgrams.

[0158]

[0159] ND = not detected.

[0160] 31A-32C show the binding curves of nucleic acid aptamers ARACD3-3700006, ARACD3-0010209, and ARACD3-3130001.

[0161] Example 7: T cell activation by anti-CD3 DNA aptamers

[0162] In order to detect the activation effect of anti-CD3 DNA aptamers on T cells, 1 μM concentration of nucleic acid aptamers and CD28 were used to co-stimulate T cells. The cytokines secreted by cells in response to activation were detected by ELISA and human Th1 / Th2 micro-sample flow cytometry microsphere array (CBA). The expression of CD25 and CD69 activation markers on the surface of T cells was detected by flow cytometry. The results are shown in Figures 14A-14L, 15A-15C and 16A-16C, respectively.

[0163] T cell activation assay was performed on peripheral blood mononuclear cells (PBMCs). Freshly prepared PBMCs were obtained from healthy donors (Etablissement PBMCs were isolated from buffy coats obtained from the 100 mM PBS-treated 100 mM saline (Saint-Maurice-Saint-Maurice, Saint ...

[0164] Prior to evaluating T cell activation properties, the binding of anti-CD3 DNA aptamers to human PBMCs was first verified by flow cytometry as described in Example 3, except that the SELEX buffer was replaced by RPMI-1640 medium supplemented with 10% FBS and 1% penicillin / streptomycin. Four nucleic acid aptamers were used: CELTIC_1s, CELTIC_4s, CELTIC_9s, and CELTIC_19s, at concentrations of 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM. Fig.12 Results of a binding study are shown.

[0165] PBMC activation assays were performed on four aptamers (CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s) with or without anti-CD28 monoclonal antibody (Invitrogen) as a co-stimulator. Three conditions were included, namely, fresh aptamer solution was added in the presence of anti-CD28 monoclonal antibody after 3 h, 19 h, and 27 h to keep the reagent concentration constant. Before the experiment, PBMCs were seeded in 24-well plates at a density of 2.5 × 10 5Cells / well were placed in 400 μL RPMI medium containing 10% FBS and 1% penicillin / streptomycin and incubated at 37°C, 5% CO2 for 4 h. Candidate nucleic acid aptamers were denatured at 95°C for 5 min and then immediately placed on ice at 4°C for 5 min. After sampling 100 μL of supernatant (cytokine basal level condition), 100 μL of stimulation solution containing 1 μM DNA aptamer and 0.5 μg / mL CD28 monoclonal antibody diluted in RPMI was added to the wells. Cells were incubated at 37°C, 5% CO2 for 16, 24, or 48 h. Alternatively, PBMCs were incubated with 100 μL of a mixture containing 2 μg / mL CD3 mAb and 5 μg / mL CD28 mAb (Invitrogen); a solution containing 2 μg / mL CD3 mAb; or RPMI medium without reagents (negative control). The cells were then centrifuged at 320 g for 5 min, and the supernatant was recovered. PBMC activation was assessed by measuring the levels of secreted interleukin 2 (IL-2), tumor necrosis factor α (TNF-a), and interferon γ (IFN-g) in the culture supernatants collected at different time intervals. Sandwich ELISAs (DUOSET ELISA R&D Systems) were used for detection. 100 μL of undiluted sample or cytokine standards were added to each well pre-coated with capture antibody overnight. IL-2, TNF-a, or IFN-g cytokine binding was detected using biotinylated detection antibodies containing streptavidin-HRP conjugate and TMB substrate. After adding the stop solution, the ELISA plate was read at 450 nm using a VARIOSCAN LUX plate reader, and the cytokine levels were detected with reference to the standard curve. Figures 14A-14L show the results obtained. According to the manufacturer's instructions, the levels of secreted interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 5 (IL-5), interleukin 10 (IL-10), tumor necrosis factor alpha (TNF-a) and interferon gamma (IFN-g) in the culture supernatant collected 48 hours were detected using a human Th1 / Th2 flow cytometry microsphere array (CBA) (Becton Dickinson Biosciences). Figures 16A-16C show the results obtained.

[0166] Finally, the activation of PBMCs was evaluated by analyzing the expression of CD25 and CD69 activation markers on the surface of CD4 and CD8 positive T cells. After culturing for 48 hours under different experimental conditions and collecting the culture supernatant for ELISA and CBA analysis, PBMCs were transferred to 96-well plates and centrifuged at 2500rpm for 2min. The supernatant was discarded and the precipitated cells were washed twice with 200μL DPBS-0.2% BSA. After each wash, centrifuge at 2500rpm for 2min. The cells were then incubated with anti-CD4, anti-CD8, anti-CD25 and anti-CD69 monoclonal antibodies (Miltenyi) diluted in DPBS-0.2% BSA (1μl / test). After incubation at 4°C for 10min, the cells were centrifuged at 2500rpm for 2min and washed twice with DPBS-0.2% BSA (200μL / well). Cells were fixed with CellFix solution (BD Biosciences), and fluorescent positive cells were counted by flow cytometry (AttunNext; Invitrogen) on BL3 (anti-CD4-PerCP-Vio700), YL1 (CD69-PE), YL2 (CD8-PE-Vio-615) and YL4 (CD25-PE-Vio770) channels. Figures 15A-15C show the results obtained.

[0167] Cells treated with anti-CD3 mAbs with or without anti-CD28 mAbs showed increased secretion of all measured cytokines, except IL-5, and upregulated surface expression of CD25 and CD69 activation markers. None of the tested aptamers activated the secretion of cytokines expressed by surface markers, even when combined with co-stimulatory anti-CD28 antibodies. Maintaining constant aptamer concentrations by repeated additions of fresh solution to compensate for degradation of the aptamers in serum did not result in a more sustained activation curve.

[0168] Example 8: T cell activation by anti-CD3 RNA aptamers

[0169] Using the procedure described in Example 7, the activation of T cells by anti-CD3 RNA aptamers was detected by incubating cells with nucleic acid aptamers at a concentration of 1 μM and CD28 co-stimulation. The cytokines secreted by cells in response to activation were detected by ELISA and human Th1 / Th2 microsphere immunoassay system. The expression of CD25 and CD69 activation markers on the surface of T cells was detected by flow cytometry. Figures 35A-F, 37A-C and 36A-C show the results obtained, respectively.

[0170] As already observed in Example 7, cells treated with anti-CD3 mAbs in combination with or without anti-CD28 mAbs showed increased secretion of all tested cytokines except IL-5 and upregulated surface expression of CD25 and CD69 activity markers. Even in combination with co-stimulatory anti-CD28 antibodies, all tested aptamers failed to activate the expression of cytokine secretion of surface markers. Maintaining the concentration of aptamers constant by repeated addition of fresh solution to compensate for degradation of the aptamers in the serum did not result in a more prolonged activation curve.

[0171] Example 9: Functional stability of anti-CD3 DNA aptamers

[0172] The stability of anti-CD3 DNA aptamers (CELTIC_1s, CELTIC_4s, CELTIC_9s, CELTIC_11s, CELTIC_19s, and CELTIC_22s) was tested in SELEX buffer containing 5% fetal bovine serum (FBS) or in FBS alone. Biotinylated aptamers were denatured at 95°C for 5 min and then immediately cooled to 4°C on ice for 5 min. The sequences were then diluted to a final concentration of 2 μM in SELEX buffer supplemented with 5% FBS or pure FBS. Samples were incubated at 37°C for 10 min, 30 min, 1 h, 2 h, 4 h, or 24 h; control samples contained freshly prepared aptamers that were not incubated at 37°C. 100 nM streptavidin-PE was then added to each solution, and the aptamers were incubated with positive CD3 Jurkat cells as described previously. Then, the half-life of nucleic acid aptamers in SELEX buffer containing 5% FBS or pure FBS was detected using flow cytometry on the YL-1 channel based on the change in the number of fluorescent positive cells at 37°C with incubation time. The test results are shown in Figures 11A and 11B. Even after incubation for 24 hours in SELEX buffer containing 5% serum, all nucleic acid aptamers were stable. Diluting DNA aptamers in pure FBS showed that the sequence gradually degraded after incubation for 2 hours at 37°C.

[0173] Example 10: Functional stability of anti-CD3 RNA aptamers

[0174] The stability of nucleic acid aptamers ARACD3-3700006 and ARACD3-0010209 was detected in Dulbecco's phosphate buffer (DPBS) containing 5% FBS or in FBS alone. The procedure described in Example 9 was used, except that denaturation was performed at 85°C. The test results are shown in Figure 32-A. Both nucleic acid aptamers incubated in DPBS containing 5% serum are stable, even if the incubation is 24 hours. When incubated in pure serum, half of the binding activity is lost after 30 minutes.

[0175] Example 11: Serum stability of anti-CD3 DNA aptamers using gel electrophoresis

[0176] The stability of anti-CD3 DNA aptamers (CELTIC_1s, CELTIC_4s, CELTIC_11s, CELTIC_19s) was studied in selection (SELEX) buffer containing 5% fetal bovine serum (FBS), RPMI medium containing 10% fetal bovine serum (FBS), or pure fetal bovine serum (FBS) medium. The aptamers were denatured at 95°C for 5 min and then immediately cooled to 4°C on ice for 5 min. The sequences were then diluted to a final concentration of 2 μM in SELEX buffer supplemented with 5% FBS, RPMI medium supplemented with 10% FBS, or pure FBS serum. The samples were incubated at 37°C for 10 min, 30 min, 1 h, 2 h, 4 h, or 24 h; control samples contained freshly prepared aptamers that were not incubated at 37°C. The half-life of aptamers in their respective buffers was then detected by migration on agarose gels using the following electrophoresis method: aptamer samples collected from different incubation times were mixed with loading buffer (ThermoScientific, Waltham, MA, USA) and 15 L of each sample was placed on a freshly prepared 3% agarose gel containing SYBRsafe (Invitrogen) as a DNA staining marker. Migration of DNA aptamers on agarose gels was performed in 1X TBE buffer (Invitrogen) and 100 V was applied for 20 min. The gel was visualized using a Bio-Rad imaging system, and the results are shown in Figures 10A-10D. All tested aptamers were stable in SELEX-5% FBS buffer for at least 24 h. After incubation at 37 ° C for 24 h in RPMI medium containing 10% FBS, CELTIC_4s and CELTIC_11s degraded. However, dilution of DNA aptamers in pure serum resulted in a decrease in intensity after 1 h of incubation. These results are completely consistent with the stability reported by flow cytometry in Example 9.

[0177] Example 12: Serum stability of anti-CD3 RNA aptamers using gel electrophoresis

[0178] The stability of anti-CD3 RNA aptamers (ARACD3-3700006 and ARACD3-0010209) was studied in DPBS buffer containing 5% FBS, RPMI medium containing 10% FBS, or pure FBS. The aptamers were denatured at 85°C for 5 min and then immediately cooled to 4°C on ice for 5 min. The serial dilutions were then made to a final concentration of 2 μM in DPBS buffer supplemented with 5% FBS, RPMI medium supplemented with 10% FBS, or pure FBS serum. The samples were incubated at 37°C for 10 min, 30 min, 1 h, 2 h, 4 h, or 24 h; control samples contained freshly prepared nucleic acid aptamers that were not incubated at 37°C. Then, the half-life of nucleic acid aptamers in their respective buffers was detected by migration on agarose gel using the following denaturing electrophoresis method: nucleic acid aptamer samples collected from different incubation times were mixed with a loading buffer containing formamide (ThermoScientific, Waltham, Massachusetts, USA), and after denaturation at 85°C for 5 minutes, 15 μL of each sample was placed on a newly prepared 3% agarose gel containing SYBRsafe (Invitrogen) as an RNA staining marker. The migration of RNA aptamers on agarose gel was carried out in 1X TBE buffer (Invitrogen), 100V was applied, and it lasted for 20min. The gel was visualized using the Bio-Rad imaging system, and the results are shown in Figures 32B-C. Both nucleic acid aptamers were stable for at least 4h in DPBS-5% FBS and RPMI-10% FBS. The RNA aptamer intensity decreased after incubation in pure serum for 30min. These results are completely consistent with the stability reported by the flow cytometer in Example 10.

[0179] Example 13: Epitope detection of anti-CD3 DNA aptamers using anti-CD3 monoclonal antibody competitive binding method

[0180] To collect more information about the recognition regions of CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s aptamers, a competition binding assay was performed on CD3-positive Jurkat cells using a reference monoclonal antibody, essentially as described in Example 3, but with the following changes.

[0181] Jurkat cells were incubated with PE-labeled monoclonal antibodies (okt 3-PE-0.1 nM; UCHT1-PE-1 nM or HIT3a-PE-0.1 nM - all purchased from ThermoScientific, Waltham, MA, USA) at 37°C in the presence of excess amounts of various competitors (unlabeled OKT3-32 nM; unlabeled UCHT1-10 nM; unlabeled HIT3a-32 nM - all purchased from ThermoScientific, Waltham, MA, USA and aptamers-300 nM). The binding of labeled anti-CD3 monoclonal antibodies to cells was then assessed by flow cytometry.

[0182] In the opposite experimental setting, Jurkat cells were incubated with CELTIC_1s, CELTIC_4s, CELTIC_11s, CELTIC_19s DNA aptamers (fixed concentration 300 nM) with or without saturating concentrations of unlabeled monoclonal antibodies (OKT3-32 nM; UCHT1-10 nM; unlabeled HIT3a-32 nM). Binding of biotinylated aptamers to cells was assessed by flow cytometry after detection with streptavidin-PE.

[0183] Figures 17.1.A, 17.2.A and 17.3.A show the binding results of PE-labeled anti-CD3 monoclonal antibodies with or without saturating concentrations of competitors. For each test antibody, using an excess of its unlabeled form inhibited or completely abolished the binding of its PE-labeled form, thus validating the experimental conditions. When using nucleic acid aptamers as competitors, the maximum signal was detected, indicating that the test candidates failed to interfere with the binding of the three reference antibodies.

[0184] Figures 17.1.B, 17.2.B and 17.3.B show the binding results of anti-CD3 aptamers in the presence or absence of saturating concentrations of monoclonal antibodies. Similar signals were measured when the aptamers were incubated with or without competitors, indicating that the antibodies failed to interfere with the binding of the tested sequences.

[0185] No competition was observed between the anti-CD3 aptamers and the reference monoclonal antibodies tested, indicating that the aptamers target regions of the human CD3 receptor that are different from the OKT3, HIT3a, and UCHT1 epitopes. The OKT3 and UCHT1 antibodies have been reported to activate T lymphocytes upon binding. The recognition of alternative CD3 epitopes by CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s is consistent with the lack of activation properties observed in human PBMCs in Example 7.

[0186] Example 14: Epitope Detection of Anti-CD3 RNA Aptamers Using Competitive Binding of Anti-CD3 Monoclonal Antibodies

[0187] To collect more information about the recognition regions of ARACD3-3700006 and ARACD3-0010209 aptamers, competition binding assays were performed on CD3-positive Jurkat cells using reference monoclonal antibodies, essentially as described in Example 13, but using DPBS-5% FCS instead of SELEX buffer-5% FCS.

[0188] Figures 38-A, 38-C and 38-E show the binding results of PE-labeled anti-CD3 monoclonal antibodies in the presence or absence of saturating concentrations of competitors

[0189] For each antibody tested, using an excess of its unlabeled form inhibited or completely abolished the binding of its PE-labeled form, thus validating the experimental conditions. When using aptamers as competitors, the maximum signal was detected, indicating that the tested candidates failed to interfere with the binding of the three reference antibodies.

[0190] Figures 38.B, 38-D and 38-F show the binding results of anti-CD3 nucleic acid aptamers in the presence or absence of saturating concentrations of monoclonal antibodies. When nucleic acid aptamers were incubated with or without competitors, similar signals were detected, indicating that the antibodies failed to interfere with the binding of the tested sequences.

[0191] No competition was observed between the anti-CD3 aptamers and the reference monoclonal antibodies tested, indicating that the aptamers target regions of the human CD3 receptor that are different from the OKT3, HIT3a, and UCHT1 epitopes. The OKT3 and UCHT1 antibodies have been reported to activate T lymphocytes upon binding. The recognition of alternative CD3 epitopes by CELTIC_1s, CELTIC_4s, CELTIC_11s, and CELTIC_19s is consistent with the lack of activation properties observed in human PBMCs in Example 8.

[0192] Example 15: Engineering of anti-CD3 DNA aptamers with improved stability derived from core sequences

[0193] Based on the results obtained in the binding studies performed on CD3 positive and CD3 negative cells, and as described in Example 3, to further study the stability of nucleic acid aptamers in serum, we selected a series of sequence-optimized anti-CD3 aptamers derived from the core sequence with improved apparent affinity and targeting specificity. These analyses were performed by incubating nucleic acid aptamers CELTIC_core, CELTIC_core_12, and CELTIC_core_24, CELTIC_core_29, CELTIC_core_40, and CELTIC_core_42 modified with HEG at the 5'-end in selection (SELEX) buffer containing 5% fetal bovine serum (FBS), RPMI medium containing 10% FBS, or pure FBS. After various incubation times, the undegraded nucleic acid aptamers were quantified by flow cytometry and agarose gel electrophoresis as previously described in Examples 11 and 13, respectively.

[0194] As shown in Figures 22A-F and 23A-C, the aptamers CELTIC_core, CELTIC_core_24 and CELTIC_core_29 appeared to be very unstable under each serum condition tested, with no intact / functional aptamers remaining after incubation for 4 hours in SELEX-5% FBS or for 30 minutes in pure serum. As already observed in Examples 11 and 13, the results obtained by the two methods were completely consistent. In comparison, the parental full-length CELTIC_1s and CELTIC_19s sequences were stable for 24 hours in SELEX-5% fetal bovine serum and for at least 1 hour in pure serum. On the other hand, CELTIC_core_12, CELTIC_core_40 and CELTIC_core_42 performed better in both stability readouts. CELTIC_core_12 is by far the most stable aptamer, with no degradation at all after 24 hours of incubation in SELEX-5% FBS and RPMI medium containing 10% FBS. In pure serum, its degradation only started to occur after 4 h. CELTIC_core_40 and CELTIC_core_42 are intermediate examples that are more stable than the unmodified CELTIC_core sequence, but they are completely degraded after 4 h of incubation in pure serum. It is worth noting that although CELTIC_core_12, CELTIC_core_29 and CELTIC_core_42 differ by only one nucleotide at position 11, they show completely different stabilities. In addition, the introduction of a second abasic site at position 16 of CELTIC_core_29, forming CELTIC_core_42, seems to be a strategy to stabilize the sequence.

[0195] As another attempt to improve the stability of HEG-modified CELTIC_core_40 and CELTIC_core_42, the benefit of adding 3'-3' deoxythymidine was investigated. Such modifications at the 3' end have been reported to enhance the resistance of nucleotide sequences to nuclease degradation. Aptamers with 3'-3'-deoxythymidine at the 3'-end showed significantly improved stability compared to CELTIC_core_40 and CELTIC_core_42. Although not exceeding CELTIC_core, these variants were stable in SELEX-5% FBS for 24 h and in pure serum for at least 2 h. It is worth mentioning that CELTIC_core_42 is more stable than CELTIC_core_40 despite the presence of two abasic sites that are generally considered nuclease-sensitive sites.

[0196] Example 16: Most stable and sequence-optimized anti-CD3 core DNA sequence derivatives retain cross-specificity

[0197] As described in Example 4, the binding affinity of the most significant anti-CD3 aptamers derived from the core sequence was detected using a BIAcore T200 instrument (GE Healthcare). To analyze the interaction between the aptamers and the CD3 protein, the biotinylated aptamers were immobilized on Series S Sensor chips SA (GE Healthcare) at a density lower than that in Example 4 (100-500RU) according to the manufacturer's instructions (GE Healthcare). CD3ε / δ of mice and cynomolgus monkeys was purchased from AcroBiosystems. For human proteins, the highest concentration used was 100nM, and for mouse and cynomolgus monkey antigens it was 1M. Other concentrations were obtained by 3-fold dilution.

[0198] Table 8 below provides the K values ​​obtained from surface plasmon resonance measurements. DSummary of values. These results confirm that the affinity observed in the cell binding assay for the core sequence is reduced compared to the parental sequences CELTIC_CD3_1s and CELTIC_CD3_19s. Variants of the core sequences identified in the cell binding assay (CELTIC_core_12, CELTIC_core_24, CELTIC_core_29, CELTIC_core_40, and CELTIC_core_42) have all been shown to have better affinity for human CD3ε / δ than unmodified nucleic acid aptamers. As has been observed in Example 4, the affinity for CD3ε / δ is generally slightly lower, which is the result of a SELEX strategy that includes more rounds of CD3ε / δ isomers. None of these sequences bind to the Fc region of human IgG1. Adding 3'-3'-deoxythymidine at the 3' end of CELTIC_core_24, CELTIC_core_40, and CELTIC_core_42 did not significantly change K D value.

[0199] Table 8: K values ​​of sequence-optimized anti-CD3 core DNA sequence derivatives detected by surface plasmon resonance D The data were calculated using the kinetic analysis mode based on the recorded sensorgrams.

[0200]

[0201] Table 9 below provides the K values ​​obtained by surface plasmon resonance detection using human CD3ε / γ and mouse and cynomolgus monkey CD3ε / γ. D Summary of values. In this new experimental setup, CELTIC_core again showed lower affinity for human CD3ε / γ compared to the parental sequences CELTIC_core_1s and CELTIC_core_19s, while the sequence variants CELTIC_core_12, CELTIC_core_24, CELTIC_core_29, CELTIC_core_40 and CELTIC_core_42 showed better affinity. Under these conditions, 3'-3' deoxythymidine modified versions of the last four nucleic acid aptamers performed equally well. All of these sequence-optimized nucleic acid aptamers were able to bind to both murine and cynomolgus CD3ε / γ isoforms, confirming the cross-specificity of CD3 nucleic acid aptamers already observed in Examples 3 and 5. The reported K values ​​for interaction with mouse and cynomolgus CD3ε / γ isoforms are comparable to those of CELTIC_core, CELTIC_1s or CELTIC_19s. D and K of interaction with human CD3 protein DThe values ​​are in the same range, indicating that the detected interactions are real. Based on these results, the aptamers optimized with anti-CD3 sequences maintain cross-specificity and bind to mouse and cynomolgus monkey, even though these aptamers were selected against the human receptor.

[0202] Table 9: K values ​​of sequence-optimized anti-CD3 core DNA sequence derivatives detected by surface plasmon resonance D Based on the recorded sensorgrams, the data were calculated using the steady-state analysis mode.

[0203]

[0204] Example 17: Most stable and sequence-optimized anti-CD3 core DNA sequence derivatives still recognize proteins different from Epitope of reference antibody

[0205] To gather more information about the recognition regions of CELTIC_core_12, CELTIC_core_40t and CELTIC_42t aptamers, competition binding assays were performed using reference monoclonal antibodies on CD3-positive Jurkat cells essentially as described in Example 13. For comparison, full-length CD3_CELTIC_1s was included in these analyses.

[0206] The results of PE-labeled anti-CD3 OKT3, UCHT1 and HIT3a monoclonal antibodies binding with or without saturating concentrations of competitors are shown in Figures 21-.A, 21-C and 21-E. For each test antibody, the use of excess unlabeled form inhibited or completely abolished the binding of its PE-labeled form, thus validating the experimental conditions. When using nucleic acid aptamers as competitors, the maximum signal was detected, indicating that the test candidates failed to interfere with the binding of the three reference antibodies.

[0207] Figures 21-B, 21-D and 21-E show the binding results of anti-CD3 aptamers with or without monoclonal antibodies at saturating concentrations. Similar signals were detected when the aptamers were incubated with and without competitors, indicating that the antibodies failed to interfere with the binding of the tested sequences.

[0208] No competition was observed between the anti-CD3 aptamers and the reference monoclonal antibodies tested, indicating that the aptamers target regions of the human CD3 receptor that are different from the OKT3, HIT3a, and UCHT1 epitopes. Taken together, these results indicate that the sequence-optimized CELTIC_core_12, CELTIC_core_40t, and CELTIC_42t aptamers do not differ from the parental sequences in terms of epitope specificity, despite changes in nucleotide composition and chemical modifications at the 5'- and 3'-termini. Binding to CD3 regions substituted with the OKT3 and UCHT1 epitopes, which are known to activate T lymphocytes upon binding, showed that the CELTIC_core_12, CELTIC_core_40t, and CELTIC_42t aptamers do not exhibit activation properties.

[0209] Example 18: Functionalization of sequence-optimized anti-CD3 core DNA sequence derivatives by covalent chemistry The subsequent grafting will not change its biological properties

[0210] Finally, we set out to evaluate the impact of 3' and 5' end modifications on the biological properties of a given anti-CD3 aptamer. This question is particularly important when considering the covalent coupling of functionalized aptamers to carriers, polymers or surfaces. To this end, we chose HEG-modified CELTIC_core_42, coupling TEG-biotin to the 5' or 3' end of CELTIC_core_42 by solid phase synthesis as described in Example 1, or introducing a tetrazine-PEG5 group to the 5' end of CELTIC_core_42. These functional groups allow the aptamer to bind to the aptamer through affinity interactions (reported to be the strongest interaction with aptamers to date, K D For 10 15 M) to biotin, or covalently to norbornene / alkene / alkyne-modified ligands via click chemistry (Diels-Alder with reverse electron demand).

[0211] The interaction of these three forms of the same aptamer with the CD3 receptor expressed on Jurkat cells was investigated as described in Example 3. CD3-negative Ramos cells served as negative control to monitor non-specific interactions mediated by the introduced chemical modifications. Fig.33 The results summarized in show that both ends of a given aptamer can be modified with biotin, with no significant effect on the apparent affinity (K D The introduction of a tetrazine function at the 5' end slightly improved the affinity (apparent K D <25 nM) without any loss of specificity for the CD3 target.

[0212] Together, these results demonstrate that functionalization of anti-CD3 aptamers for subsequent conjugation can be performed without significantly interfering with their biological properties.

[0213] Table 10: Sequence List

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224] For Clusters 1 to 45, the flanking regions present at the 5'- and 3'-ends (TAGGGAAGAGAAGGACATATGAT and TTGACTAGTACATGACCACTTGA, respectively), whose sequences are described in SEQ ID NO: 114, are not shown.

[0225] As used herein, "consisting essentially of" permits the inclusion of materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation of the term "comprising" herein, particularly in the description of components of a composition or in the description of elements of a device, may be replaced with "consisting essentially of" or "consisting of".

[0226] While the invention has been described in conjunction with certain preferred embodiments, a skilled artisan, after reading the foregoing description, will be able to make various changes, substitutions, and other modifications to the compositions and methods described herein.

Claims

1. A nucleic acid aptamer comprising the sequence GX1TTX2GX3X4X5X6CX7GGX8CTGGX9G, wherein X1 is A or G; X2 is T or G; X3, X7 and X9 are G or C; X4 is T or C; X5 is A or T; X6 is T, C or G; X8 is A or C (SEQ ID NO: 111) or a variant thereof, and wherein the nucleic acid aptamer binds to CD3ε / γ or CD3ε / δ.

2. A nucleic acid aptamer comprising the sequence GGGTTTGGCAX1CGGGCCTGGC, wherein X1 is G, C or T (SEQ ID NO: 112) or a variant thereof, and wherein the nucleic acid aptamer binds to CD3ε / γ or CD3ε / δ.

3. The nucleic acid aptamer according to any one of claims 1-2, wherein the nucleic acid aptamer binds to human CD3ε / γ and / or CD3ε / δ with a dissociation constant of about 0.2 pM to about 250 nM.

4. The nucleic acid aptamer according to any one of claims 1-2, wherein the nucleic acid aptamer binds to a non-human form of CD3ε / γ and / or CD3ε / δ with a dissociation constant of about 20 nM to about 800 nM. 5 . The nucleic acid aptamer according to claim 1 , comprising a sequence selected from SEQ ID NO: 1 to 108.

6. The nucleic acid aptamer according to any one of claims 1 to 5, comprising a variant of the sequence, wherein one or more bases of the sequence are substituted by non-naturally occurring bases, or wherein one or more bases are deleted or the corresponding nucleotides are substituted by linkers.

7. The nucleic acid aptamer according to claim 6, wherein the one or more non-naturally occurring bases are selected from methylinosine, dihydrouridine, methylguanosine and thiouridine.

8. The nucleic acid aptamer according to any one of claims 1 to 7, which binds to but does not activate CD3+T cells.

9. A carrier for delivering a reagent, a dye, a functional group for covalent coupling or a bioactive agent to a T cell, wherein the carrier comprises the nucleic acid aptamer according to any one of claims 1 to 8.

10. The carrier according to claim 9 or 12, comprising a nanoparticle polymer.

11. The carrier of claim 10, wherein the nanoparticle polymer comprises poly(β-amino ester) (PBAE).

12. The carrier according to claim 10 or 11, wherein the nucleic acid aptamer is covalently linked to the polymer.

13. The vector of any one of claims 10-12, wherein the agent is a T cell modulator or an imaging agent.

14. The vector of claim 13, wherein the T cell regulator is a viral vector carrying a transgene; wherein the viral vector is coated with the polymer; and wherein the nucleic acid aptamer is covalently linked to the polymer. The vector according to claim 14 , wherein the viral vector is a lentiviral vector.

16. The vector of claim 14 or 15, wherein the transgene encodes a chimeric antigen receptor.

17. The vector according to claim 13, wherein the T cell modulator is selected from dasatinib, a MEK1 / 2 inhibitor, a PI3K inhibitor, an HDAC inhibitor, a kinase inhibitor, a metabolic inhibitor, a GSK3β inhibitor, a MAO-B inhibitor and a Cdk5 inhibitor.

18. A method of delivering an agent to T cells of a subject, the method comprising administering to the subject the vector of any one of claims 13-17.

19. A pharmaceutical composition comprising the carrier of any one of claims 13-17 and one or more excipients. 20 . A method for isolating T cells from a subject, the method comprising isolating T cells from the subject using the nucleic acid aptamer according to any one of claims 1 to 8.

Images