RNA (Ribonucleic Acid) aptamer and application thereof in improving salt tolerance of rice

Abstract

The invention discloses an RNA (Ribonucleic Acid) aptamer and application thereof in improving the salt tolerance of rice. The aptamer sequence eApt-2 with high affinity to eIF4A is obtained through enrichment by using a phylogenetic screening technology of the nucleic acid aptamer, and the aptamer sequence eApt-2 can inhibit the RNA helicase activity of eIF4A and selectively block a 5'cap-dependent translation initial process. After the eApt-2 coding sequence is introduced into a rice cell, the transgenic rice shows significantly enhanced salt tolerance under a salt stress condition: the growth condition is improved, and the biomass and the photosynthetic efficiency are both higher than those of a control plant. Compared with a traditional strategy of improving the salt tolerance through gene overexpression or knockout, the method does not need permanent modification of animal and plant genomes, accurate and reversible regulation and control of translation initiation factors are carried out through aptamers, optimization of stress response protein synthesis is achieved, and higher specificity and safety are achieved. The invention provides a novel and efficient technical approach for cultivating salt-tolerant crops, and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biotechnology, and particularly relates to an RNA aptamer and its application in improving the salt tolerance of rice. Background Art

[0002] Rice (Oryza sativa) is one of the most important food crops globally, feeding more than half of the world's population. However, soil salinization has become one of the major abiotic stress factors limiting rice yield. Salt stress can lead to ion imbalance and osmotic stress in plants, interfere with normal physiological and metabolic processes, cause a decrease in seed germination rate, plant growth retardation, and yellowing and wilting of leaves, and in severe cases, can lead to crop yield reduction or even crop failure. With the rise in sea level caused by climate change and the intensification of soil salinization due to improper irrigation and other factors, improving the salt tolerance of rice has become an urgent issue for ensuring stable agricultural production and food security. Traditionally, people have cultivated new varieties of salt-tolerant crops through conventional breeding or transgenic means (such as overexpressing or knocking out salt-tolerance-related genes). However, these methods often have a long cycle, inaccurate targeting, and overmodifying key genes may bring side effects such as growth retardation, affecting the normal physiological functions of plants. Especially for overexpression / knockout improvement of some essential genes, it is often accompanied by unexpected negative effects, making it difficult to achieve fine regulation of plant stress responses.

[0003] The adaptation process of plants under salt stress involves complex molecular network regulation, including signal transduction, stress-tolerance gene expression, and protein synthesis, etc. Among them, the regulation of the translation initiation stage is crucial, which determines which proteins are preferentially synthesized under stress conditions. Research shows that under salt stress, plants will preferentially synthesize stress-resistant related proteins such as ion transporters, osmoprotectants, and antioxidant enzymes, while reducing the synthesis of non-essential proteins to save energy for stress responses. This selective control of protein synthesis is largely determined by the activity of translation initiation factors. Eukaryotic translation initiation factor 4A (eIF4A) is an important component of the initiation complex and has RNA helicase activity, responsible for unwinding the secondary structure of the mRNA 5' untranslated region when the ribosome loads the mRNA. The functional state of eIF4A directly affects the translation efficiency and selectivity of mRNA. Existing research has pointed out that under stress conditions, the regulation of translation factors such as eIF4A is closely related to plant stress resistance responses. If the activity of such factors can be precisely regulated, the synthesis of stress-related proteins can be optimized, thereby enhancing the stress resistance of plants.

[0004] RNA aptamers are a class of nucleic acid molecules that can specifically bind to target molecules (such as proteins). Compared with traditional genetic engineering improvement methods, RNA aptamers have more precise and reversible regulation of targets: aptamers can regulate the function of target proteins by binding to them, without permanently changing the plant genome. In recent years, RNA aptamers have received attention in the fields of biomedicine and others, but the research on improving plant stress resistance is still in its infancy. Regulating specific proteins using aptamers is expected to become a new crop improvement strategy. Given the key role of eIF4A in the salt stress response, if RNA aptamers that specifically bind to and inhibit eIF4A can be screened out, it is expected to precisely control the translation initiation process, enabling rice to preferentially synthesize stress-resistant proteins and inhibit the synthesis of non-critical proteins under salt stress, thereby enhancing salt tolerance. Therefore, it is of great significance to provide a technology for improving rice salt tolerance based on RNA aptamer regulation of eIF4A. Summary of the Invention

[0005] The purpose of the present invention is to overcome the defect of insufficient precision in the existing methods for improving rice salt tolerance, and to provide a new strategy for improving rice salt tolerance by regulating the translation initiation factor eIF4A using RNA nucleic acid aptamers. The present invention obtains an RNA aptamer that can efficiently and specifically bind to the rice eIF4A protein through in vitro screening, and introduces it into rice cells for expression to finely regulate protein synthesis under stress conditions, thereby enhancing the salt tolerance of plants.

[0006] The first object of the present invention is to provide an RNA aptamer, whose nucleotide sequence is shown in SEQ ID NO.4.

[0007] The present invention uses the systematic evolution of ligands by exponential enrichment (SELEX) technology of nucleic acid aptamers to enrich aptamer sequences with high affinity for eIF4A from an oligonucleotide library containing random sequences; the target is the recombinant eIF4A protein derived from rice, and the length of the random RNA library is 40 nucleotides. After multiple rounds of positive screening and combined with negative screening to remove non-specific sequences, an eIF4A aptamer sequence eApt-2 with specificity and high affinity is screened out. Experiments prove that eApt-2 can specifically bind to the eIF4A protein, and its dissociation constant Kd is about 0.86 μM, indicating a strong binding force. More importantly, after binding, eApt-2 can inhibit the RNA helicase activity of eIF4A, thereby selectively blocking the 5'-cap-dependent translation initiation process. Therefore, the present invention obtains an RNA aptamer that can precisely regulate translation initiation.

[0008] The second object of the present invention is to provide a recombinant expression vector, which contains the DNA sequence encoding the above-mentioned RNA aptamer and can transcribe and express the RNA aptamer in plant cells.

[0009] The third object of the present invention is to provide a transgenic plant cell containing the recombinant expression vector described above.

[0010] The fourth object of the present invention is to provide a transgenic plant, which is a plant into which the recombinant expression vector described above is transferred and integrated into the genome to express the RNA aptamer.

[0011] The fifth object of the present invention is to provide the application of the RNA aptamer described above in improving the salt tolerance of plants.

[0012] Preferably, the plant is rice.

[0013] After the eApt-2 aptamer is expressed in the transgenic rice cells of the present invention, it can bind to endogenous eIF4A and partially inhibit its function, achieving dynamic regulation of the translation mechanism without changing the expression level of any endogenous genes. Under salt stress conditions, plant cells expressing the aptamer can reduce the investment in the synthesis of non-critical proteins and preferentially ensure the translation of stress defense-related proteins, thereby improving the overall salt tolerance. The transgenic rice plants obtained by cultivation show significantly enhanced salt tolerance under salt treatment, such as better growth conditions than the control plants, higher biomass accumulation, and smaller decreases in chlorophyll content and photosynthetic efficiency. The aptamer regulation strategy of the present invention provides a new approach for crop salt tolerance breeding.

[0014] Compared with the existing technologies for improving salt tolerance by overexpressing or knocking out genes, the present invention uses RNA aptamers to finely regulate translation initiation factors, and has the following outstanding advantages: First, the regulation is highly specific, and eApt-2 only affects the translation process related to eIF4A, does not interfere with other elements of the plant genome, and reduces the potential impact on normal growth; Second, the regulatory effect is reversible, and the aptamer can be degraded and inactivated when not needed, avoiding the risks brought by permanent genetic modification; Third, introducing the aptamer sequence is relatively safe for plants, does not cause the accumulation of foreign proteins, and avoids the physiological and metabolic interference and ecological risks that may be caused by traditional transgenes. Therefore, the present invention provides a more precise, efficient and safe method for improving the salt tolerance of rice, and has good application prospects. Description of the Drawings

[0015] Figure 1 It is the SELEX screening strategy (A) and the schematic diagram of RNA library design (B).

[0016] Figure 2 It is the enrichment curve (A) of eApt-2 and the prediction of the stem-loop structure (B).

[0017] Figure 3It is the binding affinity (A) between eApt-2 and eIF4A and the effect on the eIF4A protein level (B).

[0018] Figure 4 It is the verification of the inhibitory effect of eApt-2 on cap-dependent translation by dual-luciferase assay.

[0019] Figure 5 It is the enhanced co-localization of eApt-2 and eIF4A under salt stress.

[0020] Figure 6 It is the expression of eApt-2 in transgenic rice and its improvement of salt tolerance; where A is the root length of wild-type (WT) and transgenic seedlings under salt stress (150 mM NaCl), B is the biomass of wild-type and transgenic seedlings under salt stress (150 mM NaCl); C is the qRT-PCR analysis of eIF4A aptamer expression in transgenic seedlings, D is the chlorophyll content of wild-type and transgenic seedlings measured by SPAD value, and E is the Western blot analysis of eIF4A protein level in wild-type and transgenic seedlings. Specific Embodiments

[0021] The following examples further illustrate the present invention rather than limiting it.

[0022] Example 1: In vitro screening of eIF4A-specific RNA aptamer

[0023] Target protein preparation: The coding sequence (nucleotide sequence as shown in SEQ ID NO.2) of rice eIF4A protein (amino acid sequence as shown in SEQ ID NO.1) was cloned into the prokaryotic expression vector pCold vector, and the recombinant eIF4A protein with 6×His tag was induced to express in Escherichia coli BL21(DE3). When the bacterial liquid was cultured to OD≈0.6, the temperature was reduced and IPTG was added to induce protein expression. After appropriate culture, the bacteria were collected and the protein was extracted by lysis. The His-tagged eIF4A protein was purified and enriched using Ni 2 +-NTA affinity chromatography column, and the purity was verified by SDS-PAGE. The purified eIF4A protein was immobilized on Ni-NTA agarose beads as the target vector for subsequent SELEX screening.

[0024] Random nucleic acid library and SELEX conditions: Synthesize the initial single-stranded DNA random library, which contains about 101 different sequences, with 40 random bases (N) in the middle of each sequence or 26 random bases (N 26 )-stem structure sequence-26 random bases (N 26 ), and the T7 promoter sequence for in vitro transcription and the fixed primer region are included on both sides (Figure 1 In B) of [reference]. The DNA library was transcribed into an RNA library using a T7 in vitro transcription kit. The RNA library was mixed with the eIF4A protein immobilized on agarose beads in a binding buffer (containing 20 mM HEPES, 150 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 0.1% Tween-20), and incubated at room temperature for a certain time to allow the aptamer to fully bind to the target protein. Subsequently, the unbound RNA sequences were removed (which can be achieved by centrifugal washing multiple times), and the RNA-protein complexes retained on the beads were collected. An appropriate amount of elution buffer (containing 10 mM EDTA) was added to dissociate the RNA aptamer. The eluted enriched RNA aptamer was immediately reverse transcribed into cDNA, and PCR amplification was performed using a high-fidelity DNA polymerase. The newly obtained enriched DNA fragments were used for the next round of in vitro transcription. Such cycles were repeated for multiple rounds of screening, and each round included binding, elution, and amplification steps ( Figure 1 In A) of [reference]. The selection pressure was gradually increased during the screening process: starting from the second round, a reverse screening step was added, that is, the RNA library was incubated with an irrelevant His-tag protein system before each round of forward screening to remove sequences that might bind to common His-tags or non-specific sites; at the same time, as the number of screening rounds increased, the amount of the target eIF4A protein was gradually reduced and the washing intensity was increased to eliminate low-affinity binders. In the later screening rounds (rounds 18 - 20), a competitive elution step was added: a known eIF4A inhibitor (a rocaglate-class small molecule) was added to the eIF4A beads bound to RNA, so that the aptamers with high affinity and competing for the eIF4A active site were preferentially eluted. Through the above strategies, the specificity and affinity of the screened aptamers were improved. A total of 20 rounds of SELEX screening were performed in this example.

[0025] Sequence determination and aptamer acquisition: After the last round of screening, the enriched aptamer pool was subjected to sequencing analysis. High-throughput sequencing technology (Illumina sequencing platform) was used to read the aptamer sequences, and bioinformatics methods (FASTAptamer tool suite) were used to analyze the enrichment and frequency distribution of the sequences.

[0026] The results showed that multiple sequences were significantly enriched during the screening process. Several aptamer sequences with the highest enrichment levels (such as eApt-1, eApt-2, and eApt-3) were selected from this example. Among them, eApt-2 and eApt-3 were two dominant sequences, and their sequence lengths were 70 and 72 nucleotides respectively.

[0027] The nucleotide sequence of eApt-1 is: GGAGGCUCUCGGGACGACGGAAUUGGCGAAAUCAUUGC GCCAACUGUAGUCCGUCCCGAUGCUGCAAUCGUAA (SEQ ID NO.3).

[0028] The nucleotide sequence of eApt-2 is: GGAGGCUCUCGGGACGACGACUGGAGCGGAUGGUAAUC CUGGAAUCGGCGUCCCGAUGCUGCAAUCGUAA (SEQ ID NO.4).

[0029] The nucleotide sequence of eApt-3 is: GGAGGCUCUCGGGACGACGGAAUCGGCGUCUGAUAAUC GCAGACUGAAGUCGUCCCGAUGCUGCAAUCGUAA (SEQ ID NO.5).

[0030] Among the above sequences, eApt-2 has the highest enrichment degree in the screening pool. The enrichment curve is shown in Figure 2 A in, which is considered to be the obtained optimal RNA aptamer candidate sequence. Its stem-loop structure prediction is as shown in Figure 2 B in. The subsequent examples will mainly verify the function of eApt-2.

[0031] Example 2: Interaction between Aptamer eApt-2 and eIF4A and Its Effect on Translation Initiation

[0032] Binding Affinity Assay: In this example, dot blot binding experiment and electrophoretic mobility shift assay (EMSA) were used to evaluate the binding ability of the aptamer to eIF4A. The purified eIF4A protein was spotted on a nitrocellulose membrane, and aptamer eApt-2 or eApt-3 probes with certain concentrations were added for hybridization respectively. The binding signal intensity was detected by chemiluminescence color development. The results showed that the signal intensity generated by the eApt-2 probe was significantly higher than that of eApt-3 under the same conditions, indicating that eApt-2 binds stronger to eIF4A. Further, aptamers with gradient concentrations were incubated with a fixed amount of eIF4A protein, and the intensity change of the binding band was observed in EMSA. The binding curve was plotted and the dissociation constant Kd was calculated. The results ( Figure 3 A in) showed that the Kd of eApt-2 was about 0.86 μM, while the Kd of eApt-3 was about 13.46 μM, verifying that eApt-2 has a much higher affinity for eIF4A than eApt-3.

[0033] Effect on eIF4A protein level: To investigate whether aptamer binding affects the intracellular stability of eIF4A, this example uses a transient expression system of rice protoplasts for experimentation. First, using the leaves of Nipponbare rice seedlings as materials, protoplasts are prepared by enzymatic digestion with cellulase (1.5% Cellulase R10) and pectinase (0.5% Macerozyme R10) for 3 hours in the dark, and highly active protoplasts are obtained through filtration and gradient centrifugation purification. Subsequently, the eApt-2 aptamer sequence (GGAGGCUCUCGGGACGACGACUGGAGCGGAUGGUAAUCCUGGAAUCGGCGUCCCGAUGCUGCAAUCGUAA) synthesized by T7 transcription is heat-denatured (95°C for 5 minutes) at room temperature and then rapidly placed on ice for structural refolding. The refolded aptamer (final concentration 50 nM) is transfected into protoplasts using the 40% PEG4000-mediated method. After the transfection reaction, the cells are left standing at room temperature for 20 minutes to facilitate absorption. After transfection, the cells are washed with W5 buffer and resuspended, and transferred to a medium containing 0.4 M mannitol for subsequent culture at room temperature. Protoplasts are collected at different time points of 0, 1, 4, and 8 hours after transfection. After extracting total protein, Western Blot technology is used to detect the change in the expression level of eIF4A protein to explore the effect of the eApt-2 aptamer on the stability of eIF4A in rice cells. Results( Figure 3 As shown in B) of the results, compared with the control without aptamer introduction, the eIF4A protein level decreased significantly over time after the introduction of eApt-2: a decrease in eIF4A content was detected at 1 hour after transduction, and the intensity of the protein band further decreased at 4 hours and 8 hours. This result indicates that the binding of eApt-2 may accelerate the degradation of eIF4A protein or affect its stability, suggesting that the aptamer not only inhibits the function of eIF4A through physical hindrance but may also trigger the degradation pathway of this complex in cells.

[0034] In vitro translation activity analysis: To clarify the functional effect of the aptamer on the translation initiation process, this example uses a dual-luciferase reporter system for detection. The reporter vector pRF-HCV-IRES used contains two reporter genes, Renilla luciferase (RLuc) and firefly luciferase (FLuc). The translation of RLuc depends on the typical 5'-cap-dependent pathway, while the translation of FLuc is mediated by the hepatitis C virus IRES element (cap-independent). The above dual-reporter gene mRNA is co-incubated with the rice cell-free extract (RCE) system, and the synthesized aptamer eApt-2 or other control aptamers (random sequence aptamer N40) are added, and the luciferase activity of the product is measured. Results( Figure 4)It was shown that in the system with the introduction of eApt-2, the activity of Renilla luciferase decreased significantly, while the activity of firefly luciferase was basically unaffected. Compared with the control without aptamer or with the addition of an aptamer with an unrelated sequence, compared with other selected eApt-1 and eApt-3, eApt-2 showed the strongest inhibitory effect, and the RLuc activity decreased extremely significantly (p<0.01, a decrease of 34.8%), while the FLuc had no significant change. This indicates that eApt-2 specifically inhibits the cap-dependent translation initiation process in cell extracts, and has no obvious effect on IRES-mediated translation. Thus, it can be seen that eApt-2 binds to eIF4A, hinders its normal function in the ribosomal initiation complex, and thus selectively inhibits the translation of mRNAs that depend on the helicase activity of eIF4A. Combining the above results, it can be inferred that under adverse conditions such as salt stress, the introduction of eApt-2 will inhibit the synthesis of proteins that have no direct relationship with stress, freeing up more translation resources for key stress-resistant proteins, thus facilitating the survival of cells under stress.

[0035] Subcellular localization and interaction verification: Further, we observed the co-localization of the aptamer and eIF4A in cells by confocal microscopy. The synthesized eApt-2 aptamer with a fluorescent label (Cy3) was introduced into rice protoplasts, and immunofluorescence staining was performed using an anti-eIF4A antibody to detect the localization relationship between the two in cells. Under normal conditions, only a small amount of aptamer was visible to coincide with the eIF4A signal; while after adding a moderate salt stress treatment, the coincidence degree of the aptamer fluorescence and the eIF4A signal increased significantly (Pearson correlation coefficient analysis showed an increase in the co-localization ratio). This phenomenon indicates that in a salt stress environment, eIF4A may undergo conformational changes or changes in subcellular distribution, and is more easily captured and bound by the aptamer. This result supports the mechanism of eApt-2 acting under salt stress conditions from the side: stress promotes aptamer-target interaction, thus more effectively regulating the translation process and achieving the optimization of stress response.

[0036] Example 3: Verification of the improvement of salt tolerance by aptamer eApt-2 in transgenic rice

[0037] Vector construction and genetic transformation: In this example, the expression sequence of the aptamer eApt-2 was introduced into rice cells to verify its effect on the salt tolerance of the whole plant. First, according to the RNA sequence of eApt-2 (SEQ ID NO.4), the corresponding DNA sequence was designed and synthesized: GGAGGCTCTCGGGACGACGACTGGAGCGGATGGTAATCCTGGAATCGGCGTCCCGATGCTGCAATCGTAA. Appropriate promoter and terminator elements were added to both ends to construct an expression cassette: The CaMV 35S promoter was used to drive the nuclear transcription of the aptamer to obtain constitutive expression. The aptamer expression cassette was cloned into the plant expression vector (pCAMBIA1300 plasmid) to obtain the recombinant vector p35S-eApt-2. Agrobacterium-mediated transformation was used to transform rice (Nipponbare) callus. After resistance screening and tissue culture to regenerate plants, transgenic rice lines stably integrating the eApt-2 expression cassette were obtained. The correct insertion of the aptamer transgene was verified by PCR and sequencing.

[0038] Aptamer expression and its effect on eIF4A: The seedlings were taken for detecting the aptamer expression level. Total RNA was extracted from transgenic rice and wild-type control respectively, and reverse transcription quantitative PCR (qRT-PCR, forward primer: GGAGGCTCTCGGGACGA; reverse primer: TTACGATTGCAGCATCGGGAC) was carried out using aptamer-specific primers. The result ( Figure 6 C in it) confirmed the accumulation of the transcript of the aptamer eApt-2 in transgenic plants, while there was no such amplification signal in the wild-type control, indicating the successful expression of the exogenous aptamer gene in transgenic rice.

[0039] Meanwhile, total proteins were extracted from the corresponding materials for Western Blot analysis of eIF4A protein. The results showed that under normal conditions, the eIF4A protein content in transgenic plants was slightly lower than that in the control; after 48 hours of treatment with 150 mM NaCl salt stress, the eIF4A protein level in transgenic plants was significantly lower than that in the control group ( Figure 6 E in it). Under the same conditions, the eIF4A level in the control plants showed no significant change or a slight increase. This result was consistent with the trend of the protoplast experiment in Example 2, further proving that at the whole plant level, the expression of the aptamer can affect the steady-state level of eIF4A protein.

[0040] Salt tolerance phenotypic analysis: To evaluate the effect of the eApt-2 aptamer on the salt tolerance of rice, a salt stress comparison experiment was conducted between transgenic rice seedlings and non-transgenic control seedlings under greenhouse conditions. The two groups of seedlings were respectively treated in a culture solution containing 150 mM NaCl for 7 - 14 days, and the plant growth status and physiological indexes were observed. The results showed that the transgenic rice expressing eApt-2 exhibited stronger tolerance under salt stress: their leaves remained in better green color and were upright, and the degree of plant growth inhibition was significantly lower than that of the control. Quantitative determination showed that one week after salt stress, the plant height and fresh weight of the transgenic plants were significantly higher than those of the control group, and the average fresh weight of the transgenic plants was about 1.3 times that of the control (p < 0.05)( Figure 6 B in). At the same time, the chlorophyll content was detected using a SPAD chlorophyll meter( Figure 6 D in). The SPAD value of the leaves of the transgenic plants only decreased slightly after salt treatment (31, average value) and remained above 80% of that before stress, while that of the control plants decreased to about 25 (average value). This indicates that the photosynthesis of the transgenic plants was less affected under salt stress. In addition, the transgenic plants accumulated more biomass and had more developed roots compared with the control( Figure 6 A, B in). All these evidences support that the expression of the eApt-2 aptamer significantly improves the salt tolerance of rice.

[0041] Combined with the results of the above examples, the molecular mechanism by which eApt-2 improves the salt tolerance of rice can be inferred as follows: After entering plant cells, the aptamer directly binds to eIF4A, inhibits its helicase activity and triggers a decrease in its protein level. Due to the limited activity of eIF4A, the part of mRNA in the cell that is efficiently translated depending on the 5'-cap structure (mostly protein-coding genes related to normal growth) is inhibited; relatively speaking, some mRNAs that can still be translated under stress (may have a simpler 5'-structure or contain IRES elements and often encode stress-resistant functional proteins) are less affected, so their proportion in the overall translation increases. As a result, under salt stress conditions, the plant's resource allocation is more inclined to synthesize stress-resistant proteins rather than minor proteins related to growth. This translational reprogramming improves the adaptability of cells to salt stress. At the same time, as an exogenous molecule, the RNA aptamer has a reversible and regulatory effect: in the absence of stress, the effect of the aptamer on eIF4A is relatively limited and does not seriously hinder the normal growth of plants; while when stress occurs, its regulatory effect can rapidly enhance the plant's defense ability.

[0042] In summary, through the translation control mediated by RNA aptamers, the present invention realizes the precise improvement of plant salt resistance and provides a new technical approach different from traditional gene manipulation.

[0043] In this invention, an RNA aptamer eApt-2 that specifically binds to rice eIF4A was screened out by SELEX technology, and its ability to improve salt tolerance by inhibiting cap-dependent translation initiation was verified. eApt-2 provides a precise and reversible new tool for improving rice salt tolerance, and has important theoretical significance and application value.

Claims

1. An RNA aptamer, characterized in that The nucleotide sequence is shown in SEQ ID NO.

4.

2. A recombinant expression vector, characterized in that: The invention contains a DNA sequence encoding the RNA aptamer according to claim 1 and can transcribe and express the RNA aptamer in plant cells.

3. A transgenic plant cell, characterized in that: Contains the recombinant expression vector according to claim 2.

4. A transgenic plant, characterized in that: The plant is a plant in which the recombinant expression vector according to claim 2 is transferred and integrated into the genome, and the plant expresses the RNA aptamer.

5. Use of the RNA aptamer according to claim 1 in improving plant salt tolerance.

6. The use according to claim 5, characterized in that: The plant is rice.

Images