Transcription factor gene PagBZR1 for synergistically regulating wood yield and wood fiber length of poplar and application of transcription factor gene PagBZR1

Abstract

The invention relates to a transcription factor gene PagBZR1 for synergistically regulating and controlling poplar wood yield and wood fiber length and application of the transcription factor gene PagBZR1, and belongs to the technical field of plant genetic engineering. The nucleotide sequence is shown as a sequence 3 in a sequence table, and the amino acid sequence is shown as a sequence 4 in the sequence table. The PagmBZR1 gene is transferred into a poplar, compared with a wild type, the plant height of the transgenic poplar expressed by activation of the PagmBZR1 is remarkably increased, the ground stem is remarkably thickened, the number of cell layers of stem vascular tissues is remarkably increased, the length and width of wood fibers are remarkably increased, secondary cell walls are remarkably deposited and thickened, and the phenotype of the transgenic poplar expressed by inhibition of the PagmBZR1 is opposite to the phenotype of the transgenic poplar expressed by inhibition of the PagmBZR1. Therefore, the PagmBZR1 gene is a key regulatory gene for regulating the generation of poplar wood, and has important application value in the fields of forest gene engineering and clonal forestry.

Description

Technical Field

[0001] The present invention relates to key transcription factor genes on the brassinolide signal transduction pathway regulating poplar vascular tissue development and wood formation and applications thereof, in particular to a transcription factor gene PagBZR1 for synergistically regulating poplar wood yield and wood fiber length and applications thereof, belonging to the technical field of biogenetic engineering. Background Art

[0002] Poplar is an economic tree species widely distributed around the world. It has the characteristics of early rapid growth, strong adaptability, wide distribution, multiple varieties, easy hybridization, easy genetic improvement, and easy reproduction. Therefore, it is widely used in intensive cultivation. Poplar has a wide range of uses. It is not only used as a material for the processing industry, but also an important raw material for plywood, fiberboard, papermaking, sanitary chopsticks and packaging industries. It not only has huge economic benefits, but also great ecological and social benefits. Therefore, it is urgent to develop new high-quality and high-yield poplar varieties with increased wood production and improved wood quality. Using molecular biology and genetic engineering technology to increase poplar wood production and improve poplar wood quality has important theoretical significance and application value.

[0003] Wood yield and wood quality are jointly determined by the division activity of vascular cambium cells and the activity of xylem differentiation. Previous studies have shown that the division activity of poplar vascular cambium and the activity of xylem differentiation are regulated by the hormone signal of brassinosteroids. The increase in brassinosteroid content promotes the differentiation of secondary xylem and the formation of wood, and significantly increases the biomass of wood tissue. Brassinosteroids transmit signals to the downstream transcription factor BZR1 through signal cascade reactions, thereby regulating the transcription of BR response genes. Therefore, studying the role of BZR1 in plant development can further reveal the molecular mechanism of brassinosteroids regulating vascular tissue development and wood formation, which is conducive to creating new poplar varieties with high-quality wood fiber quality.

[0004] Therefore, a transcription factor gene PagBZR1 that synergistically regulates poplar wood yield and wood fiber length and its application are provided. Based on molecular biology and genetic engineering technology, poplar is used as the research object to provide new ideas for analyzing the molecular mechanism of brassinolide regulating poplar wood formation, which is of great significance for forest breeding and improvement. Summary of the invention

[0005] In view of the deficiencies in the prior art, one of the objectives of the present invention is to provide a transcription factor gene PagBZR1 that synergistically regulates poplar wood yield and wood fiber length.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length, the nucleotide sequence of which is shown in sequence 3 in Table 3.

[0008] Another object of the present invention is to provide the expression protein of the transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length.

[0009] The above object of the present invention is achieved through the following technical solutions:

[0010] An expression protein of the transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length, whose amino acid sequence is shown in sequence 4 in Table 4.

[0011] Another object of the present invention is to provide a plant expression vector of the transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length.

[0012] The above object of the present invention is achieved through the following technical solutions:

[0013] A plant expression vector of the transcription factor gene PagBZR1 that synergistically regulates poplar wood yield and wood fiber length, comprising a plant activation expression vector PagBZR1pro-PagmBZR1-VP16, whose nucleotide sequence is shown in Sequence 8 in Table 8; and a plant inhibition expression vector PagBZR1pro-PagmBZR1-SRDX, whose nucleotide sequence is shown in Sequence 9 in Table 9.

[0014] Another object of the present invention is to provide a method for constructing a plant expression vector of the transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length.

[0015] The above object of the present invention is achieved through the following technical solutions:

[0016] A method for constructing a plant expression vector of the transcription factor gene PagBZR1 that synergistically regulates poplar wood yield and wood fiber length, the steps of which are as follows:

[0017] (1) Cloning of PagmBZR1 gene

[0018] Using 84K (P. alba × P. glandulosa) silver glandular poplar as the material, the total RNA of tissue culture seedling 84K was extracted using the RNeasy Plant Mini kit and RNase-free DNase I kit (Qiagen, Hilden, Germany); 2.0 μg of RNA was taken from each sample, and the first-strand cDNA was synthesized by using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA); with reference to the published genome sequence of Populus trichocarpa, primers were designed using Primer3 software (amplicon included start codon and stop codon) for gene amplification, and the gene mutation method of the bzr1-D gain-of-function mutant was adopted to mutate the GSK-3 kinase phosphorylation site, and the gene was named PagmBZR1.

[0019] (2) Construction of plant expression vector of PagmBZR1 gene

[0020] The activation expression and inhibition expression vectors of PagBZR1 gene were constructed by cloning technology, and the vector-specific PCR primers were designed by Oligo7 software. The previously amplified PagmBZR1 was used as a template for PCR amplification.

[0021] The CDS of PagmBZR1 gene was constructed into the target vector, which was pCAMBIA3300 (SEQ entry vector pCAMBIA3300: 10177 bp);

[0022] (3) First, digest the target vector with Hind III enzyme;

[0023] (4) The target gene with vector-specific primers at both ends was constructed into the plant expression vector pCAMBIA3300 by homologous recombination reaction. The sequences of the final vectors constructed are shown in Sequence 8 in Table 8 and Sequence 9 in Table 9, respectively;

[0024] (5) The vectors finally constructed were PagBZR1pro-PagmBZR1-VP16 and PagBZR1pro-PagmBZR1-SRDX.

[0025] Preferably, in step (1), the PagmBZR1 CDS forward primer is as shown in Sequence 1 in Table 1, and the PagmBZR1 CDS reverse primer is as shown in Sequence 2 in Table 2; the high-fidelity PCR reaction system is as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5 μL, PagmBZR1 CDS forward primer (10 μM) 0.15 μL, PagmBZR1 CDS reverse primer (10 μM) 0.15 μL, template (84K poplar cDNA) 0.8 μL, sterile ddH2O is added to 15 μL, reaction procedure: 98°C, 1 min; (98°C, 10s; 56°C, 15s; 72°C, 2 min: 35 cycles); 72°C, 3 min.

[0026] Preferably, in step (2), the PagmBZR1 vector-specific forward primer is shown as Sequence 5 in Table 5, and the PagmBZR1 vector-specific reverse primer is shown as Sequence 6 in Table 6.

[0027] Preferably, in step (3), the enzyme digestion system is as follows: 5 ng of target vector pCAMBIA3300 (volume converted according to concentration); 3 μL of HindⅢ enzyme; 3 μL of 10×green buffer; ddH2O, made up to 30 μL, reaction system: 37°C, 30 min.

[0028] Preferably, in step (4), the homologous recombination reaction system: 80 ng of pCAMBIA3300 digested with HindⅢ (the default amount of the target vector is 80 ng, and the volume is converted according to the concentration); 3.75 μL of homologous recombination enzyme; ddH2O, supplemented to 10 μL, reaction system: 45°C, 30 min; in step (5), a 35S small promoter is present downstream of the PagBZR1 promoter itself and at the 5' end of the PagmBZR1 gene, so that the PagmBZR1 gene is efficiently expressed in poplar; a strong terminator NOS is assembled at the 3' end of the PagmBZR1 gene to effectively terminate the transcription of the PagmBZR1 gene.

[0029] Another object of the present invention is to provide genetic transformation of the transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length.

[0030] The above object of the present invention is achieved through the following technical solutions:

[0031] The invention discloses a genetic transformation of a transcription factor gene PagBZR1 for cooperatively regulating wood yield and wood fiber length of poplar, and the steps are as follows: the constructed activation expression vector PagBZR1pro-PagmBZR1-VP16 and the inhibition expression vector PagBZR1pro-PagmBZR1-SRDX are transferred into Agrobacterium EHA105 by a cold shock method, and the PagmBZR1 gene is transferred into 84K poplar by an Agrobacterium-mediated leaf disc transformation method.

[0032] Another object of the present invention is to provide an application of a transcription factor gene PagBZR1 for synergistically regulating poplar wood yield and wood fiber length.

[0033] The above object of the present invention is achieved through the following technical solutions:

[0034] The application of the transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length in regulating the growth and development of poplar, especially in regulating the development of poplar vascular tissue and wood formation.

[0035] Advantages of the present invention:

[0036] The invention uses 84K silver gland poplar as material and clones the PagmBZR1 gene; at the same time, an activation expression vector PagBZR1pro-PagmBZR1-VP16 and an inhibition expression vector PagBZR1pro-PagmBZR1-SRDX are constructed, and a 35S small promoter is provided at the downstream of the PagBZR1 promoter itself and the 5' end of the PagmBZR1 gene, so that the PagmBZR1 gene is efficiently expressed in the poplar, thereby regulating the development of the poplar vascular tissue and the wood formation.

[0037] Compared with the prior art, the present invention transfers the PagmBZR1 gene into poplars. Compared with the wild type, the transgenic poplars with activated expression of PagmBZR1 have significantly increased plant height, significantly thickened stems, significantly increased cell layers of stem vascular tissues, significantly increased wood fiber length and width, and significantly deposited and thickened secondary cell walls, while the phenotype of transgenic poplars with inhibited expression of PagmBZR1 is the opposite. This indicates that the transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length is an important regulatory factor that controls the development of poplar vascular tissues. The PagBZR1 gene can significantly improve plant growth, and can promote vascular tissue development and wood formation, and has important application value in the fields of forestry genetic engineering and forestry engineering.

[0038] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but this does not mean to limit the scope of protection of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a schematic diagram of the structure of the plant activation expression vector PagBZR1pro-PagmBZR1-VP16 in Example 1 of the present invention.

[0040] Figure 2 It is a schematic diagram of the structure of the plant inhibition expression vector PagBZR1pro-PagmBZR1-SRDX in Example 1 of the present invention.

[0041] Figure 3 This is a comparison of plant height and ground stem phenotypes of transgenic poplars with activated and inhibited expression of PagmBZR1 and non-transgenic poplars in Example 1 of the present invention.

[0042] Figure 4 This is a fluorescence quantitative PCR detection diagram of the transcription level of transgenic poplars with activated expression and inhibited expression of PagmBZR1 in Example 1 of the present invention.

[0043] Figure 5-1 It is a comparison diagram of semi-thin sections of vascular tissues of transgenic poplars with activated and inhibited expression of PagmBZR1 and non-transgenic poplars in Example 1 of the present invention.

[0044] Figure 5-2 It is a statistical graph of the phloem thickness, cambium cell layer number and xylem cell layer number of the vascular tissue of the transgenic poplars with activated expression and inhibited expression of PagmBZR1 and the non-transgenic poplars in Example 1 of the present invention.

[0045] Figure 6 This is a comparison diagram of the wood fiber length and width of transgenic poplars with activated and inhibited expression of PagmBZR1 and non-transgenic poplars in Example 1 of the present invention.

[0046] Figure 7 This is a comparison of the thickness of the secondary cell wall of wood fibers of transgenic poplars with activated and inhibited expression of PagmBZR1 and non-transgenic poplars in Example 1 of the present invention. DETAILED DESCRIPTION

[0047] The present invention is further described below in conjunction with specific examples. Operations not described in detail in the following examples can be implemented by referring to molecular cloning and the instructions for use of related kits.

[0048] Example 1

[0049] Step (1) Cloning of PagmBZR1 gene

[0050] Total RNA of 84K (P. alba X P. glandulosa) was extracted from tissue culture seedlings using RNeasy Plant Mini Kit and RNase-free DNase I Kit (Qiagen, Hilden, Germany). 2.0 μg of RNA was extracted from each sample and the first strand of cDNA was synthesized using SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Primers (amplicon including start codon and stop codon) were designed with reference to the published genome sequence of P. trichocarpa and gene amplification was performed using Primer3 software. The bzr1-D gain-of-function mutant was used to mutate the phosphorylation site of GSK-3 kinase and the gene was named PagmBZR1.

[0051] Among them, the PagmBZR1 CDS forward primer is shown in sequence 1 in Table 1;

[0052] Table 1

[0053] name Sequence 1 PagmBZR1 CDS forward primer ATGACGTCAGATGGGGCAAC

[0054] The PagmBZR1 CDS reverse primer is shown as Sequence 2 in Table 2 ;

[0055] Table 2

[0056] name Sequence 2 PagmBZR1 CDS reverse primer ACTCTGAGCCTTGCCACTTC

[0057] The high-fidelity PCR reaction system was as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5 μL, forward primer (10 μM) 0.15 μL, reverse primer (10 μM) 0.15 μL, template (84K poplar cDNA) 0.8 μL, sterile ddH2O to 15 μL, reaction procedure: pre-denaturation at 98°C, 1 min; (denaturation at 98°C, 10 s; annealing at 56°C, 15 s; extension at 72°C, 2 min) for a total of 35 cycles; final extension at 72°C, 3 min;

[0058] The final gene cDNA sequence obtained was 915 bp, and the sequence is shown in Sequence 3 in Table 3 (SEQ PagmBZR1 gene cDNA: 915 bp), see Table 3 below;

[0059] Table 3

[0060]

[0061] The protein sequence compiled and expressed is shown in Sequence 4 in Table 4;

[0062] Table 4

[0063]

[0064] Step (2) Construction of plant expression vector of PagmBZR1 gene

[0065] The activation expression and inhibition expression vectors of the PagBZR1 gene were constructed using cloning technology, and the vector-specific PCR primers were designed using Oligo7 software. The previously amplified PagmBZR1 was used as a template for PCR amplification; wherein the PagmBZR1 vector-specific forward primer is shown in Sequence 5 in Table 5;

[0066] Table 5

[0067] name Sequence 5 PagmBZR1 CDS specific forward primer ACAATTACAATTACCATGACGTCAGATGGGGCAACC

[0068] The PagmBZR1 vector-specific reverse primer is shown in Sequence 6 in Table 6;

[0069] Table 6

[0070] name Sequence 6 PagmBZR1 CDS-specific reverse primer GAATTCCTGCAGCCCACTCTGAGCCTTGCCACTTCC

[0071] The CDS of the PagmBZR1 gene was constructed into the target vector, the target vector was pCAMBIA3300 (SEQ entry vector pCAMBIA3300: 10177 bp); the target vector sequence is shown in Sequence 7 in Table 7;

[0072] Table 7

[0073]

[0074]

[0075]

[0076]

[0077] The target vector needs to be digested with HindⅢ enzyme first: the digestion system is as follows: 5 ng of target vector pCAMBIA3300 (volume converted according to concentration); 3 μL of HindⅢ enzyme; 3 μL of 10x digestion buffer; ddH2O is added to 30 μL; reaction system: 37°C, 30 min; through homologous recombination reaction, the target gene with vector-specific primers at both ends is constructed into the plant expression vector pCAMBIA3300, and the sequence of the final vector constructed is shown in Sequence 8 in Table 8;

[0078] Homologous recombination reaction system: 80 ng of pCAMBIA3300 digested with HindⅢ (the default amount of the target vector is 80 ng, and the volume is converted according to the concentration); (target fragment mass / number of target fragment bases) / (target vector amount 80 ng / number of target vector bases) = 3; obtain the mass of the target fragment, and convert the volume of the target fragment according to the concentration of the target fragment; 3.75 μL of homologous recombination enzyme; ddH2O is supplemented to 10 μL; reaction system: 37°C, 30 min; the VP16 coding sequence is connected to the PagmBZR1 gene coding sequence to construct the plant activation expression vector PagBZR1pro-PagmBZR1-VP16. The VP16 transcription activation domain consists of approximately 60 amino acid residues, which promotes transcription of downstream target genes by fusion with transcription factors.

[0079] Table 8

[0080]

[0081]

[0082]

[0083]

[0084]

[0085] The target vector needs to be digested with HindⅢ enzyme first: the digestion system is as follows: 5 ng of target vector pCAMBIA3300 (volume converted according to concentration); 3 μL of HindⅢ enzyme; 3 μL of 10x digestion buffer; ddH2O is added to 30 μL; reaction system: 37°C, 30 min; through homologous recombination reaction, the target gene with vector-specific primers at both ends is constructed into the plant expression vector pCAMBIA3300, and the sequence of the final vector constructed is shown in Sequence 9 in Table 9;

[0086] Homologous recombination reaction system: 80ng of pCAMBIA3300 digested with HindⅢ (the default amount of the target vector is 80ng, and the volume is converted according to the concentration); (target fragment mass / number of bases of the target fragment) / (target vector amount 80ng / number of bases of the target vector) = 3; the mass of the target fragment is obtained, and the volume of the target fragment is converted according to the concentration of the target fragment; the amount of homologous recombination enzyme is 3.75μL; ddH2O is supplemented to 10μL; reaction system: 37℃, 30min; the plant-specific EAR-motif domain (SRDX) is connected to the coding sequence of the PagmBZR1 gene to construct the plant repression expression vector PagBZR1pro-PagmBZR1-SRDX. The plant-specific EAR-motif domain (SRDX) consists of 12 amino acids, and fusion with the C-terminus of the transcription factor can convert the activator into a repressor or increase the repression ability of the repressor, thereby inhibiting the expression of the downstream target gene of the transcription factor.

[0087] Table 9

[0088]

[0089]

[0090]

[0091]

[0092]

[0093] The vectors finally constructed were PagBZR1pro-PagmBZR1-VP16 and PagBZR1pro-PagmBZR1-SRDX. There were 35S small promoters at the downstream of PagBZR1's own promoter and at the 5' end of PagmBZR1 gene, which could make PagmBZR1 gene highly expressed in poplar. There was strong terminator NOS assembled at the 3' end of PagmBZR1 gene, which could effectively terminate the transcription of PagmBZR1 gene. Figure 1 As shown, it is a schematic diagram of the structure of the plant activation expression vector PagBZR1pro-PagmBZR1-VP16 in Example 1 of the present invention; Figure 2 , which is a schematic diagram of the structure of the plant inhibitory expression vector PagBZR1pro-PagmBZR1-SRDX in Example 1 of the present invention;

[0094] The vector finally constructed was assembled with phosphinothricin acetyltransferase PAT, which was used as a screening marker for transgenic poplars. Glufosinate can be used to screen transgenic poplars. PCR detection and sequencing verification confirmed that the activation expression vector was successfully constructed and named PagBZR1pro-PagmBZR1-VP16 (sequence 8) (SEQ PagBZR1pro-PagmBZR1-VP16: 12042bp); the inhibition expression vector was successfully constructed and named PagBZR1pro-PagmBZR1-SRDX (sequence 9) (SEQ PagBZR1pro-PagmBZR1-SRDX: 11844bp);

[0095] Step (3) Genetic transformation of PagmBZR1 gene

[0096] The constructed target vector carrying the PagmBZR1 gene was transferred into Agrobacterium EHA105 by the cold shock method, and the PagmBZR1 gene was transferred into 84K poplar by the Agrobacterium-mediated leaf disc method. The transformation steps were as follows: the 84K tissue culture seedlings used for genetic transformation were cultured at a temperature of 22-25°C, a light intensity of 16 / 8h (day / night), and a light intensity of 50μmol*m -2* s -1 The target vector carrying the PagmBZR1 gene was transferred into Agrobacterium EHA105. The Agrobacterium infected 84K leaf discs at OD600 = 0.6-0.8. The infected leaf discs were co-cultured in a co-culture medium (WPMS (Woody Plant Medium Screen) containing 100 μM acetosyringone (AS)) at a temperature of 22±2°C in the dark for 2 days. The co-cultured leaf discs were transferred to a screening medium (WPMS, supplemented with 1.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.1 mg / L kinetin) containing 5 mg / L phosphinothricin and 200 mg / L Timentin, and the dark culture was continued for about one and a half months. The rice-sized callus was transferred to a screening medium (WPMS, supplemented with 1.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.1 mg / L kinetin) containing 5 mg / L phosphinothricin. ammonium) and 200 mg / L Timentin differentiation medium (WPMD, supplemented with 0.05 mg / L naphthaleneacetic acid (NAA), 0.5 mg / L 6-benzylaminopurine (6-BA)) and 0.05 mg / L thidiazuron (TDZ) until resistant adventitious buds were induced, and the resistant adventitious buds were transferred to rooting medium, and DNA from leaves of rooted plants was extracted and verified by PCR;

[0097] Step (4) Application of PagmBZR1 gene

[0098] Wild-type 84K and transgenic poplars were cultured under the same growth conditions for 60 days, the external growth status of the plants was observed, and the stems were sliced ​​to observe the accumulation of wood biomass, and the length of wood fiber cells was compared using the wood separation method;

[0099] The experimental results are as follows Figures 3 to 7 As shown, Figure 3 As shown, it is a comparison diagram of plant height and ground stem phenotype of transgenic poplars with activated expression of PagmBZR1 and inhibited expression of PagmBZR1 and non-transgenic poplars in Example 1 of the present invention (Nikon Z30, distance 1m, focal length 16-50mm), wherein the upper figure is a comparison diagram of plant height of transgenic poplars with activated expression of PagmBZR1 and inhibited expression of PagmBZR1 and non-transgenic poplars, and the lower figure is a comparison diagram of ground stem phenotype of transgenic poplars with activated expression of PagmBZR1 and inhibited expression of PagmBZR1 and non-transgenic poplars; the leftmost is a non-transgenic poplar, one of which was selected for mapping, and the statistical data is three replicates, mBZR1-VP16 is a transgenic plant transformed with a PagmBZR1 activation expression vector; mBZR1-SRDX is a transgenic plant transformed with a PagmBZR1 inhibition expression vector; as shown Figure 4 As shown in , it is the result of fluorescence quantitative PCR experiment on transcription level of transgenic poplars with PagmBZR1 activated expression and PagmBZR1 inhibited expression in Example 1 of the present invention. The bar graph in the figure shows the expression amount of PagBZR1 gene in wild type (84K) and transgenic poplars respectively (mBZR1-VP16 is PagmBZR1 activated expression vector, wherein 1, 2, 3 are three strains; mBZR1-SRDX is PagmBZR1 inhibited expression vector, wherein 1, 2, 3 are three strains); as shown in 5-1, it is a comparison diagram of semi-thin sections of vascular tissue of transgenic poplars with PagmBZR1 activated expression and PagmBZR1 inhibited expression and non-transgenic poplars in Example 1 of the present invention (ThermoFisher EVOS FLAuto2, taken under 10x conditions), Figure 5-1 In the figure, the wild type is on the far left, and the transgenic poplar is on the right; Figure 5-2 As shown, it is a statistical diagram of the thickness of phloem, the number of cambium cell layers and the number of xylem cell layers of the vascular tissue of transgenic poplars with activated expression and inhibited expression of PagmBZR1 and non-transgenic poplars in Example 1 of the present invention; Figure 6As shown, it is a comparison diagram of the wood fiber cell sizes of the transgenic poplar with activated expression of PagmBZR1 and inhibited expression of PagmBZR1 and the non-transgenic poplar in Example 1 of the present invention, wherein A is a comparison diagram of the wood fiber cell sizes of the transgenic poplar with activated expression of PagmBZR1 and inhibited expression of PagmBZR1 and the non-transgenic poplar in Example 1 of the present invention (ThermoFisher EVOS FLAuto2, photographed under 10x conditions); B is a statistical diagram of the length of the wood fiber cells of the wild type (84k) and the transgenic poplar; C is a statistical diagram of the width of the wood fiber cells of the wild type (84k) and the transgenic poplar (Thermo Fisher EVOS FLAuto2, photographed under 10x conditions); as shown Figure 7 , which are comparison diagrams of the thickness of the secondary cell wall of wood fibers of transgenic poplars with activated expression of PagmBZR1 and inhibited expression of PagmBZR1 and non-transgenic poplars in Example 1 of the present invention, A is a comparison diagram of the thickness of the secondary cell wall of wood fibers of transgenic poplars with activated expression of PagmBZR1 of the present invention and wild-type 84K poplar; B is a comparison diagram of the thickness of the secondary cell wall of wood fibers of transgenic poplars with inhibited expression of PagmBZR1 of the present invention and wild-type 84K poplar (JEOL JEM-1230, JAPAN, photographed under 200000×); wherein, the left side is the wild type, the right side is the transgenic poplar, and C is a bar graph showing the statistical graph of the thickness of the secondary cell wall of wood fibers of the wild type (84k) and transgenic poplars.

[0100] The results show that compared with the wild type, the transgenic poplars with activated expression of PagmBZR1 have significantly increased plant height, significantly thickened ground stems, significantly increased cell layers in stem vascular tissue, significantly increased wood fiber length and width, and significantly deposited and thickened secondary cell walls, while the phenotype of transgenic poplars with suppressed expression of PagmBZR1 is the opposite. This indicates that the transcription factor gene PagBZR1, which coordinately regulates poplar wood yield and wood fiber length, is an important regulatory factor controlling the development of poplar vascular tissue. The PagBZR1 gene can significantly improve plant growth, promote vascular tissue development and wood formation, and has important application value in the fields of forest genetic engineering and forestry engineering.

[0101] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A transcription factor gene PagmBZR1 that coordinately regulates poplar wood yield and wood fiber length, the nucleotide sequence of which is shown in sequence 3 in the sequence table.

2. The expression protein of the transcription factor gene PagmBZR1 that coordinately regulates poplar wood yield and wood fiber length as described in claim 1, whose amino acid sequence is shown in Sequence 4 in the sequence listing.

3. A plant expression vector of the transcription factor gene PagBZR1 that synergistically regulates poplar wood yield and wood fiber length, comprising a plant activation expression vector PagBZR1pro-PagmBZR1-VP16, whose nucleotide sequence is shown in sequence 8 in the sequence list; and a plant inhibition expression vector PagBZR1pro-PagmBZR1-SRDX, whose nucleotide sequence is shown in sequence 9 in the sequence list.

4. A method for constructing a plant expression vector of the transcription factor gene PagBZR1 for synergistically regulating poplar wood yield and wood fiber length as claimed in claim 3, comprising the following steps: (1) Cloning of PagmBZR1 gene Using 84K silver gland poplar as material, the total RNA of tissue culture seedling 84K was extracted using RNeasy Plant Mini kit and RNase-free DNase I kit; RNA was taken and the first strand of cDNA was synthesized using SuperScript III first-strand synthesissystem; Primers were designed using Primer3 software with reference to the published genome sequence of Populus trichocarpa for gene amplification, and the gene mutation mode of the mutant was obtained using the bzr1-D function, the GSK-3 kinase phosphorylation site was mutated, and the gene was named PagmBZR1; (2) Construction of plant expression vector of PagmBZR1 gene The activation expression and inhibition expression vectors of PagBZR1 gene were constructed by cloning technology, and the vector-specific PCR primers were designed using Oligo7 software. The previously amplified PagmBZR1 was used as a template for PCR amplification. The CDS of PagmBZR1 gene was constructed into the destination vector, which was pCAMBIA3300; (3) Digest the target vector with Hind III enzyme; (4) The target gene with vector-specific primers at both ends was constructed into the plant expression vector pCAMBIA3300 through homologous recombination reaction, and the transcription activation VP16 coding sequence and the transcription inhibition SRDX sequence were connected behind the target gene respectively. The final vectors constructed were PagBZR1pro-PagmBZR1-VP16 and PagBZR1pro-PagmBZR1-SRDX.

5. The method for constructing the plant expression vector of the transcription factor gene PagBZR1 for coordinated regulation of poplar wood yield and wood fiber length according to claim 4, characterized in that: In step (1), the PagmBZR1 CDS forward primer is shown as sequence 1 in the sequence table, and the PagmBZR1 CDS reverse primer is shown as sequence 2 in the sequence table; the high-fidelity PCR reaction system is as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5 μL, 10 μM PagmBZR1 CDS forward primer 0.15 μL, 10 μM PagmBZR1 CDS reverse primer 0.15 μL, 84K poplar cDNA template 0.8 μL, sterile ddH2O is added to 15 μL, reaction procedure: 98°C, 1 min; 72°C, 3 min.

6. The method for constructing the plant expression vector of the transcription factor gene PagBZR1 for coordinated regulation of poplar wood yield and wood fiber length according to claim 5, characterized in that: In step (2), the PagmBZR1 vector-specific forward primer is shown as Sequence 5 in the sequence listing, and the PagmBZR1 vector-specific reverse primer is shown as Sequence 6 in the sequence listing.

7. The method for constructing the plant expression vector of the transcription factor gene PagBZR1 for coordinated regulation of poplar wood yield and wood fiber length according to claim 6, characterized in that: In step (3), the enzyme digestion system is as follows: 5 ng of target vector pCAMBIA3300; 3 μL of HindⅢ enzyme; 3 μL of 10×green buffer; ddH2O, made up to 30 μL, reaction system: 37°C, 30 min.

8. The method for constructing the plant expression vector of the transcription factor gene PagBZR1 for coordinated regulation of poplar wood yield and wood fiber length according to claim 7, characterized in that: In step (4), the homologous recombination reaction system: 80 ng of pCAMBIA3300 digested with HindⅢ, the default amount of the target vector is 80 ng, and the volume is converted according to the concentration; 3.75 μL of homologous recombination enzyme; ddH2O, supplemented to 10 μL, reaction system: 37°C, 30 min; in step (5), a 35S small promoter is present downstream of the PagBZR1 promoter itself and at the 5' end of the PagmBZR1 gene, so that the PagmBZR1 gene is efficiently expressed in poplar; a strong terminator NOS is assembled at the 3' end of the PagmBZR1 gene to effectively terminate the transcription of the PagmBZR1 gene.

9. The genetic transformation of the transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length according to claim 1 and / or 2, the steps of which are as follows: by cold shock method, the constructed activation expression vector PagBZR1pro-PagmBZR1-VP16 and inhibition expression vector PagBZR1pro-PagmBZR1-SRDX are transferred into Agrobacterium EHA105, and by Agrobacterium-mediated leaf disc transformation method, the PagmBZR1 gene is transferred into 84K poplar.

10. Use of the transcription factor gene PagBZR1 for synergistically regulating poplar wood yield and wood fiber length according to claim 1 and / or 2 in regulating the growth and development of poplars, especially in regulating the development of poplar vascular tissue and wood formation.

Images