Application and method of arabidopsis thaliana cpk18 gene in improving plant resistance to copper stress

Abstract

The application discloses application and method of Arabidopsis thaliana CPK18 gene in improving copper stress resistance of plants, overexpresses the Arabidopsis thaliana CPK18 gene through genetic engineering technology, obtains an overexpression vector, transforms the overexpression vector into a strain, and obtains a CPK18 gene overexpression homozygous strain through screening, and then the copper resistance of the plant is obviously improved. The application confirms for the first time through experiments that the Arabidopsis thaliana CPK18 gene overexpression can improve the copper resistance of the plant, and in view of the correlation between the CPK18 gene and the copper resistance of the plant, it can be considered that the Arabidopsis thaliana CPK18 gene has potential application value in improving the copper resistance of the plant, and the application also lays a good theoretical foundation for cultivating copper-resistant crop varieties by using the CPK18 gene.

Description

Technical Field

[0001] This invention belongs to the field of plant breeding and genetic engineering technology, specifically relating to the application and method of Arabidopsis thaliana CPK18 gene in improving plant copper stress resistance. Background Technology

[0002] Copper, as a common trace element, has certain applications in agricultural production, such as as a fungicide and micronutrient fertilizer. However, excessive accumulation of copper in the soil can be toxic to crops, affecting their growth, yield, and quality, and consequently threatening the agricultural ecological environment and human health. The main sources of copper in soil include agricultural inputs, industrial emissions, and atmospheric deposition. With the acceleration of agricultural modernization in my country, the large-scale use of pesticides and fertilizers, as well as the development of the livestock industry, has led to a year-on-year increase in copper input into the soil. Simultaneously, industrial and mining activities and urban expansion have resulted in a large amount of copper-containing waste entering the soil, further exacerbating copper accumulation. Under acidic soil conditions, copper is more reactive and more easily absorbed by crops, thus increasing the risk of copper toxicity. Heavy metal pollution is an urgent issue for crop growth and protecting human food security. Researching the copper tolerance mechanisms of crops and cultivating copper-tolerant varieties is of significant practical importance for producing healthy food.

[0003] Calcium-dependent protein kinases (CDPKs / CPKs) are important protein kinases in plants. After recognizing Ca2+ signals, they participate in the regulation of various signaling pathways through substrate phosphorylation, thereby playing important biological functions. CPK18 is an important member of the Arabidopsis CDPK family. Genes in this family are closely related to the regulation of plant signaling pathways and their role in abiotic stress response; however, no reports have yet been found regarding the role of this gene in plant copper tolerance. Summary of the Invention

[0004] To address the aforementioned problems, the present invention aims to provide the application and method of the Arabidopsis thaliana CPK18 gene in improving plant copper stress resistance. This invention obtains a commercially available CPK18 gene mutant, and after PCR verification, obtains a homozygous mutant line. This homozygous mutant line exhibits higher copper sensitivity. Furthermore, this invention obtains a CPK18 gene overexpression vector, and subsequently obtains a homozygous overexpression system of the CPK18 gene, which exhibits higher copper resistance.

[0005] Application of Arabidopsis thaliana CPK18 gene in improving plant resistance to copper stress. The sequence of Arabidopsis thaliana CPK18 gene is shown in SEQ ID NO:1. Homozygous overexpression lines of Arabidopsis thaliana CPK18 gene have an antagonistic effect on copper.

[0006] Preferably, the root length inhibition effect of the homozygous overexpression line of Arabidopsis thaliana CPK18 gene under copper treatment is significantly lower than that of the wild-type line and the mutant line.

[0007] Preferably, the homozygous mutant line of the Arabidopsis thaliana CPK18 gene showed significantly higher root length inhibition under copper treatment than the wild type.

[0008] Preferably, the plant is Arabidopsis thaliana.

[0009] A method for cultivating copper-resistant plants, comprising:

[0010] The overexpression vector containing the Arabidopsis thaliana CPK18 gene was transformed into plants via inflorescence infection to obtain copper-resistant plants.

[0011] Preferably, the overexpression vector includes pFGC121-CPK18, which is obtained by digesting the vector plasmid with enzymes and then ligating the Arabidopsis thaliana CPK18 gene into the UBQ10 promoter of the vector plasmid.

[0012] Preferably, the vector plasmid is the pFGC121 plasmid.

[0013] Preferably, the amplification primers for the Arabidopsis thaliana CPK18 gene include:

[0014] CPK18-F:TGATTAACAGGGATCCATGGGTCTCTGTTTCTCG;

[0015] CPK18-R: TGCTCACCATGGATCCTAAGACTTGAGAAACATAT TCAAACCTAAC.

[0016] The beneficial effects of this invention are as follows: This invention provides the application of the Arabidopsis thaliana CPK18 gene in improving plant copper stress resistance. Through genetic engineering technology, the Arabidopsis thaliana CPK18 gene is overexpressed to obtain an overexpression vector. This overexpression vector is transformed into plant lines, and after screening, homozygous overexpression lines of the CPK18 gene are obtained, thus significantly improving the copper resistance of the plants. This invention is the first experimental confirmation that overexpression of the Arabidopsis thaliana CPK18 gene can improve copper resistance in plants. Given the correlation between the CPK18 gene and plant copper resistance, it can be considered that the Arabidopsis thaliana CPK18 gene has potential application value in improving plant copper resistance. This invention also lays a good theoretical foundation for using the CPK18 gene to cultivate copper-tolerant crop varieties. Attached Figure Description

[0017] Figure 1This is a schematic diagram of the gene map and T-DNA insertion site of CPK18 (At4G36070);

[0018] Figure 2 Figure showing the results of conventional PCR identification of homozygous lines of CPK18 mutants;

[0019] Figure 3 The root length changes of wild-type lines Col-0, CPK18 mutant lines cpk18-1, cpk18-2, and CPK18 overexpression lines CPK18-OE#3, CPK18-OE#4 under 0 μM Cu treatment;

[0020] Figure 4 The root length changes of wild-type lines Col-0, CPK18 mutant lines cpk18-1, cpk18-2, and CPK18 overexpression lines CPK18-OE#3, CPK18-OE#4 under 75 μM Cu treatment;

[0021] Figure 5 The root length changes of wild-type lines Col-0, CPK18 mutant lines cpk18-1, cpk18-2, and CPK18 overexpression lines CPK18-OE#3, CPK18-OE#4 under 100 μM Cu treatment;

[0022] Figure 6 Root length data of wild-type lines Col-0 and CPK18, mutant lines cpk18-1 and cpk18-2, and CPK18 overexpression lines CPK18-OE#3 and CPK18-OE#4 under Cu treatment;

[0023] Figure 7 Fresh weight data of wild-type lines Col-0 and CPK18, mutant lines cpk18-1 and cpk18-2, and CPK18 overexpression lines CPK18-OE#3 and CPK18-OE#4 under Cu treatment. Detailed Implementation

[0024] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc., used in the embodiments of the present invention are commercially available; unless otherwise specified, all technical means in the embodiments of the present invention are conventional means well known to those skilled in the art.

[0025] Example 1: Obtaining Arabidopsis thaliana CPK18 gene mutant lines cpk18-1, cpk18-2 and transgenic lines CPK18-OE#3, CPK18-OE#4

[0026] I. Arabidopsis thaliana CPK18 gene

[0027] The CUS sequence of the CPK18 gene was obtained from the Arabidopsis thaliana database. It is 1686 bp in length and encodes a protein containing 561 amino acids. The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0028] II. Obtaining Arabidopsis CPK18 gene mutant lines cpk18-1, cpk18-2 and transgenic lines CPK18-OE#3, CPK18-OE#4

[0029] 1. Obtaining Arabidopsis thaliana CPK18 gene overexpression lines

[0030] (1) Construction of a constitutive expression promoter UBQ10-driven overexpression vector for CPK18 (UBQ10:CPK18): Gene-specific primers were designed based on the CUS sequence of the Arabidopsis CPK18 gene, and their sequences are as follows (5'-3'):

[0031] CPK18-F:TGATTAACAGGGATCCATGGGTCTCTGTTTCTCG (SEQ ID NO: 2);

[0032] CPK18-R: TGCTCACCATGGATCCTAAGACTTGAGAAACATAT TCAAACCTAAC (SEQ ID NO: 3);

[0033] The CPK18 gene was amplified by PCR, and the amplification product was recovered and purified. The pFGC121 plasmid was digested with the restriction endonuclease BamHI, and the CPK18 gene was cloned into the pFGC121-GFP-FLAG vector to obtain the recombinant plasmid, which is pFGC121-CPK18-GFP-FLAG plasmid.

[0034] (2) The pFGC121-CPK18-GFP-FLAG recombinant plasmid was confirmed by plasmid PCR sequencing.

[0035] (3) The overexpression vector pFGC121-CPK18 was transformed into Agrobacterium EHA105 competent cells, and then transformed into Arabidopsis thaliana by inflorescence infection method to obtain CPK18 gene overexpression lines.

[0036] 2. Screening of CPK18 transgenic homozygous lines

[0037] (1) Seeds of a single plant that has been infected with the CPK18 gene overexpression line are used as the T0 generation;

[0038] (2) T0 generation seeds were cultured on a medium containing herbicide (0.001% glufosinate), and green seedlings were selected and cultured in nutrient soil medium. Seeds received from a single plant were T1 generation.

[0039] (3) T1 generation seeds were cultured on a medium containing herbicide, and green seedlings from the offspring with a green seedling: yellow seedling segregation ratio of 3:1 were selected and planted in nutrient soil medium. Seeds received from a single plant were T2 generation.

[0040] (4) T2 generation seeds were cultured on a medium containing herbicide. Lines with green seedlings in their offspring were selected and planted in nutrient soil medium. The seeds obtained were the seeds of homozygous transgenic lines overexpressing the CPK18 gene, and were named CPK18-OE#3 and CPK18-OE#4, respectively.

[0041] III. PCR Validation Analysis of Arabidopsis CPK18 Gene Mutant Lines cpk18-1 and cpk18-2

[0042] The mutants were identified using flanking sequences and insert vector sequences provided by the Tair website. Primers were designed using SnapGene and DNA editor software, and PCR identification was performed. The primers used in the PCR experiments were (5'-3'):

[0043] CPK18-ID-F:CACCATTGGGAAATTGCTCG(SEQ ID NO:4)

[0044] CPK18-ID-R:CTACCATTCTGCTCTCAGGG(SEQ ID NO:5)

[0045] LBa1:TGGTTCACCGTAGTGGGCCATCG(SEQ ID NO:6)

[0046] Because the T-DNA insertion mutant contains a SALK T-DNA insertion fragment, full-length PCR cannot be performed using the protein end primers. However, PCR using the SALK T-DNA insertion fragment-specific primer LBa1 with the end primers can yield the recombinant fragment. The results are as follows: Figure 2 As shown, cpk18-1 and cpk18-2 both lack the full-length fragment but have recombinant fragments, while the corresponding wild-type has the full-length fragment but no recombinant fragments, indicating that cpk18-1 and cpk18-2 are homozygous mutants.

[0047] Example 2: Functional analysis experiment of Arabidopsis thaliana CPK18 under copper treatment

[0048] 1. Preparation of culture medium

[0049] (1) Preparation of 1 / 2MS medium for plant tissue culture: Weigh 2.22 g / L MS powder, 20 g / L sucrose, and 0.5 g / L MES, dissolve them in pure water and make up to volume, adjust the pH to 5.80, and add 8 g / L agar;

[0050] Sterilization: Autoclave at 121℃ for 20 minutes;

[0051] (2) After the culture medium is sterilized, place it in a clean bench when it cools to 50-60℃. Add 100mM copper sulfate stock solution to the 1 / 2MS copper-containing culture medium to make the final copper concentration in the culture medium 75-100μM. (3) Pour the culture medium into 13cm plastic square dishes, dispensing about 50ml into each dish. After the culture medium solidifies, seal it in a sterile bag for later use.

[0052] 2. Experimental Materials

[0053] Figure 1 This is a schematic diagram of the CPK18 (At4G36070) gene map and T-DNA insertion site. Figure 1 In this example, the boxes represent exons, and the lines represent introns. The T-DNA insertion mutants cpk18-1 (SALK_061352C) and cpk18-2 (SALK_069578) used in this example were purchased from the Arabidopsis thaliana Tair website. The cpk18-1 T-DNA is inserted into an exon of the CPK18 genome, while the cpk18-2 is inserted into an intron. The overexpression homozygous lines CPK18-OE#3 and CPK18-OE#4 obtained in Example 1 were also used.

[0054] 3. Seed disinfection

[0055] Seeds of Arabidopsis thaliana wild-type (Col-0), CPK18 mutant lines cpk18-1, cpk18-2, and overexpression lines CPK18-OE#3 and CPK18-OE#4 of the same size and fullness were selected at the same time and placed in 1.5 mL centrifuge tubes. 1 mL of disinfectant (20% bleach + 0.1% Tween 20) was added, and the mixture was vortexed for 15 minutes. The tubes were then rinsed 5-8 times with sterile pure water in a laminar flow hood.

[0056] 4. Copper treatment, root length measurement, and fresh weight measurement

[0057] Sterilized seeds were spotted onto 1 / 2 MS medium containing 75 and 100 μM Cu and without Cu. The medium was then incubated at 4°C for 7 days, followed by 16 h (light) / 8 h (dark). Wild-type, CPK18 mutant, and overexpression lines were photographed and weighed after 6 days of culture.

[0058] IV. Experimental Results

[0059] Under conditions without Cu treatment, there was no significant difference in growth between wild-type and CPK18 mutant lines or overexpression lines. Figure 3 However, under Cu treatment, the mutant lines had shorter roots than the wild type, and the CPK18 gene overexpression lines had significantly longer roots than the wild type. Figure 4 , 5 These results indicate that loss of CPK18 function leads to decreased copper tolerance in Arabidopsis thaliana, while overexpression of CPK18 enhances copper tolerance, meaning that CPK18 positively regulates copper tolerance.

[0060] Figure 6 This data represents the root length of wild-type lines Col-0 and CPK18, mutant lines cpk18-1 and cpk18-2, and CPK18 overexpression lines CPK18-OE#3 and CPK18-OE#4 under Cu treatment. Figure 7 Fresh weight data of wild-type lines Col-0 and CPK18, mutant lines cpk18-1 and cpk18-2, and CPK18 overexpression lines CPK18-OE#3 and CPK18-OE#4 under Cu treatment.

[0061] from Figure 6 As can be seen, the higher the Cu concentration, the shorter the root length of the wild-type lines, mutant lines, and overexpression lines. Under the same Cu concentration, the root length of the CPK18 overexpression lines CPK18-OE#3 and CPK18-OE#4 is greater than that of the wild-type lines Col-0 and CPK18, while the root length of the wild-type lines Col-0 and CPK18 is greater than that of the mutant lines cpk18-1 and cpk18-2.

[0062] from Figure 7 It can be seen that the higher the concentration of Cu, the smaller the fresh weight of the wild-type lines, mutant lines, and overexpression lines. Under the same concentration of Cu, the fresh weight of the CPK18 overexpression lines CPK18-OE#3 and CPK18-OE#4 is greater than that of the wild-type lines Col-0 and CPK18, and the fresh weight of the wild-type lines Col-0 and CPK18 is greater than that of the mutant lines cpk18-1 and cpk18-2.

[0063] It is understood that the above embodiments only illustrate preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can freely combine the above technical features without departing from the concept of the present invention, and can also make several modifications and improvements, all of which fall within the protection scope of the present invention. Therefore, all equivalent transformations and modifications made with respect to the scope of the claims of the present invention should fall within the scope of the claims of the present invention.

Claims

1. The application of the Arabidopsis thaliana CPK18 gene in improving plant copper stress resistance, characterized in that, Arabidopsis thaliana CPK18 The gene sequence is shown in SEQ ID NO:1, and the Arabidopsis thaliana is described. CPK18 The homozygous overexpression lines of the gene exhibited antagonistic effects against copper; the plant in question is Arabidopsis thaliana.

2. The application of the Arabidopsis CPK18 gene according to claim 1 in improving plant copper stress resistance, characterized in that, The root length inhibition effect of the homozygous overexpression of the Arabidopsis thaliana CPK18 gene under copper treatment was significantly lower than that of the wild-type and mutant lines.

3. The application of the Arabidopsis CPK18 gene according to claim 1 in improving plant copper stress resistance, characterized in that, The homozygous mutant lines of the Arabidopsis thaliana CPK18 gene showed significantly higher root length inhibition under copper treatment than the wild type.

4. A method for cultivating copper-resistant plants, characterized in that, include: Containing Arabidopsis CPK18 The gene overexpression vector was transformed into plants using the inflorescence infection method to obtain copper-resistant plants; the plant was Arabidopsis thaliana. CPK18 The gene sequence is shown in SEQ ID NO:

1.

5. The method for cultivating copper-resistant plants according to claim 4, characterized in that, The overexpression vector includes pFGC121-CPK18, which is derived from the vector plasmid through enzyme digestion and then expressed as Arabidopsis thaliana. CPK18 The gene was obtained after being ligated to the UBQ10 promoter in the vector plasmid.

6. The method for cultivating copper-resistant plants according to claim 5, characterized in that, The vector plasmid is pFGC121 plasmid.

7. The method for cultivating copper-resistant plants according to claim 4, characterized in that, Arabidopsis thaliana CPK18 The primers for gene amplification are: CPK18-F:TGATTAACAGGGATCCATGGGTCTCTGTTTCTCG; CPK18-R: TGCTCACCATGGATCCTAAGACTTGAGAAACATATTCAAACCTAAC.

Images