Rice lodging-resistant and yield-related protein strong1 and its coding gene and application
By regulating the expression and activity of the STRONG1 protein in rice, the problem of lodging in rice was solved, lodging resistance and yield were improved, the bottleneck of rice yield increase was broken, and high-yield and high-quality rice breeding was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-18
- Publication Date
- 2026-04-07
AI Technical Summary
Rice yields are severely affected by lodging. Existing dwarf breeding methods are insufficient to further increase yields. Lodging leads to a yield reduction of 10% to 30% or even 50%, affecting mechanized harvesting and grain quality.
By knocking out or reducing the expression of the gene encoding the STRONG1 protein in rice, its activity and content can be regulated, thereby improving the plant's lodging resistance and yield.
It significantly improves the lodging resistance and yield of rice, reduces the lodging rate, increases the yield per plant and the number of grains per panicle, and improves grain quality.
Smart Images

Figure BDA0005197781720000131 
Figure HDA0005197781820000011 
Figure HDA0005197781820000012
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to STRONG1, a protein related to lodging resistance and yield in rice, its encoding gene, and its applications. Background Technology
[0002] Rice, as one of the world's most important food crops, accounts for nearly 50% of my country's total grain output annually, feeding about half of the world's population. However, in recent decades, rice production has faced enormous threats from declining arable land and population growth, making it extremely urgent to increase rice yield per unit area.
[0003] Many factors influence rice yield, with the three most important being the number of grains per panicle, the number of effective panicles, and the thousand-grain weight. In the 1960s, dwarf rice breeding played a crucial role in solving the problem of rice lodging. However, in recent years, dwarf rice breeding has reached a bottleneck, making it difficult to significantly increase rice yield. Studies show that rice yield increases with plant height, but this increase cannot be indefinite, as increased plant height leads to severe lodging. Lodging is a common and complex phenomenon in rice production, causing yield reductions of 10% to 30% annually, sometimes even reaching 50%. Lodging has become a major limiting factor in rice production, mainly occurring in the late grain-filling stage. It not only affects mechanized harvesting but also accelerates rice senescence, reduces yield, and affects grain quality, making it a major obstacle to simplified cultivation. Therefore, research on rice lodging is of great guiding significance for improving rice yield and promoting simplified cultivation. Summary of the Invention
[0004] The technical problem solved by this invention is to improve the lodging resistance and yield of plants, especially rice.
[0005] To address the above problems, this invention provides a method for improving plant lodging resistance and yield.
[0006] The method includes improving lodging resistance and yield in plants by knocking out or reducing or decreasing the expression of protein-coding genes in plants, and / or the activity and / or content of said proteins.
[0007] The protein is any of the following:
[0008] B1) Proteins with amino acid sequences as shown in SEQ ID NO:2;
[0009] B2) A protein having more than 80% identity and the same function as the protein shown in B1) obtained by substituting and / or deleting and / or adding amino acid residues.
[0010] B3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).
[0011] In this application, the plant may be rice.
[0012] To address the aforementioned problems, the present invention also provides a method for cultivating high lodging resistance and high yield.
[0013] The method includes knocking out, reducing, or decreasing the expression level of the gene encoding the aforementioned protein in the target plant, and / or the activity and / or content of the protein to obtain a plant with high lodging resistance and high yield, wherein the lodging resistance and / or yield of the plant with high lodging resistance and high yield are higher than those of the target plant.
[0014] In the above method, knocking out or reducing or decreasing the expression of the gene encoding the protein mentioned above in the plant includes introducing the nucleic acid molecule described in B1), the expression cassette described in B2), or the recombinant vector described in B3) into the target plant.
[0015] In the above text, the nucleic acid molecule may be the nucleic acid molecule described in SEQ ID NO:1.
[0016] To address the above problems, the present invention also provides the following applications.
[0017] The use of a protein, a substance that regulates the expression of the gene encoding the protein, or a substance that regulates the activity or content of the protein in any of the following;
[0018] A1) Improving the application of lodging resistance in grasses and / or preparing products that improve lodging resistance in grasses;
[0019] A2) Applications and / or preparations for increasing the yield of grasses;
[0020] The protein is any of the following:
[0021] F1) The amino acid sequence is that of the protein shown in SEQ ID NO:2;
[0022] F2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein described in F1) that has more than 80% identity with and has the same function as the protein shown in F1).
[0023] F3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of F1) or F2);
[0024] The substance that regulates the expression of the gene encoding the protein or the substance that regulates the activity or content of the protein is any one of the following:
[0025] B1) Nucleic acid molecules that encode the above proteins;
[0026] B2), an expression cassette containing the nucleic acid molecule described in B1);
[0027] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);
[0028] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);
[0029] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);
[0030] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);
[0031] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3);
[0032] B8) Nucleic acid molecules that inhibit, reduce, or downregulate the expression of genes encoding the aforementioned proteins, or inhibit, reduce, or downregulate the activity or content of the aforementioned proteins;
[0033] B9) The gene encoding the nucleic acid molecule described in B8);
[0034] B10), an expression cassette containing the gene encoding described in B9);
[0035] B11), a recombinant vector containing the encoding gene described in B9), or a recombinant vector containing the expression cassette described in B10;
[0036] B12) recombinant microorganisms containing the encoding gene described in B9), or recombinant microorganisms containing the expression cassette described in B10), or recombinant microorganisms containing the recombinant vector described in B11);
[0037] B13), a transgenic plant cell line containing the gene described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11;
[0038] B14), transgenic plant tissue containing the encoding gene described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11;
[0039] B15), a transgenic plant organ containing the encoding gene described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11).
[0040] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0041] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0042] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0043] Of the proteins described above, SEQ ID No:2 consists of 608 amino acid residues. It is named the STRONG1 protein, and its encoding gene is the STRONG1 gene.
[0044] In this application, the regulation may be overexpression upregulation, enhancement, or increase, and / or knockout, reduction, or decrease.
[0045] In this application, knocking out, reducing, or decreasing the expression of the gene encoding the protein, or the activity or content of the protein, can improve lodging resistance and / or high yield in gramineous plants. Overexpression, upregulating, enhancing, or increasing the expression of the gene encoding the protein, or the activity or content of the protein, can decrease lodging resistance and / or high yield in gramineous plants.
[0046] In the above applications, the protein is derived from rice.
[0047] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).
[0048] In the nucleic acid molecules described in B1) or B8), those skilled in the art can easily mutate the nucleotide sequence encoding the protein STRONG1 of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 80% or more of the same nucleotide sequence as the protein STRONG1 isolated in the present invention, as long as they encode and function as protein STRONG1, are all derived from and equivalent to the nucleotide sequence of the present invention.
[0049] The aforementioned 80% or higher identity can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0050] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Perresidue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.
[0051] In this document, the vectors described are known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the pROKII vector;
[0052] In the aforementioned biological materials, the expression cassette described in B2) or B9) refers to DNA capable of expressing the gene in a host cell. This DNA may include not only promoters that initiate gene transcription but also terminators that terminate gene transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically inducible promoters from tobacco, pathogenesis-related (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both can be induced by jasmonic acid methyl ester); heat shock promoter (US Patent 5,187,267); tetracycline inducible promoter (US Patent 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), seed storage protein-specific promoters (e.g., promoters of beta-conglycin, napin, oleosin and soybean beta-conglycin (Beachy et al. (1985) EMBO J.4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited here are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627.
[0053] In B3) or B11) above, the recombinant vector can be a recombinant expression vector containing the gene expression cassette constructed using a plant expression vector. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85, or pCAMBIA1391-Xb. When constructing a recombinant expression vector using MOG1, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. As a specific embodiment, this application uses the pCM1307 vector as the expression vector. As a specific embodiment, this application uses the pHUE411 vector as the gene knockout vector.
[0054] As a specific embodiment, the microbial strain in the recombinant microorganism may be Agrobacterium EHA105.
[0055] In the above applications, the nucleic acid molecule described in B1) is a DNA molecule with a nucleotide sequence as shown in SEQ ID NO:1.
[0056] In the above applications, the nucleic acid molecule described in B8) is a gRNA that targets the protein-coding gene described above, and the target sequence of the gRNA is shown in SEQ ID NO:4.
[0057] To address the above problems, this invention provides a method for cultivating plants with low lodging resistance and low yield.
[0058] The method includes upregulating or enhancing or increasing the expression level of the gene encoding the aforementioned protein in the target plant, and / or the activity and / or content of the protein to obtain a plant with low lodging resistance and low yield, wherein the lodging resistance and / or yield of the low lodging-resistant plant are lower than those of the target plant.
[0059] In any of the methods or applications described above, the plant is any of the following:
[0060] J1) Grasses (Poaceae family);
[0061] J2) Plants of the genus *Oryza*;
[0062] J3) Rice.
[0063] The aforementioned proteins or nucleic acid molecules.
[0064] This invention has discovered a gene associated with lodging resistance and yield, which has been named STRONG1. This gene can be used to improve the lodging resistance and yield of rice, which is of great significance for breeding new rice varieties. Attached Figure Description
[0065] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0066] Figure 1 Phenotypes and differentially expressed loci of the two parents;
[0067] Figure 2 Cloning of the STRONG1 gene;
[0068] Figure 3 Detection of STRONG1 expression level in overexpressing plants and statistics of mutation types in knockout plants; where: a represents the expression level in STRONG1 overexpressing plants; b represents the mutation type information in STRONG1 knockout plants;
[0069] Figure 4 Phenotypic and statistical graphs of lodging resistance in STRONG1 overexpression and knockout plants; where: a shows the stem phenotype at maturity of STRONG1 overexpression and knockout plants; b shows the stem diameter of STRONG1 overexpression and knockout plants; c shows the cavity wall thickness of STRONG1 overexpression and knockout plants; d shows the cross-sectional modulus of STRONG1 overexpression and knockout plants; e shows the bending resistance of STRONG1 overexpression and knockout plants; f shows the thrust resistance of STRONG1 overexpression and knockout plants.
[0070] Figure 5 STRONG1 overexpression and knockout plant yield phenotypes and statistics; where: a shows the morphological phenotype of the ear of STRONG1 overexpression plants; b shows the morphological phenotype of the ear of STRONG1 knockout plants; c shows the number of primary branches in STRONG1 overexpression and knockout plants; d shows the number of secondary branches in STRONG1 overexpression and knockout plants; e shows the number of grains per ear in STRONG1 overexpression and knockout plants; f shows the yield per plant in STRONG1 overexpression and knockout plants.
[0071] Figure 6 Phenotypic and statistical graphs of grains from STRONG1 overexpressing and knockout plants; where: a shows the grain phenotype of STRONG1 overexpressing plants; b shows the grain phenotype of STRONG1 knockout plants; c shows the grain length statistics of STRONG1 overexpressing and knockout plants; d shows the grain width statistics of STRONG1 overexpressing and knockout plants; e shows the grain thickness statistics of STRONG1 overexpressing and knockout plants; f shows the thousand-grain weight statistics of STRONG1 overexpressing and knockout plants.
[0072] Figure 7 Expression and subcellular localization of STRONG1 in various tissues of the two parental rice plants; Root represents root, Leaf represents leaf, Sheath represents leaf sheath, Panicle represents panicle, Stem-A represents the first sub-panicle, Stem-B represents the second sub-panicle, Stem-C represents the third sub-panicle, and Stem-D represents the fourth sub-panicle; where: a shows the expression level of STRONG1 in various tissues of the two parental rice plants; b shows the subcellular localization of STRONG1 in tobacco.
[0073] In each figure, * indicates P < 0.05; ** indicates P < 0.01. Detailed Implementation
[0074] This invention discloses STRONG1, a protein related to lodging resistance and yield in rice, its encoding gene, and its applications.
[0075] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.
[0076] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.
[0077] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.
[0078] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.
[0079] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately." Here, "approximately" generally means an actual value within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.
[0080] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0081] YEP medium: Weigh 10g yeast extract, 5g NaCl, 10g tryptone, add distilled water to dissolve and bring the volume to 1L, add 15g agar powder (solid medium), and autoclave at 121℃ for 15min.
[0082] YEB liquid medium: Dissolve 10g of peptone, 10g of yeast extract, 5g of NaCl and 15g of agar powder in 1L of deionized water, then adjust the pH to 7.0 and autoclave for 20 minutes.
[0083] AAM liquid culture medium:
[0084] AAM (20×): Weigh 6.645g CaCl2, 58.8g KCl, 3.4g KH2PO4, and 7.4g MgSO4·7H2O, and dilute with distilled water to 1L.
[0085] MS micro-scale (200×): Weigh 166mg KI, 3.38g MnSO4·H2O, 1.24g H3BO3, 50mg Na2MoO4·2H2O, 1.72g ZnSO4·7H2O, 5g CoCl2·6H2O, and 5g CuSO4·5H2O, and dilute to 1L with distilled water.
[0086] AAM Organic (100×): Weigh out 50mg of vitamin B1, 50mg of vitamin B5, and 10mg of vitamin B6, and dilute with distilled water to 1L.
[0087] Iron salts (100×): Weigh 3.73g Na2EDTA·2H2O and 2.78g FeSO4·7H2O, and dilute with distilled water to 1L.
[0088] Take 50 mL of AAM (large volume), 5 mL of MS (micro volume), 10 mL of AAM (organic), 10 mL of iron salt, 500 mg of hydrolyzed casein, 68.5 g of sucrose, 36 g of glucose, 75 mg of glycine, 877 mg of glutamine, 266 mg of aspartic acid, and 228 mg of arginine, dissolve them in 1 L of deionized water, adjust the pH to 5.5, autoclave at 115℃ for 15 min, and add 1 mL of 20 mg / mL acetylsuccine after sterilization.
[0089] NB solid culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, and 3 g of plant gel in 1 L of distilled water, then adjust the pH to 5.8 and autoclave for 20 min.
[0090] Co-culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, and 2 mg of 2,4-D in 1 L of distilled water, adjust the pH to 5.4, sterilize at 121℃ for 15 min, and when cooled to 50-60℃, add 10 g of glucose and 20 mg of acetylsuccinone that have been filtered and sterilized with 0.22 μM.
[0091] Delayed screening medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, and 2 mg of 2,4-D in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121 °C for 15 min, and add 500 mg of cephalosporin that has been filtered and sterilized with 0.22 μM solution when the medium has cooled to 50–60 °C.
[0092] First round of screening culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121℃ for 15 min, and add 500 mg of cephalosporin and 50 mg of hygromycin after filtration sterilization at 0.22 μM when the temperature has cooled to 50-60℃.
[0093] Second round of screening culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121℃ for 15 min, and add 50 mg of hygromycin that has been filtered and sterilized with 0.22 μM when the temperature has cooled to 50-60℃.
[0094] Predifferentiation medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, 1 mg of 6-BA, 2 mg of NAA and 5 mg of ABA in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121℃ for 15 min, and add 50 mg of hygromycin that has been filtered and sterilized at 0.22 μM when the temperature has cooled to 50-60℃.
[0095] Differentiation medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, 2 mg of 6-BA, 1 mg of NAA, and 1 mg of KT in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121 °C for 15 min, and add 50 mg of hygromycin that has been filtered and sterilized with 0.22 μM solution when cooled to 50–60 °C.
[0096] Seedling growth medium: Dissolve 25 mL of 20×MS large volume stock solution, 2.5 mL of 200×MS micro volume stock solution, 2.5 mL of 200×MS iron salt stock solution, 2.5 mL of 200×MS organic stock solution, 3 g of plant gel, 0.5 mg of NAA and 0.25 mg of paclobutrazol in 1 L of distilled water, adjust the pH to 5.8, and sterilize at 121℃ for 15 min.
[0097] The solutes and their concentrations in the 20×MS mother liquor were: 38.00 g / L KNO3, 8.80 g / L CaCl2·2H2O, 7.40 g / L MgSO4·7H2O, 3.40 g / L KH2PO4, and 33.00 g / L NH4NO3. The solvent was water, and the pH was natural.
[0098] The solutes and their concentrations in the 200×MS trace mother liquor were: 4.46 g / L MnSO4·4H2O, 0.166 g / L KI, 1.24 g / L H3BO3, 1.72 g / L ZnSO4·7H2O, 0.050 g / L Na2MoO4·2H2O, 0.005 g / L CuSO4·5H2O, and 0.005 g / L CoCl2·6H2O. The solvent was water, and the pH was natural.
[0099] The solutes and their concentrations in the 200×MS iron salt mother liquor were: 5.56 g / L FeSO4·7H2O, 7.46 g / L Na2·EDTA·2H2O, with water as the solvent and natural pH.
[0100] The solutes and their concentrations in the 200×MS organic mother liquor were: 20 g / L inositol, 100 mg / L nicotinic acid, 100 mg / L pyridoxine hydrochloride, 100 mg / L thiamine hydrochloride, and 400 mg / L glycine. The solvent was water, and the pH was natural.
[0101] The solutes and their concentrations in the large volume of 50×N6 mother liquor are: 141.50 g / L KNO3, 20 g / L KH2PO4, 23.15 g / L (NH4)2SO4, 9.25 g / L MgSO4·7H2O, and 8.30 g / L CaCl2·2H2O. The solvent is water, and the pH is natural.
[0102] The solutes and their concentrations in the 100×B5 trace mother liquor are: 0.3 g / L H3BO3, 1 g / L MnSO4·4H2O, 0.0025 g / L CoCl2·6H2O, 0.0025 g / L CuSO4·5H2O, 0.2 g / L ZnSO4·7H2O, 0.025 g / L Na2MoO4·2H2O, and 0.075 g / L KI. The solvent is water, and the pH is natural.
[0103] The solutes and their concentrations in the 1000×B5 organic mother liquor are: 2 g / L glycine, 100 g / L inositol, 1 g / L nicotinic acid, 1 g / L pyridoxine hydrochloride, and 10 g / L thiamine hydrochloride. The solvent is water, and the pH is natural.
[0104] The rice variety Nipponbare is referred to as wild-type rice or WT in the following text.
[0105] Alternating light and dark culture involves alternating light and dark culture under the following conditions: 28℃; 14 hours of light culture / 10 hours of dark culture; and a light intensity of 90 μE / m² / s during light culture.
[0106] In Examples 1 to 3 of this invention, all raw materials and reagents used can be purchased from the market.
[0107] The present invention will be further illustrated below with reference to the embodiments:
[0108] Example 1: Obtaining the STRONG1 gene
[0109] This invention utilizes previously identified robust stem germplasm materials, MYDN (Ant Egg Rice) and NIP (Thin-stemmed Japanese White), through hybridization and backcrossing to create a localized population. Figure 1 Based on the stem thickness phenotype, the target gene was located in a 6.68 kb region between markers MM996 and MM998 on chromosome 6. Annotation information from the RGAP database (http: / / rice.plantbiology.msu.edu / ) revealed only one ORF encoding a microtubule-binding protein within this region, which was named STRONG1 (ST1). MYDN and NIP sequencing results showed five variant sites between the two parents across the genome, including one SNP (synonymous mutation) in the exon and four variant sites in the promoter, including one SNP and three InDel mutations. These results suggest that this ORF may be the candidate gene. Figure 2 ).
[0110] Using cDNA from the rice variety Nipponbare as a template, and with 5'-ATGGCCGACGGGGTGGAGGA' and 5'-TCATTGGTAGTTGCGAGTAA' as primers, the STRONG1 gene was amplified by PCR.
[0111] Sequencing revealed that the CDS sequence of the STRONG1 gene is SEQ ID No:1, the nucleotide sequence is SEQ ID No:3, and the amino acid sequence of the encoded protein is SEQ ID No:2. This protein was named STRONG1 protein.
[0112] SEQ ID No:1 (Sequence 1) is as follows:
[0113]
[0114] SEQ ID No: 2
[0115] *。
[0116] SEQ ID No: 3
[0117]
[0118] Example 2: Functional Verification of STRONG1
[0119] I. Construction of overexpression vectors
[0120] The nucleotide sequence of the STRONG1 gene was amplified using primers ST1-OE-F / R, yielding a PCR product of 1806 bp. This product was then ligated into the plant expression vector pCM1307 (available from China Agricultural University; Rice SPL10 positively regulates trichome development through expression of HL6 and auxin-related genes. Journal of Integrative Plant Biology, 2021, 63: 1521-1536) using homologous recombination. The primers used are shown below:
[0121] ST1-OE-F:
[0122] ATCGATACCGTCGACGAGCTCTCTAGA ACTAGT ATGGCCGACGGGGTGGAGGAGGG (The underlined part indicates the recognition site of the restriction endonuclease SpeI) (SEQ ID No: 6)
[0123] STI-OE-R:
[0124] AGACTGGTGATTTTTGCGGAGTACCCG GGTACC TCATTGGTAGTTGCGAGTAAGCC (The underlined part indicates the recognition site of the restriction endonuclease KpnI) (SEQ ID No:7)
[0125] The recombinant plasmid that was correctly sequenced was named ST1-OE.
[0126] II. Construction of the Knockout Vector
[0127] (1) Log in to the website http: / / crispor.tefor.net / to screen target sites. The two target site sequences designed in this experiment are 5'-GATACGCGCGCTACGGCTGTCGG-3' (SEQ ID No:5) and 5'-TTGCAGCAGAAGCGACTTTGCGG-3' (SEQ ID No:4).
[0128] (2) Primer sequences are as follows:
[0129] ST1-MT1-BsF:
[0130] 5'-ATATATGGTCTCTGGCGATACGCGCGCTACGGCTGTGTT-3'(SEQ ID No:8)
[0131] ST1-MT1-F0:
[0132] 5'-TGATACGCGCGCTACGGCTGTGTTTTAGAGCTAGAAATAGC-3'(SEQ ID No:9)
[0133] ST1-MT2-R0:
[0134] 5'-AACCAAAGTCGCTTCTGCTGCACGCTTCTTGGTGCC-3'(SEQ ID No:10)
[0135] ST1-MT2-BsR:
[0136] 5'-ATTATTGGTCTCTAAACCAAAGTCGCTTCTGCTGCAC-3'(SEQ ID No:11)
[0137] (3) PCR amplification: Four-primer PCR amplification was performed using pCBC-MT1T2 (available from China Agricultural University, ACRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology, 2014, 14:327.) as a template. -BsF / -BsR was 10 μM; -F0 / -R0 was 0.5 μM.
[0138] (4) Purify and recover the PCR product and establish the following enzyme digestion-ligation system.
[0139] Table 1
[0140]
[0141] Note: pHUE411 is available to the public from China Agricultural University. (ACRISPR / Cas9 toolkit for multiplexgenome editing in plants. BMC Plant Biology, 2014, 14:327.)
[0142] (5) Transform the ligation product into competent E. coli cells. The correctly sequenced vector is named ST1-CR.
[0143] III. Obtaining Genetically Modified Rice
[0144] (1) Recombinant bacteria
[0145] The two correctly prepared overexpression vectors ST1-OE and ST1-CR were transformed into Agrobacterium tumefaciens EHA105 using a freeze-thaw method to obtain recombinant bacteria, which were then used to infect callus of the transgenic recipient variety (Nipponbare).
[0146] (2) Rice
[0147] The classic Agrobacterium-mediated callus infection method is adopted, and the specific steps are as follows:
[0148] a. Obtaining embryogenic callus: After removing the shells from mature Nipponbare seeds, sterilize them with alcohol, then sterilize them twice with sodium hypochlorite, rinse them once with sterile water, and air dry them in a laminar flow hood. Inoculate the obtained sterile Nipponbare seeds into NB medium and incubate them in the dark at 28°C for 2 weeks. Peel off the embryogenic callus and subculture it into fresh NB medium for 2 weeks (subculture twice).
[0149] b. Preparation of infection solution: Take the preserved Agrobacterium solution and spread it on a solid culture medium containing rifampicin and kanamycin. Incubate in the dark at 28°C for 2 days. Scrape a small amount of Agrobacterium into AAM liquid culture medium. The bacterial concentration OD600 is about 0.3.
[0150] c. Co-culture: Select naturally dispersed, bright yellow granular callus tissue with a diameter of about 3-5 mm into an Erlenmeyer flask, add the prepared infection solution, infect for 10 min, absorb the excess infection solution with sterile filter paper, place on a co-culture medium lined with a layer of filter paper, and co-culture at 20℃ for 2-3 days.
[0151] d. Screening of resistant callus: The co-cultured callus was removed and washed rapidly with sterile water, agitated 5-6 times. It was then washed with sterile water containing cephalosporin and carbenicillin for 20 minutes, and finally placed on sterile filter paper to drain for 3 hours. It was then transferred to delayed selection medium. After one week, it was transferred to the first-round selection medium, and after two weeks, it was transferred to the second-round selection medium and cultured for another two weeks.
[0152] e. Differentiation: The resistant callus obtained by screening was inoculated into the predifferentiation medium and cultured in the dark at 28°C for 2 weeks. Then it was transferred to the differentiation medium and cultured under light for 2-3 weeks to obtain transgenic seedlings.
[0153] f. Seedling strengthening: Transfer the transgenic seedlings to a seedling strengthening culture medium. After the seedlings have taken root and grown, remove them from the culture bottle, wash off the culture medium on the roots, harden the seedlings for 1-2 weeks, and then transplant them to the field for planting until they mature, thus obtaining T0 generation transgenic plants.
[0154] (3) Identification of positive transgenic seedlings: The obtained T0 generation transgenic seedlings were identified, positive transgenic plants were screened, and then self-pollination was carried out continuously to finally obtain T3 generation homozygous transgenic plants.
[0155] Identification of overexpressing transgenic plants: Genomic DNA was extracted from rice seedlings and used as a template. PCR amplification was performed using primer pairs consisting of hyg(280)-F:5'ACGGTGTCGTCCATCACAGTTTGCC'3 (SEQ ID No:12) and hyg(280)-R:5'TTCCGGAAGTGCTTGACATTGGGGA'3 (SEQ ID No:13) to obtain PCR amplification products. Then, the following judgment was made: if a PCR amplification product contains a DNA fragment of approximately 280 bp, the rice seedling corresponding to that PCR amplification product is a positive seedling.
[0156] Leaves from the identified positive plants were collected and stored in liquid nitrogen to obtain the corresponding test samples. Total RNA was extracted from the test samples using the Trizo1 method, and then the first-strand cDNA was reverse transcribed using a reverse transcription kit (TransGen). The cDNA was diluted 50 times with sterile water and used as a template. The relative expression level of the STRONG1 gene was detected by real-time quantitative PCR (Ubq gene Os03g0234200 was used as an internal reference gene).
[0157] The primers for detecting the STRONG1 gene are ST1-RT-F:5'-TGCTCAGTTTGCAGCAGAA-3' (SEQ ID No:14) and ST1-RT-R:5'-TCAAGCGGTGCGAGAATG-3' (SEQ ID No:15).
[0158] The primers for detecting the Ubq gene are Ubq-F:5'-ACCAGCTGAGGCCCAAGA-3' (SEQ ID No:16) and Ubq-R:5'-ACGATTGATTTAACCAGTCCATGA-3' (SEQ ID No:17).
[0159] Real-time quantitative PCR was performed on an Applied Biosystems 7500 Real-Time PCR system (ABI, USA), with each experiment repeated in triplicate. The method reported by Livak KJ and Schmittgen TD (2001) was used, i.e., 2... -ΔΔCT Calculate the relative expression level.
[0160] ΔΔCT=(CT.Target-CT.Ubiquitin)Time x-(CT.Target-CT.Ubiquitin)Time 0
[0161] Time x represents any time point, and Time 0 represents the target gene expression at 1-fold after Ubiquitin correction.
[0162] Some test results can be found Figure 3 The results showed that, compared with Nipponbare, the relative expression level of the STRONG1 gene was significantly increased in all T3 generation homozygous transgenic rice lines. Three of these T3 generation homozygous transgenic rice lines were named OE-1, OE-2, and OE-3, respectively.
[0163] Identification of knockout transgenic plants: Using genomic DNA from leaves of T0 generation plants as templates, PCR amplification was performed using primer pairs consisting of primer T1F: 5'-ATCTGCTCCTGCTGTTCGT' (SEQ ID No: 18) and primer T1R: 5'-CCAATCCATTCACCCA CT-3' (SEQ ID No: 19), yielding the corresponding PCR amplification products. The PCR amplification products were then subjected to Sanger sequencing. The sequencing results were compared with the Cas9 target sequence of the STRONG1 gene (SEQ ID No: 4), and the mutation type was identified.
[0164] Test results are shown Figure 3 Three homozygous mutant plants of STRONG1 were obtained and named st1-1, st1-2, and st1-3, respectively. In st1-1, the STRONG1 gene on both homologous chromosomes exhibited the same mutation: a deletion of 4 nucleotides (CGGC) on both chromosomes, resulting in a frameshift and premature termination of protein translation. In st1-2, the STRONG1 gene on both homologous chromosomes exhibited the same mutation: a deletion of 5 nucleotides (CGGCT) on both chromosomes, resulting in a frameshift and premature termination of protein translation. In st1-3, the STRONG1 gene on both homologous chromosomes exhibited the same mutation: a deletion of 1 nucleotide (T) on both chromosomes, resulting in a frameshift and premature termination of protein translation.
[0165] IV. Identification of Relevant Traits of Various Transgenic Rice
[0166] The traits of each transgenic rice positive line and its corresponding recipient variety (Nipponbare) obtained in step three of the manual survey included stem diameter, cavity wall thickness, cross-sectional modulus, bending resistance, thrust resistance, number of branches, number of grains per panicle, yield per plant, and grain shape.
[0167] Figure 4 The lodging resistance phenotypes and statistical graphs of STRONG1 overexpression and knockout plants. Compared with wild type (NIP), knockout plants showed significantly increased stem diameter, cavity wall thickness, cross-sectional modulus, bending strength, and thrust resistance; overexpression plants showed significantly decreased stem diameter, cavity wall thickness, cross-sectional modulus, bending strength, and thrust resistance.
[0168] Figure 5 STRONG1 overexpression and knockout plant yield phenotypes and statistical graphs. Compared with the wild type, knockout plants showed significantly increased primary branch number, secondary branch number, grain number per ear, and yield per plant; overexpression plants showed significantly decreased secondary branch number, grain number per ear, and yield per plant.
[0169] Figure 6 STRONG1 overexpression and knockout plant grain phenotypes and statistical graphs. Compared with wild type, overexpression plants showed increased grain length, decreased grain width, decreased grain thickness, and decreased thousand-grain weight; knockout plants showed decreased grain length, increased grain width, increased grain thickness, and increased thousand-grain weight.
[0170] Example 3: Expression and subcellular localization analysis of STRONG1 in various tissues of rice.
[0171] I. Real-time quantitative PCR
[0172] Total RNA was extracted from various tissues of rice varieties Nipponbare and Ant Egg Rice. The first strand of cDNA was synthesized by reverse transcription using M-MLV. Using the first strand of cDNA as a template, a specific fragment of the STRONG1 gene was amplified using primers ST1-RT-F and ST1-RT-R. A specific fragment of the rice Ubq gene was amplified using primers Ubq-F and Ubq-R as an internal control for real-time quantitative analysis.
[0173] The results are as follows Figure 7 As shown, the STRONG1 gene is expressed in various tissues of Japanese safflower and ant egg rice.
[0174] II. Subcellular localization of STRONG1
[0175] 1. Construction of the STRONG1-GFP vector
[0176] To investigate the subcellular localization of STRONG1, this study constructed a vector for the STRONG1-GFP fusion protein. A CDS of STRONG1 without a stop codon was ligated into the plant expression vector pSuper 1300-GFP (available from China Agricultural University, RGN1 controls grain number and shapes panicle architecture in rice. Plant Biotechnology Journal, 2021, 20(1): 158-167). After sequencing verification, it was named ST1-GFP. Using Nipponbare cDNA as a template, the primers used are as follows:
[0177] ST1-ps1300-F:
[0178] 5'CGATACACCAAATCGACTCTAGA AAGCTT ATGGCCGACGGGGTGGAGGAG-3'(SEQ ID No:20) (The underlined part is the recognition site of the restriction endonuclease HindIII)
[0179] ST1-ps1300-R:
[0180] 5'CAGCTCCTCGCCCTTGCTCACCAT GGTACC TTGGTAGTTGCGAGTAAGCCC-3'(SEQ ID No:21) (The underlined part is the recognition site for restriction endonuclease and KpnI)
[0181] 2. Transient expression in tobacco leaves
[0182] (1) Select Agrobacterium clones containing ST1-GFP plasmid activated on YEP solid medium and culture them overnight in 3-5m LEEEP liquid medium containing the corresponding antibiotic at 28℃ and 200rpm.
[0183] (2) Inoculate the culture medium at a ratio of 1:100 into the expansion medium, which is YEP medium containing the corresponding antibiotic. Incubate overnight at 28°C and 200 rpm until the OD600 is 1-2. Collect the cells by centrifugation at 5,000 rpm for 5 min.
[0184] (3) Resuspend the bacterial cells in a resuspension solution (10mM MgCl2, 10mM MES, 150μM acetylsyl syringone) until the concentration is OD600 is 1.0, and let stand at room temperature for 2-4 hours.
[0185] (4) Select tobacco leaves that are about 4 weeks old and growing well. Use a sterile 1mL medical syringe to draw up the bacterial solution and slowly inject it into the tobacco leaves from the lower epidermis. After the tobacco leaves are injected with the bacterial solution, continue to culture them at 22-24℃. After 2-3 days, observe them directly under a laser confocal microscope.
[0186] The results are as follows Figure 7 As shown, STRONG1 is a protein located in microtubules.
[0187] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A method for improving lodging resistance and / or yield in plants, characterized in that, This includes improving lodging resistance and / or yield in plants by knocking out or reducing the expression of protein-coding genes and / or reducing the content of said proteins; The amino acid sequence of the protein is shown in SEQ ID NO:2; the plant is rice.
2. A method for cultivating lodging-resistant and / or high-yielding plants, characterized in that, This includes knocking out or reducing the expression of the gene encoding the protein described in claim 1 in the target plant, and / or reducing the content of the protein to obtain a lodging-resistant and / or high-yielding plant, wherein the lodging resistance and / or yield of the plant is higher than that of the target plant; the plant is rice.
3. The application of substances that regulate the expression of protein-coding genes or substances that regulate protein content in any of the following: A1) Improving the application of lodging resistance in grasses and / or preparing products that improve lodging resistance in grasses; A2) Applications in increasing the yield of grasses and / or applications in the preparation of products that increase the yield of grasses; The substance that regulates the expression of the protein-coding gene or the substance that regulates the protein content is any one of the following: B8) Nucleic acid molecules that inhibit the expression of the gene encoding the protein of claim 1 or downregulate the content of the protein; B9) The gene encoding the nucleic acid molecule described in B8); B10), an expression cassette containing the gene encoding described in B9); B11), a recombinant vector containing the encoding gene described in B9), or a recombinant vector containing the expression cassette described in B10; B12) recombinant microorganisms containing the encoding gene described in B9), or recombinant microorganisms containing the expression cassette described in B10), or recombinant microorganisms containing the recombinant vector described in B11); B13), a transgenic plant cell line containing the encoding gene described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11; B14), transgenic plant tissue containing the encoding gene described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11; B15), a transgenic plant organ containing the encoding gene described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11; the grass plant is rice.
4. The application according to claim 3, characterized in that, B8) The nucleic acid molecule is a gRNA that targets the protein-coding gene of claim 1, and the target sequence of the gRNA is shown in SEQ ID NO:4.
Citation Information
Patent Citations
Seed specificity highly effective promoter and its application
CN101063139A
Seed specific highly effective promoter and its application
CN101063139B
Recombinant DNA: transformed microorganisms, plant cells and plants: a process for introducing an inducible property in plants, and a process for producing a polypeptide or protein by means of plants or plant cells
US5057422A
Plant proteins, promoters, coding sequences and use
US5187267A