Use of the MTB03g gene or its encoded protein in regulating plant growth or yield

By mutating or overexpressing the MTB03g gene in rice, rice growth and yield are regulated, the problem of stagnant rice yield growth is solved, and the plant size is compact and yield improvement is achieved.

CN119614624BActive Publication Date: 2025-09-02THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510158940.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-13
Publication Date
2025-09-02
Estimated Expiration
2045-02-13

AI Technical Summary

Technical Problem

Rice yield growth has stagnated, and it is difficult for the existing technology to significantly increase yield under limited planting area. Influencing factors include plant height, number of tillers, effective number of tillers, angle of tillers, ear length and weight of 100 grains.

Method used

By mutating or overexpressing the MTB03g gene, the growth and yield of rice is regulated, including increasing plant height, shortening the angle of tillers, increasing the number of tillers and the weight of 100 grains, and shortening the length of the ears. Gene editing technologies such as the CRISPR/Cas system and RNA interference technology are used to construct recombinant plant expression vectors for gene editing or overexpression.

Benefits of technology

The compact rice plant type has been achieved, the number of tillers and the weight of hundreds of grains has been increased, and the growth and yield of rice has been improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614624B_ABST
    Figure CN119614624B_ABST
Patent Text Reader

Abstract

The present invention discloses MTB03g The invention relates to the use of a gene or its encoded protein in regulating plant growth or yield. MTB03g Gene mutation MTB03g Compared with wild-type rice, the mutant MTB03g The rice mutants showed phenotypes such as increased plant height, shortened tiller angle, increased tiller number, effective tiller number and 100-grain weight during the growth period, and shortened panicle length, confirming that MTB03g The gene or its encoded protein has the function of regulating plant growth, plant shape or yield, etc. The present invention has application prospects in regulating plant growth, increasing plant yield, etc.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a new use of genes isolated from Gramineae plants, in particular to a new use of genes isolated from rice ( Oryza sativa ) MTB03g The use of a gene or its encoded protein in regulating plant growth or yield belongs to MTB03g New areas of use for genes or their encoded proteins. Background Art

[0002] Rice( Oryza sativa L. Rice is one of the world's most important food crops, accounting for approximately a quarter of global grain production. More than half of the world's population relies on rice as their staple food. However, in recent years, rice yields have been increasing slowly, with yield growth stagnating in some regions. Therefore, whether rice production can meet the needs of a growing population in the future has become a crucial issue in global food security. A greater challenge lies in significantly increasing yields on existing or even declining cultivated areas. During rice cultivation, physiological parameters such as plant height, number of tillers, number of effective tillers, tiller angle, panicle length, and 100-grain weight can all affect final rice yield. Therefore, there is an urgent need to explore the rice gene pool and identify genes that can regulate these physiological parameters. These genes will have potential applications in regulating rice growth and increasing rice yield. Summary of the Invention

[0003] The main purpose of the present invention is to MTB03g gene, MTB03g protein, containing MTB03g Gene expression cassette or containing MTB03g Recombinant plant expression vectors of genes are used to regulate plant growth or yield.

[0004] To achieve the above objectives, the main technical solutions adopted by the present invention include:

[0005] One aspect of the present invention is to MTB03g gene, MTB03g protein, containing MTB03g Gene expression cassette or containing MTB03g Recombinant plant expression vectors of genes are used to regulate plant growth or plant type.

[0006] In a preferred embodiment of the present invention, the regulating plant growth is to promote rice growth; wherein, the promoting rice growth includes increasing plant height and shortening tillering angle; and the regulating plant shape is to make the rice plant shape compact.

[0007] Another aspect of the present invention is to MTB03g gene, MTB03g protein, containing MTB03gGene expression cassette or containing MTB03g Recombinant plant expression vectors of genes are used to regulate plant yield.

[0008] In a preferred embodiment of the present invention, the regulating plant yield is to increase plant yield; wherein, the increasing plant yield includes increasing the number of tillers, the number of effective tillers, and the 100-grain weight of the plant; and shortening the ear length.

[0009] For reference, the present invention provides an embodiment. MTB03g Gene mutation MTB03g The gene expression level is reduced or the normal function of the MTB03g protein is defective, thereby increasing the plant height; shortening the tiller angle; increasing the number of tillers, the number of effective tillers, and the 100-grain weight of the plant; shortening the ear length; and thereby promoting plant growth or increasing plant yield.

[0010] The mutations include MTB03g One or more nucleotide substitutions, deletions, and / or additions are made to the nucleotide sequence of a gene or its promoter. Preferably, the mutations can be obtained through physical mutagenesis, chemical mutagenesis, or gene editing. Physical mutagenesis includes, but is not limited to, radiation mutagenesis and space breeding; chemical mutagenesis includes mutagenesis induced by treatment with mutagens such as EMS; and gene editing methods include, but are not limited to, ZFNs, TALEs, and / or CRISPR / Cas.

[0011] Those skilled in the art can use conventional methods such as conventional gene knockout or gene editing technology to modify the MTB03g Gene knockout mutation, such as constructing MTB03g Gene knockout vectors or constructed using gene editing technology MTB03g CRISPR / Cas9 gene editing vectors, etc., can be used to edit the genes in plants. MTB03g Gene knockout or mutation are methods that are well known to those skilled in the art.

[0012] Those skilled in the art are aware that the main principle of the CRISPR / Cas gene editing system or gene editing method is to use a nucleic acid fragment called a guide RNA (gRNA) to locate the desired gene editing location in the host genome, that is, the target DNA sequence, and then use the Cas protein to cut the DNA. In this application, the Cas proteins include but are not limited to Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13, and / or Cas14.

[0013] The interference MTB03gThe normal expression or normal function of a gene or promoter can be disrupted by using RNA interference technology (RNAi) to interfere with the normal expression of the gene encoding the MTB03g protein or its promoter or to cause defects in its normal function. RNA interference technology is a conventional technique in the art. It uses 21-23bp short double-stranded RNA (siRNA) or long double-stranded RNA (dsRNA; double-strand RNA) to specifically bind to the homologous region of the mRNA expressed by the target gene, causing the mRNA to degrade and thus achieve the effect of inhibiting gene expression.

[0014] A preferred embodiment of the present invention is MTB03g The construction of gene editing vector includes: MTB03g The target sequence for introducing mutations into the gene and the fragments of the homology arms are connected to the vector backbone to obtain a gene editing vector.

[0015] The gene editing vector may also contain a selectable marker gene for selecting transformed cells or tissues. Such marker genes include genes encoding antibiotic resistance and genes conferring resistance to herbicidal compounds. Furthermore, such marker genes also include phenotypic markers, such as β-galactosidase and fluorescent protein.

[0016] The transformation protocol and the protocol for introducing the polynucleotide or polypeptide into the plant may vary depending on the type of plant or plant cell being transformed. Suitable methods for introducing the polynucleotide into plant cells include microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high-velocity ballistic bombardment. In certain embodiments, various transient transformation methods may be used to transform rice. MTB03g The gene is provided to the plant. The transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al. Plant Cell Reports. 1986. 5:81-84).

[0017] A preferred embodiment of the present invention is a method for inhibiting plant growth, comprising: overexpressing in a plant MTB03g Genes, MTB03g The increased expression of the gene may enhance the function or activity of the MTB03g protein.

[0018] The overexpression can be achieved by constructing a plant recombinant expression vector, including: MTB03gThe gene is linked to an expression control element to produce a recombinant plant expression vector. The recombinant plant expression vector may consist of a 5' non-coding region (SEQ ID NO. 1) and a 3' non-coding region. The 5' non-coding region may include a promoter sequence, an enhancer sequence, and / or a translation enhancing sequence. The promoter may be a constitutive promoter, an inducible promoter, or a tissue- or organ-specific promoter. The 3' non-coding region may include a terminator sequence, an mRNA cleavage sequence, and the like. Suitable terminator sequences can be obtained from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase terminator regions.

[0019] In a preferred embodiment of the present invention, the plant is a grass plant; preferably, the grass plant is rice.

[0020] Another aspect of the present invention is to provide a rice-derived compound capable of regulating plant growth or yield. MTB03g gene or its encoded protein.

[0021] The present invention MTB03g The nucleotide sequence of the CDS of the gene is selected from any one of the nucleotide sequences described in (a) to (e) below:

[0022] (a) the polynucleotide sequence shown in SEQ ID No. 1;

[0023] (b) a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 3;

[0024] (c) a polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under stringent hybridization conditions, and the polynucleotide sequence still has the function of regulating plant growth or yield;

[0025] (d) a polynucleotide sequence that is at least 95% identical to the polynucleotide sequence shown in any one of (a) to (c), and that still has the function of regulating plant growth or yield;

[0026] (e) A polynucleotide sequence that is complementary to the polynucleotide sequence described in any one of (a) to (d), and the polynucleotide sequence still has the function of regulating plant growth or yield.

[0027] The percentage of sequence identity described in the present invention can be obtained by well-known bioinformatics algorithms, including the Myers and Miller algorithm, the Needleman-Wunsch global alignment method, the Smith-Waterman local alignment method, the Pearson and Lipman similarity search method, and the Karlin and Altschul algorithm, which are well known to those skilled in the art.

[0028] Those skilled in the art can easily adopt known methods, such as directed evolution or point mutation, to MTB03g The nucleotide sequence of the gene is mutated. MTB03g Nucleotides with 75% or higher identity to the nucleotide sequence of a gene are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as the encoded protein has the function of regulating plant growth or yield.

[0029] In addition, the nucleotide sequence described in the present invention can be DNA, such as cDNA, genomic DNA or recombinant DNA; or it can be RNA, such as mRNA or hnRNA.

[0030] The present invention MTB03g The genomic nucleotide sequence of the gene is shown in SEQ ID No. 2.

[0031] The amino acid sequence of the MTB03g protein described in the present invention is selected from the amino acid sequences shown in any one of the following (a)-(d):

[0032] (a) the amino acid sequence shown in SEQ ID NO. 3;

[0033] (b) a protein variant obtained by deleting or replacing one or more amino acid residues in the amino acid sequence of SEQ ID NO. 3, wherein the protein variant still has the function or activity of regulating plant growth or yield;

[0034] (c) a protein variant obtained by inserting one or more amino acid residues into the amino acid sequence shown in SEQ ID NO. 3, wherein the protein variant still has the function or activity of regulating plant growth or yield;

[0035] (d) A protein having 80% or more identity with the amino acid sequence shown in SEQ ID NO. 3, which protein still has the function or activity of regulating plant growth or yield.

[0036] This invention uses wild rice as experimental material and uses gene editing to MTB03gThe gene mutation resulted in a mutant strain that was defective in the normal function of the MTB03g protein. Compared with the wild type, MTB03g The plant height of the gene mutant increased; the tiller angle was shortened; the number of tillers, the number of effective tillers and the weight of 100 grains increased; the ear length was shortened; that is, the growth performance and yield of the mutant were improved. In addition, MTB03g The tillering angle of the gene mutant is shortened, making the plant compact and conducive to dense planting. MTB03g The invention has the function of negatively regulating plant growth or yield. The invention has application prospects in regulating plant growth and increasing plant yield.

[0037] Definitions of terms used in this invention

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described.

[0039] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also refers to oligonucleotide analogs, including PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioates, phosphamidates, etc.). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions can be achieved by generating a sequence in which position 3 of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0040] As used herein, "stringent hybridization conditions" refer to conditions of low ionic strength and high temperature as known in the art. Generally, under stringent conditions, a probe hybridizes to its target sequence to a greater extent than to other sequences (e.g., at least 2-fold above background). Stringent hybridization conditions are sequence-dependent and will vary under different environmental conditions, with longer sequences hybridizing specifically at higher temperatures. By controlling the stringency of hybridization or wash conditions, target sequences that are 100% complementary to the probe can be identified. For detailed guidance on nucleic acid hybridization, reference can be made to the relevant literature (Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid hybridization"). acidassays.1993). More specifically, the stringent conditions are usually selected to be about 5-10°C lower than the thermal melting point (Tm) of the specific sequence at a specified ionic strength pH. Tm is the temperature (under specified ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (because the target sequence is present in excess, 50% of the probes are occupied at equilibrium at Tm). Stringent conditions may be those wherein the salt concentration is less than about 1.0 M sodium ion concentration, typically about 0.01 to 1.0 M at pH 7.0 to 8.3. Stringent conditions may also be achieved by adding destabilizing agents such as formamide. For selective or specific hybridization, a positive signal may be at least twice the background hybridization, optionally 10 times the background hybridization. Exemplary stringent hybridization conditions may be as follows: 50% formamide, 5× SSC, and 1% SDS, incubated at 42°C; or 5× SSC, 1% SDS, incubated at 65°C, washed in 0.2× SSC, and washed in 0.1% SDS at 65°C. The washes may be performed for 5, 15, 30, 60, 120 minutes, or longer.

[0041] The "multiple" mentioned in the present invention generally means 2-8, preferably 2-4; the "replacement" refers to the replacement of one or more nucleotide residues with different nucleotide residues; the "deletion" refers to a reduction in the number of nucleotide residues, that is, the lack of one or more nucleotide residues; the "insertion" refers to a change in the sequence of nucleotide residues, and the change results in the addition of one or more nucleotide residues relative to the natural molecule.

[0042] The term "recombinant host cell strain" or "host cell" refers to a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector, such as a plasmid, or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0043] The term "operably linked" refers to a functional connection between two or more elements. Operably linked elements may be contiguous or non-contiguous.

[0044] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0045] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0046] The term "gene editing vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to in the art as binary vectors. Binary vectors, along with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include the cis-acting sequences required for T-DNA transfer and a selectable marker engineered for expression in plant cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 for MTB03g Flowchart for the construction of gene mutant strains;

[0048] Figure 2 Wild type and MTB03g Comparison of phenotypes of gene mutants at different stages; Figure 2 -A is wild type and MTB03g Comparison of phenotypes of the gene mutant MT1-2 strain at 60 days; Figure 2 -B is wild type and MTB03g Comparison of phenotypes of the gene mutant MT1-2 strain at 80 days; Figure 2 -C is wild type and MTB03g Comparison of phenotypes of the gene mutant MT1-3 strains at 60 days; Figure 2 -D is wild type and MTB03g Comparison of phenotypes of the gene mutant MT1-3 strains at 80 days;

[0049] Figure 3 Wild type and MTB03g Statistical chart of the growth of gene mutant strains; Figure 3 -A is wild type and MTB03g Plant height statistics of gene mutant strains; Figure 3 -B is wild type and MTB03g Statistical diagram of tillering angles of gene mutant strains;

[0050] Figure 4 Wild type and MTB03g Statistical chart of the yield of gene mutant strains; among them, Figure 4 -A is wild type and MTB03g Statistical graph of tiller numbers of gene mutant strains; Figure 4 -B is wild type and MTB03g Statistics of the number of effective tillers of gene mutant strains; Figure 4 -C is wild type and MTB03g Statistical graph of rice panicle length of gene mutant strains; Figure 4 -D is wild type and MTB03g Hundred-grain weight statistics of gene mutant strains. DETAILED DESCRIPTION

[0051] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0052] Test Example 1 MTB03g Gene mutation transformation, screening and functional identification experiments

[0053] 1. Construction of gene editing vector

[0054] according to MTB03g The target sequence (GTACATGGCAAACCTCCCGTTGG (SEQ ID No. 4)) was designed based on the nucleotide sequence of the CDS of the gene (SEQ ID No. 1), and the MTB03g The target sequence for introducing mutations into the gene and the target fragment of the homology arm were ligated with the linearized vector backbone WMC025-pCBSG032. The ligation system is shown in Table 1. After mixing on ice, the mixture was placed in a PCR instrument and ligated at 37°C for 30 min. The mixture was then placed on ice or stored at 4°C.

[0055] MTB03g

[0056] MTB03g

[0057] The amino acid sequence of the MTB03g protein is as follows: * (SEQ ID No. 3).

[0058] Table 1 Recombination connection system

[0059]

[0060] After taking the competent DH5α out of the refrigerator, quickly place it on ice. After 5 minutes, wait for the bacterial block to dissolve, add 10 μL of the ligation product, let it stand on ice for 25 minutes, heat shock at 42°C for 45 seconds, and place it on ice for 2 minutes (do not shake). Add 100 μL of LB liquid medium without antibiotics, place it in a shaker at 37°C and 200 rpm for 1 hour, spread it on LB solid medium containing 50 μg / mL of kanamycin, and culture it at 37°C for one day.

[0061] Twelve single clones were randomly picked from the cultured plates and placed in 2 mL sterile EP tubes. 500 µL of LB liquid medium was added to the sterile EP tubes in advance and the tubes were shaken at 37°C and 200 rpm for 6 h. 5 µL of bacterial solution was aspirated for PCR of each sample. The reaction system for bacterial solution PCR is shown in Table 2. Positive clones with the correct band size were selected by gel electrophoresis for sequencing.

[0062] The nucleotide sequences of primers QC-F / QC-R used in colony PCR are as follows:

[0063] QC-F: CTGGCGAAAGGGGGATGTGCTGCAA (SEQ ID No. 5);

[0064] QC-R: TTCAAACAAGTGTGACAAAAA (SEQ ID No. 6).

[0065] Table 2 Reaction system of bacterial liquid PCR

[0066]

[0067] The plasmid with correct sequencing results was stored in a -20°C refrigerator to complete the construction of the gene editing vector.

[0068] 2 Genetic transformation of rice

[0069] Infection solution: 50 g sucrose, 2.2 g MS powder, 0.5 g MES, 500 μL Silwet L-77. First add 800 mL of distilled water, adjust the pH to 5.7 with 1 M KOH, add distilled water to 1000 mL, and sterilize by high pressure.

[0070] Induction medium: N6 max Stock solution (10×) 100 mL, N6 min Stock solution (100×) 10 mL, Fe 2+ 10 mL of 1-EDTA stock solution (100×), 10 mL of vitamin stock solution (100×), 2.5 mL of 2,4-D stock solution, 0.6 g of proline, 0.8 g of CH, 30 g of sucrose, and 3 g of plant gel were added to 900 mL of distilled water. The pH value was adjusted to 5.8 with 1 M KOH, and the volume was made up to 1 L with distilled water. The mixture was then boiled and dispensed into 100 mL Erlenmeyer flasks and sterilized by high pressure.

[0071] Solid co-culture medium: N6 max Stock solution (10×) 12.5 mL, N6 minStock solution (100×) 1.25 mL, Fe 2+ Prepare 1.25 mL of 1-EDTA stock solution (100×), 2.5 mL of vitamin stock solution (100×), 0.625 mL of 2,4-D stock solution, 0.15 g of proline, 0.2 g of CH, 7.5 g of sucrose, and 2 g of agar powder. Add 200 mL of distilled water, adjust the pH to 5.6 with 1 M KOH, then add distilled water to a volume of 250 mL. Autoclave. Immediately before use, add 5 mL of 50% glucose and 250 μL of the 1,4-D stock solution.

[0072] Screening medium: N6 max Stock solution (10×) 25 mL, N6 min Stock solution (100×) 2.5 mL, Fe 2+ Prepare 2.5 mL of 100× EDTA stock solution, 2.5 mL of 100× vitamin stock solution, 0.625 mL of 2,4-D stock solution, 0.15 g of proline, 0.2 g of CH, 7.5 g of sucrose, and 2 g of agar powder. Add 200 mL of distilled water, adjust the pH to 6.0 with 1 M KOH, and then bring the volume to 250 mL with distilled water. Autoclave. Add 250 μL of 50 mg / mL Hn and 500 μL of 250 mg / mL Cn before use. Pour the mixture into a sterilized plate and air-dry on a clean bench for approximately 2 hours before use.

[0073] Differentiation medium: MS max Stock solution (10×) 100 mL, MS min Stock solution (100×) 10 mL, Fe 2+ -EDTA stock solution (100×) 10 mL, vitamin stock solution (100×) 10 mL, KT stock solution 2.0 mL, NAA stock solution 0.2 mL, proline 0.6 g, CH 0.8 g, D-sorbitol 30 g, sucrose 30 g, plant gel 3.0 g, first add 900 mL of distilled water, adjust the pH to 5.8 with 1 M KOH, add distilled water to 1 L, then boil and dispense into 100 mL Erlenmeyer flasks, and sterilize by high pressure.

[0074] Rooting medium: MS max Stock solution (10×) 50 mL, MS min Stock solution (100×) 5 mL, Fe 2+5 mL of EDTA stock solution (100×), 5 mL of vitamin stock solution (100×), 20 g of sucrose, and 3.0 g of plant gel were first added to 900 mL of distilled water, and the pH value was adjusted to 5.8 with 1 M KOH. The volume was made up to 1 L with distilled water, and then the solution was boiled and dispensed into rooting tubes and sterilized by high pressure.

[0075] Transform the gene-editing vector into Agrobacterium: Add 1 µL of the gene-editing vector to 20 µL of Agrobacterium tumefaciens (EHA105-WM) culture medium. Place the culture medium on ice for 5 minutes, quickly freeze it in liquid nitrogen for 5 minutes, place it in a 37°C water bath for 5 minutes, and then place it on ice for 5 minutes. Add 100 µL of antibiotic-free LB liquid medium and incubate the culture medium at 28°C with shaking at 200 rpm for 2 hours. The culture medium is then directly plated onto LB solid medium containing 50 µg / mL of kanamycin and 50 µg / mL of rifampicin and cultured at 28°C for two days.

[0076] Two days later, pick a single colony and place it in a 5 mL sterile EP tube. Add 2 mL of LB medium containing 50 μg / mL kanamycin and 50 μg / mL rifampicin to the sterile EP tube and culture overnight. Add 400 μL of the bacterial suspension to 100 μL of 75% sterile glycerol, label it, and store it in a -80°C freezer.

[0077] Select mature rice seeds, remove the husks, and place them in a 50 mL centrifuge tube. Disinfect with 75% ethanol for 1 minute. Discard the ethanol, rinse once with sterile water, and then discard. Disinfect with 30% sodium hypochlorite for 20 minutes. Discard the sodium hypochlorite and rinse 5-6 times with sterile water. Remove excess water with a pipette and transfer the seeds to induction medium, 20-25 seeds per dish. Once callus emerges, the proembryo can be used for direct transformation.

[0078] Streak Agrobacterium EHA105 containing the target gene vector onto LB solid medium containing 50 μg / mL kanamycin and incubate at 28°C in the dark for 2 days until single colonies appear. Prepare the infection solution. Use a pipette to remove the infection solution from the plate to create the Agrobacterium suspension for co-cultivation with rice.

[0079] Select a sufficient amount of callus tissue (in good condition, bright yellow, round and firm, with a particle diameter of approximately 3 mm) and place it in a 100 mL sterile Erlenmeyer flask. Add an appropriate amount of Agrobacterium suspension (ensure sufficient suspension is sufficient to contact the material). Incubate at room temperature for 20 minutes, shaking occasionally. Discard the suspension and place the callus tissue on sterile filter paper to absorb any excess. Immediately transfer the callus to a solid co-culture medium covered with a layer of sterile filter paper and incubate in the dark at 26°C for 3 days.

[0080] MTB03gThe flowchart of gene mutant construction is as follows Figure 1 The specific steps are as follows. After three days of co-cultivation, the callus tissue is washed and sown onto the solid co-culture medium using a 1 mL blue pipette tip into a sterile Erlenmeyer flask. Sterile water is added to rinse both sides. A third rinse is performed with sterile water containing 500 μL / L carbenicillin. Excess water is removed with a pipette and the callus is transferred to sterile filter paper. Dry the callus using the airflow from the clean bench for approximately 30 minutes. Once dry, the callus is transferred to screening medium for selection culture at 28-30°C in the dark. The selection process lasts 3-4 weeks. After one month of selection, bright yellow positive calli are visible. At this point, the positive calli can be transferred to differentiation medium for differentiation and regeneration. Sixteen positive calli are placed on each differentiation dish and cultured in a light-treated greenhouse at 28-30°C. Generally, green spots will appear on the calli after about 10 days, and seedlings will differentiate after about another 10 days. When the differentiated seedlings grow to about 2-3cm and have obvious root systems, they can be transferred to rooting medium to allow them to grow. The rooting medium should be poured into a relatively high bottle or tube so that the rooted seedlings have enough space to grow taller. The rooting culture conditions are 28-30℃ and sterile light culture.

[0081] After transplanting, T0 plants were tested for resistance genes and target loci using PCR. The reaction system and procedure are shown in Tables 3 and 4. The primers for detecting resistance genes were HYG-F1 / HYG-R1, and the primers for detecting target loci were LOC_Os03g054200_J2281092-A1-F1 / R1. The nucleotide sequences of the two primer sets are as follows:

[0082] HYG-F1:CAAAGATCGTTATGTTTATCGGCACT (SEQ ID No. 7);

[0083] HYG-R1: TTGGCGACCTCGTATTGGGAA (SEQ ID No. 8).

[0084] LOC_Os03g05420_J2281092-A1-F1:TTGGTCCTCTTGGTCTGC (SEQ ID No. 9);

[0085] LOC_Os03g05420_J2281092-A1-R1: AGTCCTCTGCTACGCTTG (SEQ ID No. 10).

[0086] Table 3 Reaction system for PCR detection

[0087]

[0088] Table 4 PCR reaction procedure

[0089]

[0090] 3 MTB03g Functional identification test of gene mutant rice

[0091] 3.1 MTB03g Results of growth performance identification of gene mutant rice

[0092] Rice seeds were spread flat in a petri dish lined with moist filter paper and germinated at 28°C. After three days, the rice seeds were essentially germinated and transferred to a rice culture box for incubation at 28°C for approximately 30 days. The seeds were then transferred to a rice field for continued growth. A ruler was used to measure the distance from the root to the tip of the rice seedlings 60 and 80 days after germination, the width of the widest part of the middle of the rice leaf blade, and the angle between the outermost tiller and the vertical line at 60 and 80 days.

[0093] The phenotypic results of rice at 60 and 80 days after germination are as follows Figure 2 As shown, Figure 2 -A is a phenotypic comparison of the wild type and the MTB03g gene mutant MT1-2 strain at 60 days; Figure 2 -B is a phenotypic comparison of the wild type and the MTB03g gene mutant MT1-2 strain at 80 days; Figure 2 -C is a phenotypic comparison of the wild type and the MTB03g gene mutant MT1-3 strain at 60 days; Figure 2 -D is a phenotypic comparison of the wild type and the MTB03g gene mutant MT1-3 strain at 80 days; compared with the wild type, MTB03g The gene mutant strain showed the trait of higher plant height; Figure 3 Wild type and MTB03g Statistical chart of the growth of gene mutant strains; among them, the statistical results of plant height are as follows Figure 3 -A shows that compared with the wild type, the MT1-2 strain increased by 4.4%, and the MT1-3 strain increased by 6.0%; the statistical results of tiller angle are shown in Figure 3 -B shows that compared with the wild type, MTB03g The gene mutant showed a tight tiller angle. Compared with the wild type, the tiller angle of MT1-3 was shortened by 1.7%, which was more conducive to dense planting. MTB03g The growth performance of the gene mutant strain was improved.

[0094] 3.2 MTB03g Yield identification results of gene mutant rice

[0095] Rice seeds were spread flat in a Petri dish lined with moistened filter paper at 28°C for germination. After three days, the seeds were essentially germinated and transferred to a rice incubator at 28°C for approximately 30 days. The seeds were then transferred to a rice field and continued to grow for up to 60 days. A timer was used to count the number of tillers per plant. After the rice matured, the distance from the base to the tip of the panicle was measured with a ruler, the number of tillers per plant was counted with a timer, and 100 plump rice seeds were weighed using an analytical balance.

[0096] wild type and MTB03g Yield indicators of gene mutant rice are as follows Figure 4 As shown, Figure 4 -A is the statistical result of the number of rice tillers, compared with the wild type, MTB03g The tiller number of the mutant rice strains increased significantly, with the MT1-2 strain increasing by 16.4% and the MT1-3 strain increasing by 14.3%. Figure 4 -B is the statistical result of the number of effective tillers at the mature stage of rice. Compared with the wild type, MTB03g The effective tiller number of the gene mutant rice increased, with the MT1-3 line increasing by 31.4%; Figure 4 -C is the statistical result of the panicle length at the mature stage of rice, compared with the wild type, MTB03g The panicle length of the mutant rice was significantly shortened, with the MT1-3 line shortening by 5.2%; Figure 4 -D is the statistical result of 100-grain weight at rice maturity. Compared with the wild type, MTB03g The 100-grain weight of the mutant rice strains was significantly increased, and the MT1-2 strain increased by 8.0%. MTB03g The yield of the gene mutant strain was improved.

Claims

1. Use of the MTB03g gene and MTB03g protein in improving the growth rate of rice plants; characterized in that: Mutating or silencing the MTB03g gene in rice to reduce the expression of the MTB03g gene or to cause defects in the normal function of the MTB03g protein; The nucleotide sequence of the CDS of the MTB03g gene is selected from the nucleotide sequence described in (a) or (b) below: (a) the polynucleotide sequence shown in SEQ ID NO. 1; (b) a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.3; The amino acid sequence of the MTB03g protein is the amino acid sequence shown in SEQ ID NO.

3.

2. Use of the MTB03g gene and MTB03g protein in increasing the tiller number of rice; characterized in that: Mutating or silencing the MTB03g gene in rice to reduce the expression of the MTB03g gene or to cause defects in the normal function of the MTB03g protein; The nucleotide sequence of the CDS of the MTB03g gene is selected from the nucleotide sequence described in (a) or (b) below: (a) the polynucleotide sequence shown in SEQ ID NO. 1; (b) a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.3; The amino acid sequence of the MTB03g protein is the amino acid sequence shown in SEQ ID NO.3.