SNP (Single Nucleotide Polymorphism) molecular marker related to lactation character of buffalo and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to lactation traits of buffalo and application of the SNP molecular marker, the SNP molecular marker is located at the 51st basic group of Chr1166691407, the SNP molecular marker is G or T, and the nucleotide sequence of the Chr1166691407 is shown as SEQ ID NO.1. The invention further discloses a preparation method of the SNP molecular marker related to the lactation traits of buffalo and application of the SNP molecular marker related to the lactation traits of buffalo. The SNP molecular marker which is most related to the peak milk yield of the buffalo is obtained by means of DNA extraction and sequencing, genome comparison, whole genome association analysis and the like, and the peak milk yield of the GG type buffalo is superior to that of buffalo with other genotypes by researching the remarkable association between the genotype of the SNP molecular marker and the peak milk yield of the buffalo; the method is applied to auxiliary breeding of buffalo strains or varieties with the peak milk yield characteristic, so that the breeding period is shortened, the breeding efficiency is improved, and the buffalo produced by the bred buffalo with the peak milk yield characteristic can be greatly improved.

Description

Technical Field

[0001] The invention relates to the field of molecular markers, and in particular to SNP molecular markers related to buffalo lactation traits and applications thereof. Background Art

[0002] my country is rich in buffalo germplasm resources. According to data released by the Food and Agriculture Organization of the United Nations (FAO), my country's total buffalo inventory ranks third in the world, mainly distributed in southern my country. As a superior and characteristic livestock species in southern China, the comprehensive development and utilization of buffalo's genetic resources will drive the economic and social development of rural areas in the south. Buffalo milk is different from the milk produced by well-known dairy cows (commonly black and white cows). Buffalo milk is a special milk with excellent quality and mellow taste, with the characteristics of low production and high nutritional value. Buffalo milk has become the world's second largest source of milk after ordinary milk. According to FAO data, the global buffalo milk production in 2022 is about 143.573 million tons, of which my country's buffalo milk production is about 2.895 million tons, ranking third in the world. The Guangxi Zhuang Autonomous Region is the largest buffalo milk production area in my country, and its high buffalo milk production is inseparable from the scientific research personnel's ten-year breeding work on buffalo.

[0003] Buffalo milk products are popular among consumers worldwide. The main reason is that compared with regular milk, buffalo milk has higher milk fat and milk protein, and its comprehensive nutritional value is 1.85 times that of ordinary milk. Therefore, the lactation-related traits of buffalo are important economic traits and are also important phenotypic traits in the process of buffalo breeding by researchers. Researchers have shown that for every 1 kg increase in peak milk yield of dairy cows (peak milk yield refers to the highest daily milk yield of lactating cows in the current parity, in kilograms), the milk yield per parity can increase by 200-300 kg. Genetics plays a big role in the peak milk yield of dairy buffaloes. Although my country is a major buffalo breeding country, the buffaloes raised are mostly used for ploughing and plowing activities. The peak milk yield or milk performance of utilitarian buffaloes is generally low.

[0004] The lactation trait of buffalo is a typical quantitative trait. Due to the low heritability of quantitative traits and many influencing factors, it is difficult and slow for researchers to breed buffalo with high lactation performance using traditional methods. However, with the advancement of technology and scientific development, genome-wide association analysis (GWAS) can provide a new direction for the study of quantitative traits. Through GWAS sequencing, genetic variations related to economic traits of animals and plants, namely single nucleotide polymorphisms (SNPs), can be screened across the entire genome.

[0005] Therefore, by combining the buffalo whole genome sequencing data obtained through genome resequencing, the high-quality assembly of the buffalo genome (UOA_WB_1), and the buffalo lactation traits (peak milk yield), a large number of SNPs associated with buffalo milk production (peak milk yield) that have never been discovered before can be discovered. This will improve the understanding of the molecular genetic mechanism of complex traits, and screen out SNPs that affect peak milk yield for genetic breeding of buffaloes, thereby breeding high-protein milk buffaloes, which can increase the peak milk yield of buffaloes, improve the quality of buffalo dairy products, and ultimately promote the development of the buffalo milk industry. Summary of the invention

[0006] The purpose of the present invention is to provide a SNP molecular marker related to the lactation trait of buffalo and its application, aiming to overcome the low milk yield of buffalo in service and the defects of traditional buffalo breeding methods such as great difficulty, long cycle and slow progress.

[0007] To achieve the above object, the present invention provides a SNP molecular marker associated with buffalo lactation traits, wherein the SNP molecular marker is located at the 51st base of Chr11_66691407, the SNP molecular marker is G or T, the nucleotide sequence of Chr11_66691407 is shown in SEQ ID NO.1, and the specific details of SEQ ID NO.1 are as follows:

[0008] TAGTTTGAGCATTCTTTGGCATTGCCTTTCTTTGGGACTGGAATGAA AAC(T / G)GACCTTTTCCAGTCCTGTGGCCTCTGCTGAGTTTTCCAAATTT GCTGGCA.

[0009] Preferably, in the above technical solution, the lactation trait of buffaloes with the SNP molecular marker G is superior to the lactation trait of buffaloes with the SNP molecular marker T.

[0010] Preferably, in the above technical solution, the dominant genotype individual of the SNP molecular marker is a GG type buffalo individual.

[0011] A primer for amplifying the SNP molecular marker as described above, characterized in that the primer comprises an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.3, wherein SEQ ID NO.2 is specifically as follows: CCAACACCACAGTTCA AAAGCA; SEQ ID NO.3 is specifically as follows: CCATGGCATGATGGGAGGAT.

[0012] A kit for detecting the SNP molecular marker according to any one of claims 1 to 3, characterized in that the kit comprises an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.3, wherein SEQ ID NO.2 is specifically as follows: CCAAC ACCACAGTTCAAAAGCA; SEQ ID NO.3 is specifically as follows: CCATGGCATGATGG GAGGAT.

[0013] An application of the SNP molecular marker as described above in molecular marker-assisted breeding of buffalo.

[0014] A method for detecting the genotype of a buffalo using molecular biological technology, the method comprising designing amplification primers according to the nucleotide sequences on both sides of the SNP molecular marker site as described above, amplifying the amplification products using the genomic DNA of the individual buffalo to be bred as a template, performing first generation sequencing on the amplification products, typing the individual genes according to the sequencing results, and obtaining the dominant genotype of the buffalo by exploring the association between the peak milk yield of the buffalo and the genotype.

[0015] Preferably, in the above technical solution, the dominant genotype is GG buffalo.

[0016] A method for utilizing the SNP molecular marker as described above to assist in the selection and breeding of buffaloes with a peak milk yield trait, the method comprising extracting genomic DNA from buffaloes to be selected and / or bred, detecting whether the base at position 66691407 of chromosome 11 is T or G, and genotyping the buffaloes to be selected and / or bred as TT type, TG type or GG type; selecting GG type buffaloes with a high peak milk yield for the next step of selection and / or breeding, based on the peak milk yield of GG type buffaloes being much higher than that of TG type buffaloes and TT type buffaloes, thereby obtaining buffalo strains with a high peak milk yield trait.

[0017] An application of the method as described above in molecular marker-assisted breeding of buffalo.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention provides for the first time a SNP molecular marker significantly associated with the peak milk yield trait of buffaloes. The SNP molecular marker can be applied to the genotype analysis of genes related to the peak milk yield of buffaloes, providing a new molecular marker resource for molecular marker-assisted selection of peak milk yield of buffaloes, and providing a new breeding method for accelerating the selection of high-quality buffaloes with peak milk yield. The breeding method can directly select individuals at the genome level at an early stage without relying on phenotypic information, can significantly improve the selection efficiency, accelerate the breeding process, save intermediate feeding costs, improve the breeding efficiency, and reduce the breeding cost, and has a wide range of application prospects in the selection and / or breeding of buffaloes. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The realization of the purpose, functional features and advantages of the present invention will be further explained in conjunction with embodiments and with reference to the accompanying drawings.

[0021] Figure 1 is a Manhattan plot of peak milk yield of genome-wide association analysis of peak milk yield traits of buffaloes of the present invention;

[0022] Figure 2 It is a QQ graph of genome-wide association analysis of peak milk yield lactation traits of buffalo of the present invention;

[0023] Figure 3 is an electrophoretic diagram of the PCR amplification product of SEQ ID NO.1 in the embodiment of the present invention;

[0024] Figure 4 It is the sequencing map of the bases before and after the 66691407th position of chromosome 11 in the present invention. DETAILED DESCRIPTION

[0025] The terms first, second, third, etc. are used herein to describe various parts, components, regions, layers, and / or segments, but these parts, components, regions, layers, and / or segments should not be limited by these terms. These terms are only used to distinguish a certain part, component, region, layer, and / or segment from another part, component, region, layer, and / or segment. Therefore, without departing from the scope of the present invention, the first part, component, region, layer, and / or segment described below may also be described as the second part, component, region, layer, and / or segment.

[0026] The terms used herein are only for describing specific embodiments and are not intended to limit the present invention. Unless the context otherwise clearly indicates the opposite, the singular form used herein is also intended to include the plural form. It should also be understood that the term "comprising" specifically refers to a certain characteristic, field, integer, step, action, element and / or component, but does not exclude the existence or addition of other characteristics, fields, integers, steps, actions, elements, components and / or groups.

[0027] Although not otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as those commonly understood by those skilled in the art. Terms with definitions in dictionaries should be interpreted as having the same meaning as those disclosed in the relevant technical literature and this article, and should not be interpreted in an idealized or overly formal sense.

[0028] The technical solutions in the embodiments of the present invention are described clearly and completely. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] Example 1

[0030] A SNP molecular marker related to the lactation trait of buffalo, wherein the steps of screening and obtaining the SNP molecular marker are as follows:

[0031] The sample data are pedigrees, production records, and lactation trait records of 1 local buffalo, 46 ​​hybrid buffaloes, 31 buffaloes, and 42 Murrah buffaloes (a total of 120 buffaloes) raised at the Guangxi Buffalo Research Institute in China from 2000 to 2021. Peak milk yield is used as the characteristic of lactation traits, and the characteristic peak milk yield is defined as the highest daily milk yield of lactating cows in this parity, in kilograms.

[0032] (1) Sample collection and sequencing:

[0033] Buffalo genomic DNA was extracted from buffalo blood using the phenol / chloroform method, and the integrity and yield of the buffalo genomic DNA were evaluated and verified using agarose gel electrophoresis.

[0034] The buffalo genomic DNA was digested with restriction endonucleases, and then barcoded sequencing adapters were added. The samples were mixed to construct a small fragment library (300-400 bp) and sequenced using the Illumina HiSeqTM 2000 system (Illumina, San Diego, CA).

[0035] (2) Phenotypic data collation and analysis: The phenotypic data collected in step (1) were statistically analyzed using R software. The statistical contents included minimum value, maximum value, mean value, and standard deviation. The results are shown in Table 1

[0036] Table 1 Statistical analysis of buffalo phenotypic determination data

[0037]

[0038] (3) DNA extraction and sequencing: Blood samples were collected from the jugular vein of buffalo using a vacuum blood collector. Genomic DNA was extracted using the phenol / chloroform method in the Molecular Cloning Experiment Guide IV. DNA purity was tested using an ultraviolet spectrophotometer. DNA samples that passed the test were sent to Guangzhou Kidio Biotechnology Co., Ltd. for simplified genome resequencing. The sequencing platform used was Illumina HiSeqTM 2000. The data from the sequencing machine was filtered to obtain valid information. The filtering criteria were as follows:

[0039] 1) Filter out reads containing adapter sequences;

[0040] 2) When reads containing N ratio greater than 10% are removed;

[0041] 3) Remove low-quality reads (the number of bases with a quality value Q≤10 accounts for more than 50% of the entire read);

[0042] The effective data obtained after filtering were further evaluated for sequencing quality to check the error rate distribution. The sequencing error rate and accuracy results are shown in Table 2;

[0043] Table 2 Statistics of error rate and accuracy of buffalo genome DNA resequencing

[0044]

[0045] (4) Genomic data alignment: The genomic data obtained by sequencing were aligned and analyzed using bioinformatics analysis software BWA, SAMtools and GAT K; the reference genome was the fourth edition of the buffalo reference genome (GCA_003121395.1) (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_003121395.1 / ), and the alignment software bwa (0.7.12) was used to align the filtered reads to the reference genome using the mem algorithm, with alignment parameters of -k32-M; after alignment, the results were marked using picard (1.129) software (MarkDuplicates, etc.), but were not filtered out. The average alignment rate of the population sample was 99.54%, and the detailed data alignment information is shown in Table 3 below.

[0046] Table 3 Statistics of buffalo genome data comparison results

[0047]

[0048] (5) SNP quality control and filtering: Variant variation refers to the variation caused by the insertion or deletion of a single nucleotide or several nucleotides at the genome level to form DNA sequence polymorphism. We used the UnifiedGenotyper module of the software GATK (3.4-46) to perform variant detection on multiple samples of the processed comparison files. The detected variants were filtered using VariantFiltration with the filtering parameters of -Window 4, -filter "QD<4.0||FS>60.0||MQ<40.0", -G_filter "GQ<20". After the above steps, 2012270 SNP molecular markers were initially obtained.

[0049] Because rare alleles (alleles with very low frequency in the population), high deletion rate, high heterozygosity rate and other sites will cause abnormalities in population analysis and whole genome association analysis (linear models are very weak in handling extreme cases), which may cause the software to give wrong results, the original marker sites are filtered using a self-written perl script according to the following conditions:

[0050] 1) Removal of non-biallelic sites;

[0051] 2) Sites with minor allele frequency (MAF) less than 0.05 were removed;

[0052] 3) Sites with a deletion rate greater than 0.5 were removed;

[0053] 4) Sites with heterozygous ratios greater than 0.8 were removed.

[0054] The 691,729 SNP molecular markers finally obtained on the autosomes were used for subsequent association analysis.

[0055] (6) Genome-wide association analysis (GWAS): Principal component analysis was performed using GCTA software, followed by association analysis using GEMMA software combined with phenotypic information and genomic SNP information. Within a certain trait, individuals whose phenotypic values ​​were dispersed outside the mean ± 3 times the standard deviation were eliminated, and the first three values ​​of the principal component and sex were added as covariates to the mixed linear model. The model is as follows:

[0056] y=Xα+Qβ+Kμ+e

[0057] Among them, y is the phenotype vector, X is the genotype matrix, α is the genotype effect vector, Q is the fixed effect matrix (PCA score matrix in this study), β is the fixed effect vector, K is the random effect matrix, mainly refers to the kinship matrix, μ is the random effect vector, and e is the residual vector. For each SNP molecular marker, it is tested whether α is 0. The probability value p of α being 0 is used to measure the degree of association between the marker genotype and the phenotype. The smaller the p value, the smaller the probability of α being 0, and the more likely the marker is associated with the trait.

[0058] The sites that reached the significant association level were extracted using R software, and the significance threshold was set to the Bonferron i-adjusted genome-wide significance (0.05 / 745, 490 = 6.71 × 10 -8 ) to detect meaningful correlations. According to the above method, the information of these SNP molecular markers is shown in Figure 1-2 ,from Figure 1 is a Manhattan plot of peak milk yield for buffalo peak milk yield traits, from Figure 1 It can be seen that there is a point above the dotted line on chromosome 11, indicating that the base at position 66691407 of chromosome 11 is most correlated with the peak milk yield trait of buffalo. Therefore, the screened SNP molecular marker related to the peak milk yield of buffalo is located at position 66691407 of chromosome 11. The SNP molecular marker and the preceding and following sequences are named Chr11_66691407. The sequence information of Chr11_66691407 is shown in Table 4.

[0059] Table 4 Sequence information of chromosomes where SNP molecular markers are located

[0060]

[0061] Since the 51st base of Chr11_66691407 is associated with the peak milk production of buffaloes, it is used for buffalo selection and / or breeding for the peak milk production trait of buffaloes. The buffalo selection and / or breeding probably utilizes the SNP molecular marker of the 51st base of Chr11_66691407, designs primers on the nucleotide sequences on both sides thereof, collects blood from the buffaloes when they are born and extracts genomic DNA, uses the primers to perform genotyping on the buffaloes to be tested, and retains individuals with the genotype of the target trait to speed up the breeding of buffaloes.

[0062] Example 2

[0063] A method for detecting buffalo genotype using molecular biology technology, the method steps comprising the following steps:

[0064] (1) Blood was collected from the jugular vein of the selected buffaloes and genomic DNA was extracted using a blood genomic DNA extraction kit. The DNA concentration was measured using a nucleic acid concentration meter and the quality of the DNA sample was measured by 1% agarose gel electrophoresis (eg Figure 3 ). Amplification primers were designed for the selected candidate SNP sites on Chr11_66691407 (as shown in Table 5).

[0065] Table 5 Amplification primers designed for candidate SNP sites

[0066]

[0067] Note: F in the table refers to the upstream primer Forward primer, and R refers to the downstream primer Reverse primer

[0068] The above primers were used to perform PCR amplification with buffalo blood genomic DNA as template. A 50 μL PCR reaction system was used: ddH2O 19 μL, Premix Taq TM 25 μL, DNA template 2.0 μL, primers (upstream primer and downstream primer are both 10 μmol / L) 2.0 μL each.

[0069] PCR reaction conditions:

[0070] Pre-denaturation at 95°C for 4 min; denaturation at 94°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 5 min.

[0071] The PCR amplification product was purified using the Gel Extraction Kit of Shanghai Shenggong Bioengineering Co., Ltd. The specific steps are shown in the kit instructions. The PCR purification product obtained above was recovered and directly sent to BGI (Shenzhen) Biotechnology Co., Ltd. for first-generation sequencing. The individual genotypes were performed according to the sequencing results. The genotyping results are shown in Table 6.

[0072] Table 6 Genotype frequency and allele frequency of SNP molecular markers in buffalo

[0073]

[0074] As can be seen from Table 6, the T allele frequency of the SNP molecular marker at the 51st base of Chr11_66691407 mutation site is 0.853, while the G allele frequency is 0.147. By comparison, it is found that the T allele frequency is significantly greater than the G allele frequency.

[0075] Table 7 Validation of SNPs significantly associated with peak milk yield in buffalo

[0076]

[0077] Note: Peak milk volume phenotype values ​​are expressed as "least square mean ± standard deviation". Data in the same column with different letters on the shoulders indicate significant differences (P<0.05); data with the same letters on the shoulders or no letters on the shoulders indicate no significant differences (P>0.05); SNP locus genotypes are arranged in the order of reference type, heterozygous type, and mutant type.

[0078] As can be seen from Table 7, through verification, it was found that the peak milk yield of buffalo with genotype GG at the 51st base of candidate Chr11_66691407 was significantly different from that of TG and TT buffalo, and the peak milk yield of GG buffalo was significantly higher than that of TG or TT buffalo. Further, it was shown that when the SNP molecular marker at the 51st base of Chr11_66691407 was G, the milk production of buffalo could be increased. Therefore, the 51st base of Chr11_66691407 can be used as a molecular marker to identify the peak milk yield of buffalo, and used to assist in the selection of buffalo strains or varieties with peak milk yield characteristics. Applying the selected buffalo to production can greatly increase the overall milk production of buffalo.

[0079] Embodiment 3:

[0080] A method for breeding buffaloes with peak milk yield traits using SNP molecular markers, the method comprising:

[0081] (1) Extraction of genomic DNA: Blood was collected from the jugular vein of buffaloes at 3-6 months of age, and genomic DNA was extracted using a blood genomic DNA extraction kit.

[0082] (2) Using the amplification primers designed with the SNP molecular marker of the 51st base of Chr11_66691407, PCR amplification and sequencing were performed with the genomic DNA as a template, and the deoxynucleotide at the 66691407 position of chromosome 11 was measured to be T or G, and its genotype was further determined to be TT type, TG type or GG type. Since the peak milk yield of GG type buffalo is much higher than that of TG type buffalo and TT type buffalo, individuals with the GG type genotype were selected for the next step of selection and / or breeding, so as to shorten the breeding period of buffalo lines with peak milk yield traits and accelerate the breeding speed.

[0083] from Figure 4 It can be seen that the deoxynucleotide at position 66691407 of chromosome 11 is T.

[0084] The present invention can be implemented in various ways and is not limited to the embodiments described. A person skilled in the art can understand that the present invention can be implemented in other specific ways without changing the technical concept or essential features of the present invention. Therefore, it should be understood that the embodiments described above are exemplary and are not intended to limit the present invention.

Claims

1. A SNP molecular marker associated with buffalo lactation traits, characterized in that: The SNP molecular marker is located at the 51st base of Chr11_66691407, the SNP molecular marker is G or T, and the nucleotide sequence of Chr11_66691407 is shown in SEQ ID NO.

1.

2. The SNP molecular marker associated with the lactation trait of buffalo according to claim 1, characterized in that: The lactation trait of buffaloes with the SNP molecular marker G is superior to the lactation trait of buffaloes with the SNP molecular marker T.

3. The SNP molecular marker associated with the lactation trait of buffalo according to claim 2, characterized in that: The dominant genotype individual of the SNP molecular marker is the GG buffalo individual.

4. A primer for amplifying a SNP molecular marker according to any one of claims 1 to 3, characterized in that: The primers include an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.

3.

5. A kit for detecting the SNP molecular marker according to any one of claims 1 to 3, characterized in that the kit comprises an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.

3.

6. Use of the SNP molecular marker according to any one of claims 1 to 3 in molecular marker-assisted breeding of buffalo.

7. A method for detecting buffalo genotype using molecular biology technology, characterized in that: The method comprises designing amplification primers according to the nucleotide sequences on both sides of the SNP molecular marker site as claimed in claim 1, amplifying the amplification products using the genomic DNA of the individual buffalo to be bred as a template, performing first generation sequencing on the amplification products, typing the individual genotypes according to the sequencing results, and obtaining the dominant genotypes of the buffaloes by exploring the association between the peak milk yield of the buffaloes and the genotypes.

8. The method for detecting buffalo genotype using molecular biology technology according to claim 7, characterized in that: The dominant genotype is GG buffalo.

9. A method for breeding buffaloes with peak milk production traits using the SNP molecular markers as described in any one of claims 1 to 3, characterized in that: The method comprises the following steps: extracting genomic DNA of water buffaloes to be selected and / or bred, detecting whether the base at the 66691407th position of chromosome 11 is T or G, and performing genotyping of the water buffaloes to be selected and / or bred as TT type, TG type or GG type; selecting GG type water buffaloes with high peak milk volume for the next step of selection and / or breeding based on the fact that the peak milk volume of the water buffaloes of the GG type is much higher than that of the water buffaloes of the TG type and the TT type, and obtaining water buffalo strains with high peak milk volume traits.

10. Use of the method according to claim 9 in molecular marker-assisted breeding of buffalo.

Images