Lipid composition

Abstract

The invention relates to a drug delivery system suitable for tumor administration, in particular to a lipid composition suitable for intratumoral administration, which comprises a therapeutic agent and / or a prophylactic agent which can be RNA, is suitable for intratumoral administration, and can be used for delivering the therapeutic agent and / or the prophylactic agent to a mammal tumor so as to regulate polypeptide, protein or gene expression.

Description

A lipid composition

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application No. 202210951311.0 filed on August 9, 2022, which is incorporated herein by reference in its entirety. Technical Field

[0003] The present invention relates to a tumor drug delivery system, and in particular to a lipid composition suitable for intratumoral injection and related products and their application in cancer treatment. Background Art

[0004] Nanoparticle compositions, liposomes, and liposome complexes containing lipids are used as transport vehicles to effectively deliver bioactive substances such as small molecule drugs, proteins, and nucleic acids to cells and / or intracellular compartments. These lipid compositions generally include cationic lipids, structural lipids, helper lipids, and / or surfactants.

[0005] Several lipid-based drug delivery systems have been developed, such as liposomes and lipid nanoparticle (LNP) drug delivery systems. However, in actual use, especially in tumor administration, these lipid-based drug delivery systems have been found to have many problems. For example, when LNP compositions are injected intratumorally, they are not expressed only locally in the tumor; a large portion is expressed in the liver, thus posing a potential risk of hepatotoxicity. Therefore, although research on lipid-based drug delivery systems has made significant progress, there is still a need for more efficient, stable, and well-targeted lipid delivery systems.

[0006] At present, in order to solve the problem of poor tumor targeting of lipid drug delivery systems, many companies mainly improve them by designing mRNA sequences (see, for example, SL Hewitt et al., Intratumoral IL12 mRNA therapy promotes TH1 transformation of the tumor microenvironment, Clinical Cancer Research 26 (23) (2020) 6284-6298.) or modifying them (see, for example, C. Hotz, TR et al., Local delivery of mRNA-encoded cytokines promotes antitumor immunity and tumor eradication across multiple preclinical tumor models, Science Translational Medicine 13 (610) (2021) eabc7804.). This paper solves this technical problem by further optimizing the lipid drug delivery system.

[0007] Summary of the Invention

[0008] On the one hand, the present invention provides a lipid composition, which comprises a therapeutic agent or a prophylactic agent and a lipid that encapsulates the therapeutic agent or the prophylactic agent, wherein the lipid that encapsulates the therapeutic agent or the prophylactic agent comprises a cationic lipid, a phospholipid, a steroid and a polyethylene glycol-modified lipid; the composition further comprises a cationic polymer, wherein the cationic polymer is associated with the therapeutic agent or the prophylactic agent to form a complex and is co-encapsulated in the lipid to form a lipid polymer complex; the cationic lipid comprises a lipid compound of formula (I) or a pharmaceutically acceptable salt thereof, which is as defined herein.

[0009] In one embodiment, the therapeutic or prophylactic agent is a nucleic acid, such as RNA, particularly mRNA.

[0010] In one embodiment, the cationic lipid is M5.

[0011] In one embodiment, the cationic lipid is SW-II-127, SW-II-135-1 or SW-II-138-1.

[0012] In a preferred embodiment, the lipid composition comprises

[0013] 10-70 mol% cationic lipid, 10-70 mol% phospholipid, 10-70 mol% steroid and 0.05-20 mol% polyethylene glycol-modified lipid;

[0014] Preferably comprising 30-45 mol% of cationic lipids, 10-20 mol% of phospholipids, 30-48.5 mol% of steroids and 1-1.5 mol% of polyethylene glycol-modified lipids; and / or

[0015] cationic lipids, DOPE, cholesterol, and DMG-PEG;

[0016] Most preferably, it comprises 40% cationic lipid, 15% DOPE, 43.5% cholesterol and 1.5% DMG-PEG.

[0017] In one embodiment, the therapeutic or prophylactic agent is a polynucleotide comprising a coding region, wherein the coding region encodes IL-12, wherein the IL-12 comprises the amino acid sequence of SEQ ID NO: 3, or an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 3; and wherein the polynucleotide is RNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 4; or wherein the polynucleotide is DNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 5.

[0018] In some embodiments, the polynucleotide is RNA comprising the nucleotide sequence of SEQ ID NO:6 or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO:6; or the polynucleotide is DNA comprising the nucleotide sequence of SEQ ID NO:7 or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO:7.

[0019] In one aspect, the present invention also provides a pharmaceutical composition comprising the lipid composition of the present invention, and optionally a pharmaceutically acceptable excipient.

[0020] In another aspect, the lipid composition or pharmaceutical composition provided by the present invention is used for tumor administration; the tumor administration preferably includes intratumoral administration, subcutaneous administration around the tumor, or administration into the artery that supplies blood to the tumor, and most preferably intratumoral injection.

[0021] In another aspect, the present invention also provides an intratumoral injection, comprising the lipid composition of the present invention, and optionally a pharmaceutically acceptable excipient for preparing an injectable preparation.

[0022] In another aspect, the present invention also provides use of the lipid composition of the present invention, the pharmaceutical composition of the present invention, or the intratumoral injection of the present invention in preparing a medicament for treating or preventing cancer in a subject in need thereof.

[0023] In another aspect, the present invention also provides a method for preventing or treating cancer in a subject in need thereof, the method comprising administering to a subject in need thereof a lipid composition of the present invention, a pharmaceutical composition of the present invention, or an intratumoral injection of the present invention. The lipid composition or pharmaceutical composition can be administered intratumorally, subcutaneously peritumorally, or intraarterially to the tumor, preferably by intratumoral injection.

[0024] In another aspect, the present invention also provides a method for delivering a therapeutic agent or a prophylactic agent to a tumor in a mammalian subject, the method comprising administering the lipid composition or pharmaceutical composition of the present invention to the subject, wherein the administration comprises contacting the tumor with the lipid composition or pharmaceutical composition, thereby delivering the therapeutic agent and / or prophylactic agent to the tumor.

[0025] In another aspect, the present invention also provides a method for producing a target polypeptide in a tumor in a mammalian subject, the method comprising contacting the tumor with a lipid composition or a pharmaceutical composition of the present invention, wherein the therapeutic agent or prophylactic agent is mRNA, and wherein the mRNA encodes the target polypeptide, whereby the mRNA can be translated in the cancer to produce the target polypeptide. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figures 1A-1D show the luciferase expression results of LNP or LPP formulations prepared with different formulations after intratumoral injection when the cationic lipid was M5. Figure 1A shows luciferase expression in mice. Figure 1B shows luciferase expression in the liver and tumors of mice. Figure 1C shows the liver / tumor luciferase expression ratio. Figure 1D shows the liver / systemic luciferase expression ratio.

[0027] Figures 2A-2B show the tumor inhibition effects of LNP or LPP formulations prepared with different formulations using M5 as the cationic lipid in B16F10 tumor-bearing mice. Figure 2A shows tumor volume. Figure 2B shows body weight change.

[0028] Figures 3A-3B show the tumor inhibition effects of LNP or LPP formulations prepared with different formulations using M5 as the cationic lipid in A20 tumor-bearing mice. Figure 3A shows tumor volume. Figure 3B shows body weight change.

[0029] FIG4 shows the expression of SW0715 in A375 tumor-bearing mice.

[0030] FIG5 shows that the expression of SW0715 in A375 cells and MDA-MB-231 cells is dose-dependent.

[0031] Figure 6 shows that the expression product of SW0715 can effectively activate primary CD8 + T cells.

[0032] FIG7 shows the tumor inhibitory effect of SW0715 on the humanized mouse MDA-MB-231 subcutaneous transplant tumor model. Specific implementation plan

[0033] General Definitions and Terminology

[0034] All patents, patent applications, scientific publications, manufacturer's instructions and guidelines, etc., cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein should be construed as an admission that the present disclosure is not entitled to antedate such publication.

[0035] Unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, and microbiology used herein are those widely used in the respective fields. To facilitate a better understanding of the present invention, definitions and explanations of relevant terms are provided below.

[0036] As used herein, the expressions "comprise," "include," "contain," and "have" are open ended and mean the inclusion of the listed elements, steps, or components but not the exclusion of other unlisted elements, steps, or components. The expression "consisting of excludes any element, step, or component not specified. The expression "consisting essentially of means that the scope is limited to the specified elements, steps, or components, plus optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of" and "consisting of are encompassed within the meaning of the expression "comprising."

[0037] As used herein, the singular forms "a," "an," or "the" include plural referents unless the context indicates otherwise. The terms "one or more" or "at least one" encompass 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.

[0038] Recitation of ranges of values ​​herein is intended merely to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. Unless expressly indicated to the contrary, values ​​or ranges recited herein are modified by "about" to mean ±20%, ±10%, ±5%, or ±3% of the recited or claimed value or range.

[0039] Unless otherwise stated, all methods described herein can be performed in any suitable order.

[0040] As used herein, "nucleotides" include deoxyribonucleotides and ribonucleotides and their derivatives. As used herein, "ribonucleotides" are constituents of ribonucleic acid (RNA), consisting of one base molecule, one pentose molecule, and one phosphate molecule. They refer to nucleotides with a hydroxyl group at the 2' position of the β-D-ribofuranosyl group. "Deoxyribonucleotides" are constituents of deoxyribonucleic acid (DNA), also consisting of one base molecule, one pentose molecule, and one phosphate molecule. They refer to nucleotides in which the hydroxyl group at the 2' position of the β-D-ribofuranosyl group is replaced by hydrogen, and are the main chemical components of chromosomes. "Nucleotides" are usually referred to by a single letter representing the base: "A (a)" refers to deoxyadenosine or adenylate containing adenine, "C (c)" refers to deoxycytidine or cytidine containing cytosine, "G (g)" refers to deoxyguanosine or guanylate containing guanine, "U (u)" refers to uridine containing uracil, and "T (t)" refers to deoxythymidylate containing thymine.

[0041] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA). "Polynucleotide sequence," "nucleic acid sequence," and "nucleotide sequence" are used interchangeably to refer to the order of nucleotides in a polynucleotide. It will be understood by those skilled in the art that a DNA coding strand (sense strand) and the RNA it encodes can be considered to have the same nucleotide sequence, with deoxythymidylic acid in the DNA coding strand sequence corresponding to uridine in the RNA sequence it encodes.

[0042] As used herein, the term "% identity" with respect to sequences refers to the percentage of identical nucleotides or amino acids in an optimal alignment between the sequences to be compared. The differences between the two sequences can be distributed over local regions (segments) or over the entire length of the sequences to be compared. The identity between the two sequences is usually determined after optimal alignment of a segment or "comparison window." Optimal alignment can be performed manually, or by means of algorithms known in the art, including but not limited to the local homology algorithm described by Smith and Waterman, 1981, Ads App. Math. 2,482 and Neddleman and Wunsch, 1970, J. Mol. Biol. 48,443, the search for similarity method described by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88,2444, or using computer programs such as GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. For example, the percent identity of two sequences can be determined using the publicly available BLASTN or BLASTP algorithms available on the National Center for Biotechnology Information (NCBI) website.

[0043] In some embodiments, the % homogeneity is given in the region of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100%. In some embodiments, the homogeneity is given to the whole length of the reference sequence. The comparison of sequence homogeneity can be determined with instruments known in the art, preferably using optimal sequence alignment, for example, using Align, using standard settings, preferably EMBOSS::needle, Matrix:Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0044] As used herein, "modified" refers to non-natural. For example, RNA can be modified RNA. That is, RNA can include one or more non-naturally occurring nucleobases, nucleosides, nucleotides, or linking groups. "Modified" groups can also be referred to herein as "altered" groups. Groups can be modified or altered chemically, structurally, or functionally. For example, a modified nucleobase can include one or more non-naturally occurring substitutions.

[0045] As used herein, the term "expression" includes transcription and / or translation of a nucleotide sequence. Thus, expression can involve the production of transcripts and / or polypeptides. The term "transcription" refers to the process by which the genetic code in a DNA sequence is transcribed into RNA (transcript). The term "in vitro transcription" refers to the in vitro synthesis of RNA, particularly mRNA, in a cell-free system (e.g., in an appropriate cell extract). A vector that can be used to produce a transcript is also referred to as a "transcription vector," which contains regulatory sequences required for transcription. The term "transcription" encompasses "in vitro transcription."

[0046] As used herein, the term "host cell" refers to a cell used to receive, maintain, replicate, or express a polynucleotide or vector.

[0047] As used herein, an "aliphatic" group is a non-aromatic group in which the carbon atoms are linked in a chain, and can be saturated or unsaturated.

[0048] As used herein, the term "alkyl" refers to an optionally substituted straight or branched chain saturated hydrocarbon comprising one or more carbon atoms. 12 Alkyl" or "C 1-12 "Alkyl" refers to an optionally substituted straight or branched chain saturated hydrocarbon comprising 1 to 12 carbon atoms. As used herein, the term "alkoxy" refers to an alkyl group as described herein, which is attached to the remainder of the molecule through an oxygen atom. The term "alkylene" refers to a divalent group formed by the corresponding alkyl group having lost one hydrogen atom. The term "C1-C 12 "Alkylene" or "C 1-12 "Alkylene" refers to an optionally substituted straight or branched chain alkylene group comprising 1 to 12 carbon atoms.

[0049] As used herein, the term "alkenyl" refers to an optionally substituted straight or branched chain hydrocarbon comprising two or more carbon atoms and at least one double bond. 12 Alkenyl" or "C 2-12 "Alkenyl" refers to an optionally substituted straight or branched chain hydrocarbon comprising 2 to 12 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may comprise one, two, three, four or more carbon-carbon double bonds.

[0050] As used herein, the term "carbocycle" refers to a monocyclic or polycyclic non-aromatic system comprising one or more rings consisting of carbon atoms. 3-8 "Carbocycle" means a carbon ring comprising 3-8 carbon atoms. The carbocycle may include one or more carbon-carbon double or triple bonds. Examples of carbocycles include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, and the like. As used herein, when a carbocycle is saturated (i.e., does not contain unsaturated bonds), it may also refer to the corresponding cycloalkyl group. Unless otherwise specifically stated, the carbocycles described herein refer to unsubstituted and substituted, i.e., optionally substituted, carbocycles.

[0051] As used herein, the term "heterocycle" refers to a monocyclic or polycyclic ring system comprising one or more rings and comprising at least one heteroatom. The heteroatom can be, for example, a nitrogen, oxygen, phosphorus or sulfur atom. The heterocycle can include one or more double bonds or triple bonds and can be non-aromatic. Examples of heterocycles include, but are not limited to, imidazolidinyl, oxazolidinyl, thiazolidinyl, pyrazolidinyl, isoxazolidinyl, isothiazolidinyl, morpholinyl, pyrrolidinyl, tetrahydrofuranyl and piperidinyl. The heterocycle can comprise, for example, 3-10 atoms (non-hydrogen), i.e., 3-10 membered heterocycles (e.g., 3, 4, 5, 6, 7, 8, 9 or 10 members), wherein one or more atoms are heteroatoms (e.g., N, O, S or P). When the heterocycle is saturated (i.e., without unsaturated bonds), it can also refer to the corresponding heterocycloalkyl. Unless otherwise specifically stated, the heterocycles described herein refer to both unsubstituted and substituted heterocyclic groups, i.e., optionally substituted heterocycles.

[0052] As used herein, the term "aryl" refers to an all-carbon monocyclic or fused polycyclic aromatic ring group having a conjugated π electron system. 10 The alkylaryl group may have 6 to 10 carbon atoms, for example 6, 7, 8, 9, or 10 carbon atoms. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, and the like.

[0053] As used herein, the term "heteroaryl" refers to a monocyclic or fused polycyclic ring system containing at least one ring atom selected from N, O, S, with the remaining ring atoms being C, and having at least one aromatic ring. A heteroaryl group can have 5-10 ring atoms (5-10 membered heteroaryl), including 5-, 6-, 7-, 8-, 9-, or 10-membered, particularly 5- or 6-membered heteroaryl groups. Examples of heteroaryl groups include, but are not limited to, pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, pyrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, quinolyl, isoquinolyl, tetrazolyl, triazolyl, triazinyl, benzofuranyl, benzothienyl, indolyl, isoindolyl, and the like.

[0054] Unless otherwise specifically stated, the groups described herein (e.g., any one of R1-R7, such as alkyl, alkylene, alkenyl, aryl, amino, etc.) may be optionally substituted. Optional substituents may be selected from, but are not limited to, halogen atoms (e.g., chloro, bromo, fluoro, or iodo), carboxylic acids (e.g., -C(O)OH), alcohols (e.g., hydroxy, -OH), esters (e.g., -C(O)OR or -OC(O)R), aldehydes (e.g., -C(O)H), carbonyls (e.g., -C(O)R, or represented by C=O), acyl halides (e.g., -C(O)X, wherein X is a halide selected from bromo, fluoro, chloro, and iodo), carbonates (e.g., -OC(O)OR), alkoxy groups (e.g., -OR), acetals (e.g., -C(OR)2R"", wherein each OR is the same or different alkoxy group and R"" is an alkyl or alkenyl group), phosphates (e.g., P(O)4 3- ), thiols (e.g., -SH), sulfoxides (e.g., -S(O)R), sulfinic acids (e.g., -S(O)OH), sulfonic acids (e.g., -S(O)2OH), thialdehydes (e.g., -C(S)H), sulfates (e.g., S(O)4 2- ), sulfonyl (e.g., -S(O)2-), amide (e.g., -C(O)NR2 or -N(R)C(O)R), azido (e.g., -N3), nitro (e.g., -NO2), cyano (e.g., -CN), isocyano (e.g., -NC), acyloxy (e.g., -OC(O)R), amino (e.g., -NR2, NRH, or -NH2), carbamoyl (e.g., -OC(O)NR2, -OC(O)NRH, or -OC(O)NH2), sulfonamide (e.g., -S(O)2NR2, -S(O)2NRH, -S(O)2NH2, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)S(O)2H, -N(H)S(O)2H), C1-C 12 Alkyl, C2-C 12 Alkenyl, C6-C 10 aryl, 5-10 membered heteroaryl or 3-10 membered heterocycle. In any of the foregoing, each R can independently be a substituent as defined herein, such as alkyl, alkoxy, aryl, heteroaryl or alkenyl. In some embodiments, the substituent itself can be further substituted with, for example, one, two, three, four, five or six substituents as defined herein. For example, alkyl can be further substituted with one, two, three, four, five or six substituents as described herein.

[0055] As used herein, the term "compound" is intended to include isotopic compounds of the depicted structure. "Isotopes" refer to atoms having the same atomic number but different mass numbers due to the number of neutrons in their nuclei, such as deuterium isotopes. For example, isotopes of hydrogen include tritium and deuterium. In addition, the compounds, salts, or complexes of the present invention can be prepared by combining with solvents or water molecules to form solvates and hydrates by conventional methods.

[0056] The term "optionally" or "optionally" (e.g., optionally substituted) means that the subsequently described event may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where the event or circumstance does not occur. For example, "optionally substituted alkyl" means that the alkyl radical may or may not be substituted, and that the description includes both substituted and unsubstituted alkyl radicals.

[0057] It should be understood that when chemical groups are written in a particular order, the reverse order is also encompassed unless otherwise stated. For example, in the formula -(R) where M1 is defined as -C(O)NH- i -(M1) k -(R) m -(i.e., -(R) i -C(O)-NH-(R) m -), unless otherwise stated, also encompasses compounds where M1 is -NHC(O)- (i.e., -(R) i -NHC(O)-(R) m -).

[0058] As used herein, the term "contact" refers to establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a lipid composition means that the mammalian cell and lipid nanoparticle are physically connected. The method of contacting a cell with an external entity in vivo and in vitro is well-known in the biological field. For example, contacting a lipid composition with a mammalian cell in a mammal can be carried out by different routes of administration (such as intratumoral) and can relate to different amounts of lipid compositions. In addition, the lipid composition can contact more than one mammalian cell.

[0059] As used herein, the term "delivery" refers to providing an entity to a target. For example, delivering a therapeutic or prophylactic agent to a subject can involve administering a composition comprising the therapeutic or prophylactic agent to the subject.

[0060] As used herein, the term "subject" describes an organism to which the compositions of the present invention may be administered. Subjects to which these compositions may be administered include, but are not limited to, humans, other primates, and other mammals, such as cattle, pigs, horses, sheep, cats, dogs, mice, or rats. Preferably, the subject may be a mammal, particularly a human.

[0061] As used herein, a "lipid component" is a component of a composition that includes one or more lipids. For example, the lipid component can include one or more cationic lipids, PEGylated lipids, structural lipids, or helper lipids.

[0062] The phrase "pharmaceutically acceptable" is used herein to refer to compounds, salts, materials, compositions and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications, and are consistent with a reasonable benefit / risk ratio.

[0063] As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is altered by converting an existing acid or base moiety into its salt form (e.g., by reacting a free basic group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues such as amines; alkali metal or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include, but are not limited to, acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate, and the like. Representative alkali metal or alkaline earth metal salts include, but are not limited to, sodium, lithium, potassium, calcium, magnesium salts, and the like; and non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. Pharmaceutically acceptable salts of the present invention include, for example, conventional non-toxic salts of the parent compound formed from non-toxic inorganic or organic acids. Pharmaceutically acceptable salts of the present invention can be synthesized from parent compounds containing a basic or acidic moiety by conventional chemical methods. Generally speaking, these salts can be prepared by reacting the free acid or base form of these compounds with a stoichiometric amount of an appropriate base or acid in water or in an organic solvent, or in a mixture of the two; non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are generally preferred.

[0064] As used herein, the term "treat" refers to partially or completely alleviating, ameliorating, improving, relieving, delaying the onset of, inhibiting the progression of, reducing the severity of, or reducing the occurrence of one or more symptoms or features of a particular infection, disease, disorder, or condition. "Preventing" refers to guarding against an underlying disease or preventing the worsening of symptoms or the development of a disease.

[0065] The term "prophylactically or therapeutically effective amount" refers to an amount of an agent (e.g., nucleic acid, drug, composition, therapeutic agent, diagnostic agent, prophylactic agent, etc.) sufficient to prevent or inhibit the occurrence of a disease or symptom and / or slow down, alleviate, or delay the development or severity of a disease or symptom. The prophylactically or therapeutically effective amount is affected by factors including, but not limited to, the rate of development and severity of the disease or symptom, the age, sex, weight, and physiological condition of the subject, the duration of treatment, and the specific route of administration. The prophylactically or therapeutically effective amount can be administered in one or more doses. The prophylactically or therapeutically effective amount can be achieved by continuous or intermittent administration.

[0066] Lipid composition

[0067] Provided herein is a lipid composition that is a lipid delivery vehicle, wherein the lipid can encapsulate a therapeutic agent or a preventive agent (such as a nucleotide) to form nanoparticles, thereby delivering the nanoparticles into an organism.

[0068] As used herein, the term "lipid" refers to an organic compound comprising a hydrophobic portion and optionally a hydrophilic portion. Lipids are generally poorly soluble in water but soluble in many organic solvents. Typically, amphipathic lipids comprising a hydrophobic portion and a hydrophilic portion can be organized into a lipid bilayer structure in an aqueous environment, for example, in the form of vesicles. Lipids may include, but are not limited to, fatty acids, glycerides, phospholipids, sphingolipids, glycolipids, steroids, and cholesterol esters.

[0069] As used herein, "lipid nanoparticle" or "LNP" refers to a lipid vesicle having a uniform lipid core, which is a particle formed by lipids, the lipid components of which undergo intermolecular interactions to form a nanostructured entity. A therapeutic or prophylactic agent (such as a nucleic acid, e.g., mRNA) is encapsulated in the lipids.

[0070] Particularly preferred lipid compositions can be, for example, lipid polyplexes (LPPs) as described herein. Methods for preparing such compositions are as described herein. LPPs are particles having a core-shell structure, wherein a therapeutic or prophylactic agent (such as a nucleic acid, such as mRNA) is contained in a polyplex, which itself is encapsulated in a biocompatible lipid bilayer shell to form the lipid nanoparticles of the present invention. In some embodiments, the lipid composition of the present invention is a lipid polyplex (LPP). In some embodiments, the composition of the present invention is a lipid polyplex (LPP) comprising RNA.

[0071] In some embodiments, the lipid encapsulating the therapeutic or preventive agent (such as a nucleic acid, e.g., mRNA) is selected from one or more of the following lipids: a cationic lipid, a phospholipid, a steroid, and / or a polyethylene glycol-modified lipid. In a preferred embodiment, the cationic lipid is an ionizable cationic lipid.

[0072] In one embodiment, the lipid composition comprises a cationic lipid, wherein the cationic lipid comprises DOTMA, DOTAP, DDAB, DOSPA, DODAC, DODAP, DC-Chol, DMRIE, DMOBA, DLinDMA, DLenDMA, CLinDMA, DMORIE, DLDMA, DMDMA, DOGS, N4-cholesteryl-spermine, DLin-KC2-DMA, DLin-MC3-DMA, a compound of formula (I), (II), (III) or (IV) as described herein, or a combination thereof. In a preferred embodiment, the cationic lipid comprises M5. In a preferred embodiment, the cationic lipid comprises SW-II-127, SW-II-135-1 or SW-II-138-1. In a preferred embodiment, the cationic lipid comprises M5, SW-II-127, SW-II-135-1 or SW-II-138-1.

[0073] In one embodiment, the lipid composition comprises a phospholipid and / or a steroid. In one embodiment, the lipid composition comprises a phospholipid as described herein, wherein the phospholipid comprises 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diondecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl Phosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) or a combination thereof. In one embodiment, the lipid composition comprises a steroid as described herein, wherein the steroid comprises cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol and derivatives thereof.In one embodiment, the lipid composition comprises a phospholipid as described herein and a steroid. In one embodiment, the lipid composition comprises DOPE. In one embodiment, the lipid composition comprises DSPC. In one embodiment, the lipid composition comprises cholesterol. In one embodiment, the lipid composition comprises DOPE and cholesterol. In one embodiment, the lipid composition comprises DSPC and cholesterol.

[0074] In one embodiment, the lipid composition comprises cationic lipid M5, SW-II-127, SW-II-135-1 or SW-II-138-1, phospholipid DOPE and cholesterol. In one embodiment, the lipid composition comprises cationic lipid M5, SW-II-127, SW-II-135-1 or SW-II-138-1, phospholipid DSPC and cholesterol.

[0075] In some embodiments, the lipid encapsulating the polynucleotide further comprises a polyethylene glycol-modified lipid. In one embodiment, the polyethylene glycol-modified lipid comprises DMG-PEG (e.g., DMG-PEG 2000), DOG-PEG, and DSPE-PEG, or a combination thereof. In one embodiment, the polyethylene glycol-modified lipid is DSPE-PEG. In one embodiment, the polyethylene glycol-modified lipid is DMG-PEG (e.g., DMG-PEG 2000).

[0076] In one embodiment, the lipid composition comprises a cationic lipid, DOPE, cholesterol, and DSPE-PEG.

[0077] In one embodiment, the lipid composition comprises a cationic lipid, DSPC, cholesterol, and DSPE-PEG.

[0078] In one embodiment, the lipid composition comprises a cationic lipid, DSPC, cholesterol, and DMG-PEG.

[0079] In a preferred embodiment, the lipid composition comprises a cationic lipid, DOPE, cholesterol, and DMG-PEG.

[0080] In a preferred embodiment, the lipid composition comprises the cationic lipid M5, SW-II-127, SW-II-135-1 or SW-II-138-1, DOPE, cholesterol and DMG-PEG.

[0081] In some embodiments, the lipid composition of the present invention further comprises a cationic polymer, which is associated with the therapeutic agent or prophylactic agent (such as a nucleic acid, for example, mRNA) as a complex and is co-encapsulated in the lipid.

[0082] In one embodiment, the cationic polymer comprises poly-L-lysine, protamine, polyethyleneimine (PEI), or a combination thereof. In one embodiment, the cationic polymer is protamine. In one embodiment, the cationic polymer is polyethyleneimine.

[0083] In one embodiment, the amount of lipid in the lipid composition is calculated as molar percentage (mol %), which is determined based on the total mole of lipid in the composition. Unless otherwise specified, the sum of the amount (mol %) of each lipid in the composition is 100 mol %, i.e., the sum of the amount (mol %) of cationic lipids, phospholipids, steroids, and polyethylene glycol-modified lipids is 100 mol %.

[0084] In one embodiment, the amount of cationic lipid in the lipid composition is about 10-about 70 mol%. In some embodiments, the amount of cationic lipid in the lipid composition is about 20-about 60 mol%, about 30-about 50 mol%, about 30-about 45 mol%, about 35-about 50 mol%, about 35-about 45 mol%, about 38-about 45 mol%, about 40-about 45 mol%, about 40-about 50 mol% or about 45-about 50 mol%. For example, the amount of cationic lipid can be about 30, 32.5, 35, 37.5, 40, 42.5, 45, 46.1, 47.5, 50, 52.5, 55, 57.5 or 60 mol%.

[0085] In one embodiment, the amount of phospholipids in the lipid composition is about 10-about 70 mol%. In one embodiment, the amount of phospholipids in the lipid composition is about 20-about 60 mol%, about 30-about 50 mol%, about 10-about 30 mol%, about 10-about 20 mol%, or about 10-about 15 mol%. For example, the amount of phospholipids can be about 5, 10, 15, 20, 23, 25, 30, 35 or 40 mol%.

[0086] In one embodiment, the amount of cholesterol in the lipid composition is about 10 to about 70 mol%. In one embodiment, the amount of cholesterol in the lipid composition is about 20 to about 60 mol%, about 24 to 44 mol%, about 30 to about 50 mol%, about 30 to about 48.5 mol%, about 35 to about 40 mol%, about 35 to about 45 mol%, about 40 to about 45 mol%, or about 45 to about 50 mol%. For example, the amount of cholesterol can be about 10, 15, 17.5, 18.75, 20, 22.5, 25, 27.5, 28.75, 29, 30, 32.5, 33.75, 34, 35, 38.5, 38.75, 40, 42.5, 43.5, 43.75, 44, 45, 46.25, 47.5, 48.5, 48.75, 49, 50, 52.5, 53.75, 55, 60, 62.5, 63.75, 65, or 70 mole percent.

[0087] In one embodiment, the amount of polyethylene glycol-modified lipids in the lipid composition is about 0.05-about 20 mol%. In one embodiment, the amount of polyethylene glycol-modified lipids in the lipid composition is about 0.5-about 15 mol%, about 1-about 10 mol%, about 5-about 15 mol%, about 1-about 5 mol%, about 1-about 1.5 mol%, about 1.5-about 3 mol%, or about 2-5 mol%. For example, the amount of polyethylene glycol-modified lipids can be about 0.05, 0.9, 1, 1.25, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 15 or 20 mol%.

[0088] In one embodiment, the lipid composition comprises 10-70 mol % of cationic lipids, 10-70 mol % of phospholipids, 10-70 mol % of steroids and 0.05-20 mol % of polyethylene glycol-modified lipids. In a preferred embodiment, the lipid composition comprises 30-45 mol % of cationic lipids, 10-20 mol % of phospholipids, 30-48.5 mol % of steroids and 1-1.5 mol % of polyethylene glycol-modified lipids.

[0089] In one embodiment, the LPP comprises a therapeutic or prophylactic agent of the present invention (e.g., a nucleic acid, e.g., mRNA) associated with a cationic polymer as a complex; and a lipid encapsulating the complex, wherein the lipid encapsulating the complex comprises a cationic lipid, a phospholipid, a steroid, and a polyethylene glycol-modified lipid. In one embodiment, the phospholipid is selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoylphosphatidylcholine (DSPC), or a combination thereof. In one embodiment, the steroid is cholesterol. In one embodiment, the cationic polymer is protamine. In one embodiment, the polyethylene glycol-modified lipid is selected from 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG), or a combination thereof. In one embodiment, the cationic lipid is selected from M5, SW-II-127, SW-II-135-1 or SW-II-138-1.

[0090] In one embodiment, the lipid encapsulating complex comprises 40 mol% M5, SW-II-127, SW-II-135-1 or SW-II-138-1, 15 mol% DOPE, 43.5 mol% cholesterol and 1.5 mol% DMG-PEG.

[0091] In one embodiment, the therapeutic or prophylactic agent is a polynucleotide comprising a coding region, wherein the coding region encodes IL-12, wherein the IL-12 comprises the amino acid sequence of SEQ ID NO: 3, or an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 3; and wherein the polynucleotide is RNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 4; or wherein the polynucleotide is DNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 5.

[0092] In one embodiment, the polynucleotide is RNA comprising the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 6; or the polynucleotide is DNA comprising the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 7.

[0093] In one embodiment, the lipid encapsulating the complex comprises 40 mol% M5, SW-II-127, SW-II-135-1 or SW-II-138-1, 15 mol% DOPE, 43.5 mol% cholesterol and 1.5 mol% DMG-PEG; the therapeutic or prophylactic agent is a polynucleotide comprising a coding region encoding IL-12, wherein the IL-12 comprises the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 3; and wherein the polynucleotide is RNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 4; or wherein the polynucleotide is DNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 5.

[0094] In one embodiment, the lipid encapsulating the complex comprises 40 mol% M5, 15 mol% DOPE, 43.5 mol% cholesterol and 1.5 mol% DMG-PEG; the therapeutic or prophylactic agent is a polynucleotide comprising a coding region encoding IL-12, wherein the IL-12 comprises the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 3; and wherein the polynucleotide is RNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 4; or wherein the polynucleotide is DNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 5.

[0095] In one embodiment, the lipid encapsulating the complex comprises 40 mol% M5, SW-II-127, SW-II-135-1 or SW-II-138-1, 15 mol% DOPE, 43.5 mol% cholesterol and 1.5 mol% DMG-PEG; the therapeutic or prophylactic agent is a polynucleotide, which is RNA comprising the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence having at least 85% identity with the nucleotide sequence of SEQ ID NO: 6; or the polynucleotide is DNA comprising the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence having at least 85% identity with the nucleotide sequence of SEQ ID NO: 7.

[0096] In one embodiment, the lipid encapsulating the complex comprises 40 mol% M5, 15 mol% DOPE, 43.5 mol% cholesterol and 1.5 mol% DMG-PEG; the therapeutic or prophylactic agent is a polynucleotide, which is RNA comprising the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence having at least 85% identity to the nucleotide sequence of SEQ ID NO: 6; or the polynucleotide is DNA comprising the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence having at least 85% identity to the nucleotide sequence of SEQ ID NO: 7.

[0097] Cationic lipids

[0098] Cationic lipids are lipids that can have a net positive charge at a given pH. Lipids with a net positive charge can associate with nucleic acids through electrostatic interactions.

[0099] Examples of cationic lipids include, but are not limited to, 1,2-di-O-octadecenyl-3-trimethylammonium-propane (DOTMA), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), didecyldimethylammonium bromide (DDAB), 2,3-dioleoyloxy-N-[2(spermine carboxamide)ethyl]-N,N-dimethyl-l-propanamium trifluoroacetate (DOSPA), dioctadecyldimethylammonium chloride ... dioctadecyldimethylammonium chloride (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium bromide (DDAB), dioctadecyldimethylammonium brom chloride (DODAC), 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), 3-(N—(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium (D MRIE), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 3-dimethylamino-2-(cholest-5-en-3-β-oxybutane-4-oxy)-1-(cis, cis-9,1-(cis,cis-9,12-octadecadienoxy)propane (3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-tadecadienoxy)propane, CLinDMA), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-aminium bromide bromide, DMORIE), N,N-dimethyl-2,3-bis(dodecyloxy)propan-1-amine (DLDMA), N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-amine (DMDMA), dioctadecylamidoglycyl spermine spermine (DOGS), N4-cholesteryl-spermine, 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane, DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate, DLin-MC3-DMA, a compound of formula (I), (II), (III) or (IV) as described herein, or a combination thereof.

[0100] In some embodiments, the cationic lipid is preferably an ionizable cationic lipid. Ionizable cationic lipids carry a net positive charge at, for example, acidic pH, but are neutral at higher pH (eg, physiological pH). Examples of ionizable cationic lipids include, but are not limited to, dioctadecylamidoglycyl spermine (DOGS), N4-cholesteryl-spermine, 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA), a compound of formula (I), (II), (III) or (IV) as described herein, or a combination thereof.

[0101] In a preferred embodiment, the cationic lipid comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof:

[0102] in,

[0103] R1 and R2 are each independently selected from C1-C 12 Alkyl and C2-C 12 alkenyl;

[0104] R3 and R4 are each independently selected from C1-C 12 Alkyl, C2-C 12 Alkenyl, C6-C 10 Aryl and 5-10 membered heteroaryl;

[0105] R3 and R4 are each independently optionally substituted by t R6, t is an integer selected from 1-5; R6 are each independently selected from C1-C 12 Alkyl and C2-C 12 alkenyl;

[0106] M1 and M2 are each independently selected from -OC(O)-, -C(O)O-, -SC(S)-, and -C(S)S-;

[0107] R5 is selected from -C 1-12 Alkylene-Q, Q is selected from -OR7 and -SR7, R7 is independently selected from H, C1-C 12 Alkyl, C2-C12 Alkenyl, C1-C 12 Alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C6-C 10 Aryl and 5-10 membered heteroaryl;

[0108] m and n are each independently an integer selected from 1-12.

[0109] In one embodiment, the cationic lipid comprises a lipid compound having the structure shown below, or a pharmaceutically acceptable salt thereof:

[0110] In one embodiment, at least one of R3 and R4 is C6-C 10 aryl or 5-10 membered heteroaryl.

[0111] In one embodiment, R2 is selected from C1-C 12 In another embodiment, R2 is selected from C1-C6 alkyl.

[0112] In one embodiment, one of R3 and R4 is C6-C 10 Aryl or 5-10 membered heteroaryl, the other is C1-C 12 Alkyl or C2-C 12 Alkenyl.

[0113] In one embodiment, R3 and R4 are each independently selected from C1-C 12 In another embodiment, one of R3 and R4 is phenyl and the other is C1-C 12 alkyl.

[0114] In another embodiment, R3 and R4 are each independently substituted with t R6, t being an integer selected from 1-5; for example 1, 2, 3, 4 or 5. Preferably, t is an integer from 1-3, for example 1, 2 or 3, in particular 1 or 2.

[0115] In one embodiment, R6 is independently selected from C1-C 12 Alkyl groups, such as C1-C 10 alkyl.

[0116] In one embodiment, t is 1 and R6 is substituted at the meta or para position relative to R1 or R2 on the phenyl ring.

[0117] In another embodiment, t is 2 and R6 is substituted at the meta and para positions on the phenyl ring relative to R1 or R2.

[0118] In one embodiment, R4 is substituted at the 1st or last position of R2. The 1st position refers to the position of the carbon atom in R2 that is directly connected to M2. The last position refers to the position of the carbon atom in R2 that is farthest from M2. In a specific embodiment, R4 is selected from C1-C 12 Alkyl, R3 is phenyl.

[0119] In one embodiment, R3 is substituted at the 1st position or the last position of R1. The 1st position refers to the position of the carbon atom in R1 that is directly connected to M1. The last position refers to the position of the carbon atom in R1 that is farthest from M1. In a specific embodiment, R3 is selected from C1-C 12 Alkyl, R4 is phenyl.

[0120] In one embodiment, M1 and M2 are each independently selected from -OC(O)- and -C(O)O-.

[0121] In one embodiment, R5 is selected from -C 1-5 Alkylene-Q, such as C1, C2, C3, C4 or C5 alkylene-Q. In exemplary embodiments, R5 is selected from -C 1-3 Alkylene-Q, for example C1, C2 or C3 alkylene-Q.

[0122] In another embodiment, Q is selected from -OH and -SH, in particular -OH.

[0123] In some embodiments, m and n are each independently an integer selected from 2-9, such as 2, 3, 4, 5, 6, 7, 8 or 9. Preferably, m and n are each independently an integer selected from 2-7, such as 2, 3, 4, 5, 6 or 7, more preferably, m and n are each independently an integer selected from 5-7, such as 5, 6 or 7.

[0124] In certain embodiments, the compound of formula (I) includes a compound represented by formula (II):

[0125] or a pharmaceutically acceptable salt thereof, wherein each group is as defined herein.

[0126] In one embodiment,

[0127] R1 is selected from C1-C6 alkyl;

[0128] R2 is selected from C1-C 10 alkyl;

[0129] R4 is selected from C1-C 10 alkyl;

[0130] M1 and M2 are each independently selected from -OC(O)- and -C(O)O-;

[0131] R5 is selected from -C 1-5 Alkylene-Q, Q is selected from -OR7 and -SR7, R7 is independently selected from H, C1-C 12 Alkyl and C2-C 12 alkenyl;

[0132] R6 are each independently selected from C1-C 12 Alkyl and C2-C 12 Alkenyl, especially C1-C 12 alkyl;

[0133] m and n are each independently an integer selected from 2-9, such as 2, 3, 4, 5, 6, 7, 8 or 9;

[0134] t is an integer selected from 1-3.

[0135] In one embodiment, R5 is selected from -C 1-3 Alkylene-Q, Q is selected from -OH and -SH, in particular -OH.

[0136] In one embodiment, m and n are each independently an integer selected from 2-7, such as 2, 3, 4, 5, 6 or 7.

[0137] In some embodiments, t is 1 or 2.

[0138] In one embodiment, R4 is substituted at position 1 or the last position of R2. Position 1 refers to the position of the carbon atom in R2 that is directly connected to M2. The last position refers to the position of the carbon atom in R2 that is farthest from M2.

[0139] In one embodiment, t is 1 and R6 is substituted at the meta or para position relative to R1 on the phenyl ring.

[0140] In another embodiment, t is 2 and R6 is substituted at the meta and para positions on the phenyl ring relative to R1.

[0141] In certain embodiments, the compound of formula (I) includes a compound represented by formula (III):

[0142] or a pharmaceutically acceptable salt thereof, wherein each group is as defined herein.

[0143] In one embodiment,

[0144] R1 is selected from C1-C6 alkyl;

[0145] R2 is selected from C1-C 10 alkyl;

[0146] R4 is selected from C1-C 10 alkyl;

[0147] R5 is selected from -C1-3 Alkylene-Q, Q is selected from -OH and -SH, in particular -OH;

[0148] t is 1 or 2;

[0149] R6 is selected from C1-C 12 Alkyl and C2-C 12 Alkenyl, especially C1-C 12 alkyl;

[0150] m and n are each independently an integer selected from 2-7, for example 2, 3, 4, 5, 6 or 7.

[0151] In one embodiment, R4 is substituted at the 1st or last position of R2. The last position refers to the position of the C atom in R2 that is directly connected to the The position of the furthest C atom in the part.

[0152] In one embodiment, t is 1 and R6 is substituted at the meta or para position relative to R1 on the phenyl ring.

[0153] In another embodiment, t is 2 and R6 is substituted at the meta and para positions on the phenyl ring relative to R1.

[0154] In certain embodiments, the compound of formula (I) includes a compound represented by formula (IV):

[0155] or a pharmaceutically acceptable salt thereof, wherein each group is as defined herein.

[0156] In one embodiment,

[0157] R1 is selected from C1-C6 alkyl;

[0158] R2 is selected from C1-C 10 alkyl;

[0159] R4 is selected from C1-C 10 alkyl;

[0160] t is 1 or 2;

[0161] R6 are each independently selected from C1-C 12 Alkyl and C2-C 12 Alkenyl, especially C1-C 12 alkyl;

[0162] m and n are each independently an integer selected from 2-7, for example 2, 3, 4, 5, 6 or 7.

[0163] In one embodiment, R4 is substituted at the 1st or last position of R2. The last position refers to the position of the C atom in R2 that is directly connected to the The position of the furthest C atom in the part.

[0164] In one embodiment, t is 1 and R6 is substituted at the meta or para position relative to R1 on the phenyl ring.

[0165] In another embodiment, t is 2 and R6 is substituted at the meta and para positions on the phenyl ring relative to R1.

[0166] In a specific embodiment, the substituents (eg, R1-R7) in the lipid compounds of the present invention do not include alkenyl groups.

[0167] In a preferred embodiment, the cationic lipid comprises a lipid compound having the structure shown below, or a pharmaceutically acceptable salt thereof:

[0168] In a preferred embodiment, the cationic lipid comprises the following lipid compounds SW-II-127, SW-II-135-1 or SW-II-138-1.

[0169] phospholipids

[0170] The lipid composition of the present invention contains phospholipids, which can assist the cell penetration of the lipid composition.

[0171] Examples of phospholipids include, but are not limited to, 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diondecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl Phosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), or a combination thereof.

[0172] steroids

[0173] The lipid compositions of the present invention contain steroids, which may serve as structural components of the lipid compositions.

[0174] Examples of steroids include, but are not limited to, cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, and derivatives thereof.

[0175] PEG-modified lipids

[0176] As used herein, the term "polyethylene glycol-modified lipid" or "PEG-modified lipid" or "PEG lipid" refers to a molecule comprising a polyethylene glycol portion and a lipid portion, which is a lipid modified with polyethylene glycol. The PEG lipid can be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (PEG-CER), PEG-modified dialkylamine, PEG-modified diacylglycerol (PEG-DEG), PEG-modified dialkylglycerol, or a combination thereof. For example, examples of polyethylene glycol-modified lipids include, but are not limited to, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-dioleoyl-rac-glycerol, methoxypolyethylene Glycol (DOGPEG), and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG).

[0177] In one embodiment, the polyethylene glycol-modified lipid is DMG-PEG, such as DMG-PEG 2000. In one embodiment, DMG-PEG 2000 has the following structure:

[0178] The average value of n is 44.

[0179] Cationic polymers

[0180] As used herein, the term "cationic polymer" refers to any ionic polymer that can carry a net positive charge at a specified pH, thereby electrostatically binding to nucleic acids. Examples of cationic polymers include, but are not limited to, poly-L-lysine, protamine, polyethyleneimine (PEI), or a combination thereof. The polyethyleneimine can be linear or branched.

[0181] The term "protamine" refers to a low molecular weight basic protein rich in arginine, which exists in sperm cells of various animals (especially fish) and replaces histones to bind to DNA. In a preferred embodiment, the cationic polymer is protamine (e.g., protamine sulfate).

[0182] Pharmaceutical composition

[0183] The present invention also provides a pharmaceutical composition comprising the lipid composition of the present invention and a pharmaceutically acceptable carrier.

[0184] Pharmaceutically acceptable carriers may include, but are not limited to, diluents, binders and adhesives, lubricants, disintegrants, preservatives, vehicles, dispersants, glidants, sweeteners, coatings, excipients, preservatives, antioxidants (such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-tocopherol, citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitan, The carrier may be a surfactant (e.g., a glycerol ...

[0185] The pharmaceutical compositions provided herein can be in various dosage forms, including but not limited to solid, semisolid, liquid, powder or lyophilized forms. For pharmaceutical compositions, preferred dosage forms can generally be, for example, injections and lyophilized powders. Pharmaceutical compositions can be prepared into various forms suitable for multiple routes of administration and methods. For example, pharmaceutical compositions can be prepared into liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders and granules), dosage forms for surface and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and patches), suspensions, powders and other forms.

[0186] The pharmaceutical composition of the present invention may be an injectable pharmaceutical composition, which may accordingly contain a pharmaceutically acceptable excipient for injection, preferably an excipient for intratumoral injection.

[0187] Therefore, the present invention also provides an intratumoral injection, which comprises the lipid composition of the present invention and a pharmaceutically acceptable injection excipient. For example, it can include a sterile injectable aqueous or oily suspension. The sterile injectable formulation can be a sterile injectable solution, suspension and / or emulsion in a nontoxic diluent and / or solvent.

[0188] The injection excipients may include one or more of water, sugar solution, electrolyte solution, amino acid solution or fat emulsion. For example, the injection excipients may include one or more of 5% and 10% glucose injection, 0.9% sodium chloride injection, sterile water for injection, 5-10% fructose solution, 5% sodium bicarbonate solution, seal oil or lactose hydrate.

[0189] Therapeutic / preventive agents

[0190] The lipid composition may comprise one or more therapeutic or prophylactic agents. The present invention provides methods for delivering a therapeutic or prophylactic agent to a mammalian tumor, producing a target polypeptide in a mammalian tumor, and treating cancer in a mammal in need thereof, comprising administering to the mammal a lipid composition comprising a therapeutic or prophylactic agent.

[0191] Therapeutic agents or preventatives include biologically active substances and are alternatively referred to as "active agents". Therapeutic agents or preventatives can be substances that cause desired changes in the tumor after being delivered to the tumor. In some embodiments, therapeutic agents or preventatives are small molecule drugs that can be used to treat specific tumors. Examples of medicines that can be used for compositions include but are not limited to anti-neoplastic agents (such as vincristine (vincristine), doxorubicin (doxorubicin), mitoxantrone (mitoxantrone), camptothecin (camptothecin), cisplatin (cisplatin), bleomycin (bleomycin), cyclophosphamide (cyclophosphamide), methotrexate and streptozotocin (streptozotocin)), anti-tumor agents (such as actinomycin D (actinomycin D), vincristine, vinblastine (vinblastine), alkylating agents, platinum compounds, antimetabolites and nucleoside analogs, such as methotrexate and purine and pyrimidine analogs).

[0192] In some embodiments, the therapeutic or prophylactic agent is a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that elicits an immune response, or another therapeutic or prophylactic agent. Cytotoxins or cytotoxic agents include any agent that is harmful to cells. Examples include, but are not limited to, paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy anthracin, daunorubic ... dione), mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids such as maytansinol, rachelmycin (CC-1065), and analogs or homologues thereof. Radioactive ions include, but are not limited to, iodine (e.g., iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium-90, samarium-153, and praseodymium. Vaccines may include compounds and formulations that direct an immune response against cancer cells and may include mRNA encoding tumor cell-derived antigens, epitopes, and / or neo-epitopes.Other therapeutic or prophylactic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, and 5-fluorouracil dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa, chlorambucil, razithromycin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide,

[0014] Examples of the present invention include, but are not limited to, daunomycin (formerly daunomycin), bleomycin, mithramycin, and anthramycin (AMC), and antimitotic agents such as vincristine, vinblastine, paclitaxel, and maytansine.

[0193] polynucleotides

[0194] In some embodiments, the therapeutic or prophylactic agent is a polynucleotide or nucleic acid (eg, ribonucleic acid or deoxyribonucleic acid).

[0195] In some embodiments, the therapeutic or preventive agent of the present invention is RNA. As used herein, the definition of "RNA" encompasses single-stranded, double-stranded, linear and circular RNA. The RNA of the present invention can be RNA produced by chemical synthesis, recombinant production and in vitro transcription. In one embodiment, the RNA of the present invention is used to express polypeptides in host cells.

[0196] In one embodiment, the therapeutic or preventive agent of the present invention is a single-stranded RNA. In one embodiment, the RNA of the present invention is an in vitro transcribed RNA (IVT-RNA). IVT-RNA can be obtained by in vitro transcription using a DNA template using RNA polymerase.

[0197] In some embodiments, the therapeutic or preventive agent of the present invention is a messenger RNA (mRNA). Generally speaking, an mRNA may comprise a 5'-UTR sequence, a coding sequence for a polypeptide, a 3'-UTR sequence, and an optional poly(A) sequence. The mRNA can be produced, for example, by in vitro transcription or chemical synthesis. In one embodiment, the mRNA of the present invention comprises (1) a 5'-UTR, (2) a coding sequence, (3) a 3'-UTR, and (4) an optional poly(A) sequence. In one embodiment, the mRNA of the present invention is a nucleoside-modified mRNA. In one embodiment, the mRNA of the present invention comprises an optional 5' cap.

[0198] As used herein, the term "untranslated region (UTR)" generally refers to a region (non-coding region) in RNA (such as mRNA) that is not translated into an amino acid sequence, or a corresponding region in DNA. Generally, the UTR located at the 5' end (upstream) of the open reading frame (start codon) can be referred to as the 5' untranslated region 5'-UTR; the UTR located at the 3' end (downstream) of the open reading frame (stop codon) can be referred to as the 3'-UTR. In the presence of a 5' cap, the 5'-UTR is located downstream of the 5' cap, for example, directly adjacent to the 5' cap. In a specific embodiment, an optimized "Kozak sequence" can be included in the 5'-UTR, for example, near the start codon, to improve translation efficiency. In the presence of a poly (A) sequence, the 3'-UTR is located upstream of the poly (A) sequence, for example, directly adjacent to the poly (A) sequence.

[0199] As used herein, the term "poly(A) sequence" or "poly(A) tail" refers to a nucleotide sequence containing continuous or discontinuous adenylate nucleotides. The poly(A) sequence is typically located at the 3' end of the RNA, for example, at the 3' end (downstream) of the 3'-UTR. In some embodiments, the poly(A) sequence does not contain nucleotides other than adenylate nucleotides at its 3' end. The poly(A) sequence can be transcribed from the coding sequence of the DNA template by a DNA-dependent RNA polymerase during the preparation of the IVT-RNA, or can be attached to the free 3' end of the IVT-RNA, for example, at the 3' end of the 3'-UTR, by a DNA-independent RNA polymerase (poly(A) polymerase).

[0200] As used herein, the term "5' cap" generally refers to an N7-methylguanosine structure (also known as an "m7G cap," "m7Gppp-") attached to the 5' end of an mRNA via a 5' to 5' triphosphate bond. The 5' cap can be co-transcriptionally added to the RNA during in vitro transcription (e.g., using the anti-reverse cap analog "ARCA"), or it can be attached to the RNA post-transcriptionally using a capping enzyme.

[0201] In some embodiments, the therapeutic or preventive agent of the present invention is DNA. Such DNA can be, for example, a DNA template for in vitro transcription of the RNA of the present invention or a DNA vaccine for expressing a polypeptide antigen in a host cell. The DNA can be double-stranded, single-stranded, linear, or circular.

[0202] The DNA template can be provided in a suitable transcription vector. Generally speaking, the DNA template can be a double-stranded complex, which comprises a nucleotide sequence identical to the coding sequence described herein (coding strand) and a nucleotide sequence complementary to the coding sequence described herein (template strand). As known to those skilled in the art, the DNA template can include a promoter, 5'-UTR, coding sequence, 3'-UTR and an optional poly (A) sequence. The promoter can be an available promoter for a suitable RNA polymerase (particularly DNA-dependent RNA polymerase) known to those skilled in the art, including but not limited to promoters of SP6, T3 and T7 RNA polymerases. The 5'-UTR, coding sequence, 3'-UTR and poly (A) sequence in the DNA template are the corresponding sequences included in the RNA described herein or are complementary thereto. As the polynucleotide of a DNA vaccine, it can be provided in a plasmid vector (e.g., a circular plasmid vector).

[0203] In some embodiments, the therapeutic or preventive agent of the present invention is an mRNA encoding a cytokine, including but not limited to IL-2, IL-10, IL-12, IL-15, IL-21, IFN-α, IFN-β, or IFN-γ.

[0204] In a preferred embodiment, the therapeutic or preventive agent of the present invention is IL-12 mRNA, and its exemplary nucleic acid sequence can be found in SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6.

[0205] Interleukin-12 (IL-12)

[0206] In some embodiments, the therapeutic or preventive agent herein is a polynucleotide encoding interleukin 12 (IL-12). In some embodiments, the therapeutic or preventive agent herein is an RNA encoding IL-12. In some embodiments, the therapeutic or preventive agent herein is a DNA encoding IL-12. IL-12 is a proinflammatory cytokine that plays an important role in innate immunity and adaptive immunity. It can promote Th1 cell differentiation, strengthen the cytotoxic effects of cytotoxic T cells (CTL cells) and natural killer cells (NK cells), and play an important role in cellular immunity. IL-12 mainly functions as a 70kDa heterodimeric protein (p70) composed of a p35 subunit and a p40 subunit. The IL-12p40 subunit is also referred to as IL12B, as used herein, and its protein sequence is shown in NCBI accession number NP_002178.2. The IL-12p35 subunit is also referred to as IL12A, as used herein, and its protein sequence is shown in NCBI accession number NP_000873.2. Unless otherwise specified, interleukin-12 (IL-12) or IL-12(p70) herein is a heterodimeric protein composed of a p35 subunit and a p40 subunit. In some embodiments, IL-12 or IL-12(p70) is a fusion protein comprising, from N-terminus to C-terminus, a p40 subunit, a peptide linker, and a p35 subunit. In a preferred embodiment, IL-12 or IL-12(p70) comprises the amino acid sequence of SEQ ID NO: 3.

[0207] In some embodiments, the polypeptide encoded by the polynucleotide of the present invention comprises the amino acid sequence of SEQ ID NO: 3 or is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 3. The polypeptide encoded by the polynucleotide of the present invention can promote Th1 cell differentiation and enhance the cytotoxic effect of CTL cells and NK cells.

[0208] In some embodiments, the polynucleotide comprises a coding region that encodes IL-12.

[0209] As used herein, "coding sequence" refers to a nucleotide sequence in a polynucleotide that can be used as a template for synthesizing a nucleotide sequence having a defined nucleotide sequence (e.g., tRNA and mRNA) or a defined amino acid sequence in a biological process. The coding sequence can be a DNA sequence or an RNA sequence. If the mRNA corresponding to the DNA sequence (including a coding strand identical to the mRNA sequence and a template strand complementary thereto) is translated into a polypeptide in a biological process, the DNA sequence or mRNA sequence can be considered to encode the polypeptide.

[0210] As used herein, "codon" refers to three consecutive nucleotide sequences (also known as triplet codes) in a polynucleotide that encode a specific amino acid. Synonymous codons (codons encoding the same amino acid) are used at different frequencies in different species, which is called "codon preference". It is generally believed that for a given species, the coding sequence using the codons of its preference can have higher translation efficiency and accuracy in the species expression system. Therefore, polynucleotides can be "codon optimized", that is, the codons in the polynucleotides are changed to reflect the codons of the host cell preference, and preferably the amino acid sequence encoded by them is not changed. It will be understood by those skilled in the art that due to the degeneracy of codons, the polynucleotides of the present invention may include such coding sequences, which are different from the coding sequences described herein (e.g., having about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% homology to the coding sequences described herein) but encode the same amino acid sequence. In a specific embodiment, the RNA of the present invention comprises codons optimized for host (eg, subject, particularly human) cells, such that the polypeptide of the present invention is optimally expressed in the host (eg, subject, particularly human).

[0211] In one embodiment, the polynucleotides of the present invention comprise a coding sequence for a polypeptide as described herein. In one embodiment, the polynucleotides of the present invention comprise a nucleotide sequence complementary to a coding sequence for a polypeptide as described herein. In one embodiment, the coding sequence comprises a start codon at its 5' end and a stop codon at its 3' end. In one embodiment, the coding sequence comprises an open reading frame (ORF) as described herein.

[0212] In one embodiment, the coding sequence of the present invention encodes a polypeptide comprising:

[0213] (1) the amino acid sequence of SEQ ID NO:3; or (2) an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence in SEQ ID NO:3.

[0214] In one embodiment, the coding sequence of a polypeptide described herein comprises a nucleotide sequence comprising: (1) the nucleotide sequence of SEQ ID NO:4; (2) a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to the nucleotide sequence of SEQ ID NO:4; (3) the nucleotide sequence of SEQ ID NO:5; or (4) a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to the nucleotide sequence of SEQ ID NO:5.

[0215] In some embodiments, the polynucleotides of the present invention are RNA. In some embodiments, the RNA of the present invention further comprises structural elements that contribute to improving the stability and / or translation efficiency of the RNA, including but not limited to a 5' cap, a 5'-UTR, a 3'-UTR, and a poly(A) sequence.

[0216] In some embodiments, the RNA of the present invention comprises a 5'-UTR. In a preferred embodiment, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:8. In a preferred embodiment, the 3'-UTR comprises the nucleotide sequence of SEQ ID NO:9. In some embodiments, the RNA of the present invention comprises a 5'-UTR and a 3'-UTR. In a specific embodiment, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO:8, and the 3'-UTR comprises the nucleotide sequence of SEQ ID NO:9.

[0217] In some embodiments, the RNA of the present invention comprises a poly(A) sequence. In one embodiment, the poly(A) sequence comprises contiguous adenylate nucleotides. In one embodiment, the poly(A) sequence may comprise at least 20, 30, 40, 50, 60, 70, 75, 80, 85, 95, or 100, and up to 120, 150, 180, 200, or 300 adenylate nucleotides. In one embodiment, the poly(A) sequence comprises at least 50 nucleotides. In one embodiment, the poly(A) sequence comprises at least 80 nucleotides. In one embodiment, the poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises approximately 70, 80, 90, 100, 120, or 150 nucleotides. In one embodiment, the contiguous adenylate sequence in the poly(A) sequence is interrupted by a sequence comprising U, C, or G nucleotides. In one embodiment, the poly(A) sequence comprises the nucleotide sequence of SEQ ID NO: 12.

[0218] In one embodiment, the RNA of the present invention comprises the nucleotide sequence of SEQ ID NO: 4. In one embodiment, the RNA of the present invention comprises the nucleotide sequence of SEQ ID NO: 6.

[0219] In one embodiment, the RNA of the invention (a) comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO:4 or 6; and (b) encodes an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO:3.

[0220] In some embodiments, the polynucleotides of the present invention are DNA. In some embodiments, the DNA of the present invention comprises a coding sequence for a polypeptide as described herein. In some embodiments, the DNA of the present invention comprises, from the 5' end to the 3' end, (1) a T7 promoter, (2) a 5'-UTR, (3) a coding sequence, (4) a 3'-UTR, and (5) an optional poly(A) sequence as described herein.

[0221] In some embodiments, the T7 promoter comprises the nucleotide sequence of SEQ ID NO:14.

[0222] In some embodiments, the DNA of the present invention comprises a 5'-UTR. In a preferred embodiment, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 10. In a preferred embodiment, the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the RNA of the present invention comprises a 5'-UTR and a 3'-UTR. In a specific embodiment, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 10, and the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 11.

[0223] In some embodiments, the DNA of the present invention comprises a poly(A) sequence. In one embodiment, the poly(A) sequence comprises continuous deoxyadenylic acid. In one embodiment, the poly(A) sequence may comprise at least 20, 30, 40, 50, 60, 70, 75, 80, 85, 95, or 100, and up to 120, 150, 180, 200, or 300 deoxyadenylic acid. In one embodiment, the continuous adenylic acid sequence in the poly(A) sequence is interrupted by a sequence comprising T, C, or G nucleotides. In one embodiment, the poly(A) sequence comprises the nucleotide sequence of SEQ ID NO: 13.

[0224] In one embodiment, the DNA of the present invention comprises the nucleotide sequence of SEQ ID NO: 5. In one embodiment, the DNA of the present invention comprises the nucleotide sequence of SEQ ID NO: 7.

[0225] In one embodiment, the DNA of the invention (a) comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO: 5 or 7; and (b) encodes an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 3.

[0226] Modified nucleotides

[0227] In some embodiments, the mRNA herein comprises modified nucleotides, wherein the modified nucleotides are selected from one or more of the following nucleotides: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-ur ... The invention also includes alkynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine, N-1-methyl-pseudouridine, 2-thiouridine and 2-thiocytidine; methylated bases; inserted bases; 2'-fluororibose, ribose, 2'-deoxyribose, arabinose and hexose; thiophosphate and 5'-N-phosphoramidite bond. Modifications are made to the modified nucleotides described in PCT / CN2020 / 074825 and PCT / CN2020 / 106696.

[0228] In one embodiment, the RNA (e.g., mRNA) of the present invention is modified by including one or more modified nucleobases. In one embodiment, the modified nucleobases include modified cytosine, modified uracil, or a combination thereof. In one embodiment, the modified uracil is independently selected from pseudouracil, 1-methyl-pseudouracil, 5-methyl-uracil, or a combination thereof. In one embodiment, the modified cytosine is independently selected from 5-methylcytosine, 5-hydroxymethylcytosine, or a combination thereof. In one embodiment, the proportion of modified nucleobases in the RNA of the present invention is 10%-100%, i.e., the RNA of the present invention can be modified by replacing 10%-100% of the nucleobases therein with modified nucleobases.

[0229] In some embodiments, the RNA (e.g., mRNA) of the present invention is modified by replacing one or more uracils with modified uracils. In one embodiment, the modified uracil comprises 1-methylpseudouracil, pseudouracil, 5-methyl-uracil, or a combination thereof. In one embodiment, the modified uracil comprises pseudouracil. In one embodiment, the modified uracil comprises 5-methyl-uracil. In one embodiment, the modified uracil comprises 1-methyl-pseudouracil.

[0230] In one embodiment, the RNA is modified by replacing at least one uracil with a modified uracil. In one embodiment, the RNA is modified by replacing all uracils with modified uracils. In one embodiment, the proportion of modified uracils in the RNA is 10%-100%, such as 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%. In one embodiment, the proportion of modified uracils in the RNA is 20%-100%. In one embodiment, 20%-100% of the uracils in the RNA are replaced by 1-methylpseudouracil. In a preferred embodiment, 100% of the uracils in the RNA are replaced by 1-methylpseudouracil.

[0231] 1-Methyl-pseudouridine has the following structure:

[0232] In a specific embodiment, the mRNA of the present invention comprises the nucleotide sequence of SEQ ID NO: 6, wherein 100% of uracil is replaced by 1-methylpseudouracil.

[0233] Application of lipid compositions and pharmaceutical compositions

[0234] Lipid composition of the present invention, pharmaceutical composition and intratumoral injection can be used for treating cancer. Specifically, these lipid composition, pharmaceutical composition and intratumoral injection can be used for treating cancer characterized by loss or abnormal protein or polypeptide activity. For example, lipid composition and pharmaceutical composition comprising the mRNA of coding loss or abnormal polypeptide can be used or delivered to the tumor. This mRNA can be translated subsequently and produce the polypeptide, thus reducing or eliminating the problem caused by the non-existence or abnormal activity of this polypeptide. The therapeutic agent or preventive comprising in the lipid composition can also change the transcription rate of given mRNA, thus affecting gene expression.

[0235] As used herein, "cancer" to which a lipid composition, pharmaceutical composition, or intratumoral injection can be administered includes, but is not limited to, solid tumors or hematologic malignancies. In this article, solid tumors include, for example, squamous cell carcinoma, adenocarcinoma, basal cell carcinoma, renal cell carcinoma, mammary duct carcinoma, soft tissue sarcoma, osteosarcoma, melanoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, pancreatic cancer, neuroendocrine cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, brain cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial cancer or uterine cancer, esophageal cancer, salivary gland cancer, kidney cancer, liver cancer, prostate cancer, vulvar cancer, thyroid cancer, head and neck cancer, etc., or any combination thereof. Hematological malignancies include, for example, leukemias, lymphomas, myelomas, acute myeloid leukemia, chronic myeloid leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, or multiple myeloma. Cancer can also be a metastatic cancer. "Metastasis" refers to the spread of cancer cells from their original site to other parts of the body.

[0236] The methods provided herein relate to administering lipid compositions containing one or more therapeutic or prophylactic agents and pharmaceutical compositions and intratumoral injections comprising these compositions. For features and embodiments of the present invention, the terms therapeutic agent and prophylactic agent can be used interchangeably herein. Lipid compositions, pharmaceutical compositions, and intratumoral injections can be administered to a subject in any reasonable amount that is effective for preventing, treating, diagnosing, or treating cancer for any other purpose. The specific amount administered to a given subject can vary depending on the species, age, and general condition of the subject; the purpose of administration; the specific composition, etc.

[0237] The lipid composition or pharmaceutical composition provided by the present invention is used for tumor administration; the tumor administration preferably includes intratumoral administration, subcutaneous administration around the tumor, or administration into the artery that supplies blood to the tumor, and intratumoral injection is most preferred.

[0238] In some embodiments, lipid compositions and pharmaceutical compositions comprising therapeutic or prophylactic agents of the present invention can be administered to a subject by intratumoral injection. Beneficial effects

[0239] The lipid composition, pharmaceutical composition or intratumoral injection provided by the present invention can exhibit excellent effects, such as but not limited to: (1) improving the expression efficiency of the contained mRNA in the tumor; (2) reducing the expression of mRNA in the liver and reducing liver toxicity; (3) reducing the expression of mRNA outside the tumor and reducing systemic toxicity; (4) improving the tumor treatment effect.

[0240] Furthermore, the lipid composition, pharmaceutical composition or intratumoral injection containing IL-12 nucleic acid provided by the present invention can exhibit excellent effects, such as but not limited to: (1) high expression in vivo and long half-life of the expressed IL-12; (2) dose-dependent expression in vitro; (3) induction of cellular immune response and effective activation of CD8 + T cells; (4) Good tumor suppression effect, can significantly reduce tumor volume.

[0241] Example

[0242] The present invention is further described with reference to the following examples. It should be understood that these examples are intended to be illustrative only and are not intended to limit the present invention. The following materials and instruments are commercially available or prepared according to methods known in the art. The following experiments were performed according to the manufacturer's instructions or according to methods and procedures known in the art.

[0243] Experimental Materials

[0244] The compound described in cationic lipid formula (I) is synthesized by Si microorganisms or can be prepared according to CN110520409A; phospholipid (DOPE) is purchased from CordenPharma; cholesterol is purchased from Sigma-Aldrich; mPEG2000-DMG (i.e., DMG-PEG 2000) is purchased from Avanti Polar Lipids, Inc.; PBS is purchased from Invitrogen; and protamine sulfate is purchased from Beijing Silian Pharmaceutical Co., Ltd.

[0245] Example 1 Synthesis of the compound according to formula (I)

[0246] General considerations

[0247] Unless otherwise noted, all solvents and reagents used were commercially available and used as received. 1 H NMR spectra were recorded in CDCl3 at 300 K using a Bruker Ultrashield 300 MHz instrument. Chemical shifts are relative to 1 H is reported as parts per million (ppm) relative to TMS (0.00). Silica gel chromatography was performed on an ISCO CombiFlash Rf+Lumen instrument using ISCO RediSep Rf Gold flash columns (particle size: 20-40 microns).

[0248] The procedure described below can be used to synthesize compounds SW-II-115 to SW-II-140-2.

[0249] The following abbreviations are used herein: THF: tetrahydrofuran MeCN: acetonitrile LAH: lithium aluminum hydride DCM: dichloromethane DMAP: 4-dimethylaminopyridine LDA: lithium diisopropylamide rt: room temperature DME: 1,2-dimethoxyethane n-BuLi: n-butyllithium CPME: cyclopentyl methyl ether EDCI: N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide DIEA: N,N-diisopropylethylamine PE: petroleum ether EA: ethyl acetate

[0250] A. Compound SW-II-115

[0251] 1. Synthesis of Intermediate 3

[0252] To a DCM solution (100 mL) containing compound 1 (10 g, 45 mmol, 1 eq.) and compound 2 (7.8 g, 54 mmol, 1.2 eq.) was added EDCI (17.3 g, 90 mmol, 2 eq.) and DMAP (2.2 g, 18 mmol, 0.4 eq.), followed by DIEA (23.2 g, 180 mmol, 4 eq.). The reaction mixture was stirred at room temperature under N protection for 16 hours. TLC (petroleum ether: ethyl acetate = 30: 1) showed that compound 1 was consumed and the desired product was formed. The reaction mixture was diluted with DCM (20 mL) and washed with H2O (40 mL), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with petroleum ether: ethyl acetate (1: 0-20: 1) to give compound 3 (4.365 g, 28%) as a colorless oil.

[0253] 2. Synthesis of Intermediate 5

[0254] A solution of compound 3 (500 mg, 1.437 mmol, 1 eq.) and compound 4 (2.63 g, 43.103 mmol, 30 eq.) in EtOH was stirred at 60 ° C for 16 hours under N protection. TLC (DCM: MeOH = 10: 1) showed that compound 3 was consumed, and TLC (DCM / MeOH = 10 / 1) showed that a new main point was observed. The reaction mixture was concentrated under reduced pressure. The residue was diluted with EtOAc (50 mL) and washed with H2O (3 × 50 mL). The organic layer was dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (1: 0-10: 1, v / v) to give compound 5 (264 mg, 56%) as a yellow oil.

[0255] 3. Synthesis of Intermediate 8

[0256] To compound 6 (500 mg, 1.712 mmol, 1 eq.) and compound 7 (1.113 g, 8.562 mmol, 5 eq.) in a dioxane / water (5 mL / 0.5 mL) solvent mixture were added Pd(dppf)Cl2 (112 mg, 0.171 mmol, 0.1 eq.) and potassium carbonate (709 mg, 5.136 mmol, 3 eq.). The mixture was stirred at 100°C overnight under N2. TLC (PE:EA = 15:1) indicated the reaction was complete and a new major spot was observed. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE:EA (1:0-10:1) to give compound 8 (455 mg, 88%) as a colorless oil.

[0257] 4. Synthesis of Intermediate 9

[0258] To a solution of compound 8 (455 mg, 1.497 mmol, 1 eq.) in THF (5 mL) was added LiAlH₄ (1.5 mL, 1.497 mmol, 1 M in THF, 1 eq.) at 0°C under N₂ protection. The mixture was stirred at room temperature under N₂ for 2 hours. TLC (PE:EtOAc=5:1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with water (1.5 mL) and treated with 2N HCl to adjust the pH between 6 and 7, extracted with EA, and washed with brine. The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated in vacuo to afford crude compound 9 (419 mg, >100%) as a colorless oil without further purification.

[0259] 5. Synthesis of Intermediate 10

[0260] To a solution of compound 1 (339 mg, 1.518 mmol, 1 eq.) and compound 9 (419 mg, 1.518 mmol, 1 eq.) in DCM (4 mL) were added EDCI (583 mg, 3.036 mmol, 2 eq.) and DMAP (74 mg, 0.607 mmol, 0.4 eq.), followed by DIEA (783 mg, 6.072 mmol, 4 eq.). The reaction mixture was stirred at room temperature under N protection for 16 hours. TLC (petroleum ether:ethyl acetate = 10:1) showed the formation of the desired product. The reaction mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous NaSO, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with petroleum ether:ethyl acetate (1:0-10:1) to obtain compound 10 (443 mg, 60.7%) as a colorless oil.

[0261] 6. Synthesis of the final product SW-II-115

[0262] To a mixed solvent of CPME / CH3CN (3 mL / 3 mL) containing compound 10 (307 mg, 0.64 mmol, 1 eq.) and compound 5 (210 mg, 0.64 mmol, 1 eq.) were added K2CO3 (530 mg, 3.84 mmol, 6 eq.) and KI (212 mg, 1.28 mmol, 2 eq.). After the addition was complete, the mixture was stirred at 90°C overnight under N2. TLC (DCM:MeOH = 10:1) indicated the reaction was complete, with a new major spot observed. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with DCM:MeOH (1:0-10:1, v / v) to afford compound SW-II-115 (266 mg, 57%) as a yellow oil.

[0263] LCMS:Rt:1.293min; MS m / z(ELSD):730.5[M+H] + ;

[0264] HPLC: 99.472% purity, ELSD; RT = 4.895 min.

[0265] 1H NMR (400MHz, CDCl3) δ7.21–6.99(m,3H),5.05(s,2H),4.05(t,J=6.8Hz,2H),3.58(t,J=5.3Hz,2H), 2.69–2.46(m,10H),2.31(dt,J=20.0,7.5Hz,4H),1.69–1.18(m,51H),0.89(dt,J=12.4,6.3Hz,9H).

[0266] 13 C NMR (101MHz, CDCl3) δ173.90 (s), 173.68 (s), 140.80 (d, J = 13.0Hz), 133.31 (s), 129.25 (d, J = 16.2Hz) ,128.30(s),125.75(s),77.30(d,J=11.5Hz),77.04(s),76.72(s),66.22(s),64.43(s),58.12(s),55 .72(s),53.90(s),34.32(d,J=1.9Hz),32.69(s),32.48(s),31.81(d,J=11.2Hz),31.25(s),29.59–28 .91(m),28.66(s),27.17(s),26.64(s),25.94(s),24.91(d,J=5.1Hz),22.65(d,J=3.3Hz),14.10(s).

[0267] B . Compound SW-II-118

[0268] 1. Synthesis of Intermediate 3

[0269] A solution of compound 1 (1.22 g, 5.0 mmol, 1.0 eq.) and compound 2 (765 mg, 7.5 mmol, 1.5 eq.), Pd(PPh3)4 (tetrakistriphenylphosphine palladium, 289 mg, 0.25 mmol, 0.05 eq.), and K2CO3 (1.38 g, 10.0 mmol, 2.0 eq.) in toluene (10 ml) and H2O (1 ml) was stirred at 110°C under N2 protection for 1 hour. TLC (petroleum ether:ethyl acetate = 19:1) showed that compound 1 was consumed and a new spot was observed. The reaction mixture was diluted with DCM (50 mL) and washed with H2O (40 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether:ethyl acetate (1:0-10:1) to give compound 3 (0.5 g, 45%) as a colorless oil.

[0270] 1 H NMR (400MHz, CDCl3) δ7.16 (dd, J=23.5, 8.1Hz, 4H), 4.14 (q, J=7.1Hz, 2H), 3.57 (s, 2H), 2.64–2.48 (m ,2H),1.66–1.51(m,2H),1.35(dd,J=15.0,7.4Hz,2H),1.25(t,J=7.1Hz,3H),0.92(t,J=7.3Hz,3H).

[0271] 2. Synthesis of Intermediate 4

[0272] LiAlH4 (193 mg, 5.09 mmol, 4.0 eq.) was added to a THF (10 mL) solution containing compound 3 (280 mg, 1.27 mmol, 1.0 eq.) at -78°C, and the reaction was allowed to react at 10°C for 3 hours. TLC showed that the reaction was well, and the reaction was concentrated and diluted with Na2SO4 (20 mL) and extracted with EA (30 mL×2). The organic phase was dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to give compound 4 (3.12 g, crude product) as a yellow oil.

[0273] 3. Synthesis of Intermediate 6

[0274] A solution of compound 4 (215 mg, 1.2 mmol, 1.0 eq.), compound 5 (404 mg, 1.8 mmol, 1.5 eq.), EDCI (1.15 g, 6.0 mmol, 5.0 eq.), DMAP (732 mg, 1.8 eq.), DIEA (1.29 g, 12.0 mmol, 10.0 eq.), and DIEA (1.29 g, 12.0 mmol, 10.0 eq.) in DCM (5 mL) was stirred at 10°C for 16 h under N₂ protection. TLC (DCM:MeOH = 10:1) indicated the reaction was complete and a new major spot was observed. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography eluting with PE:EA (1:0-10:1, v / v) to afford compound 6 (145 mg, 31%) as a colorless oil.

[0275] 1H NMR (400MHz, CDCl3) δ7.12(s,4H),4.27(t,J=7.1Hz,2H),3.52(t,J=6.7Hz,1H),3.40(t,J=6.8Hz,1H),2.90(t,J=7.1Hz,2H ),2.65–2.50(m,2H),2.28(t,J=7.5Hz,2H),1.93–1.70(m,2H),1.64–1.56(m,4H),1.44–1.27(m,8H),0.92(t,J=7.3Hz,3H).

[0276] 4. Synthesis of the final product SW-II-118

[0277] A mixture containing compound 6 (140 mg, 0.37 mmol, 1.0 eq.), compound 7 (243 mg, 0.55 mmol, 1.5 eq.), K2CO3 (153 mg, 1.11 mmol, 3.0 eq.) and KI (123 mg, 0.74 mmol, 2.0 eq.) was stirred in a mixed solvent of CPME (1 mL) and CH3CN (1 mL) under N2 at 90 ° C for 16 hours. The reaction mixture was concentrated under reduced pressure, and the residue was diluted with EtOAc (50 mL) and washed with NaHCO3 (30 mL). The organic layer was dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography and eluted with DCM:MeOH (1: 0-10: 1, v / v) to give SW-II-118 (105 mg, 61%) as a yellow oil.

[0278] LCMS:Rt:1.946min;MS m / z(ELSD):744.4[M+H] + ;

[0279] HPLC: 99.64% purity, ELSD; RT = 5.875 min.

[0280] 1 H NMR (400MHz, CDCl3) δ7.11(s,4H),4.91–4.79(m,1H),4.26(t,J=7.2Hz,2H),3.80–3.68(m,2H),2.90(t,J=7.1Hz,4H),2.8 1–2.67(m,4H),2.62–2.52(m,2H),2.28(td,J=7.5,2.6Hz,4H),1.64–1.51(m,11H),1.38–1.17(m,42H),0.93–0.82(m,9H).

[0281] 13 C NMR (101MHz, CDCl3) δ173.61 (d, J = 11.7Hz), 141.11 (s), 134.90 (s), 128.74 (s), 128.51 (s), 77.40 (s), 77.08(s),76.77(s),74.17(s),64.90(s),57.48(s),56.24(s),53.98(s),35.25(s),34.66(d,J=14.4 Hz),34.16(d,J=5.1Hz),33.67(s),31.86(s),29.52(d,J=2.4Hz),29.24(s),29.21–28.74(m),26.90( d,J=4.9Hz),25.42–24.92(m),24.92–24.88(m),24.74(s),22.67(s),22.37(s),14.04(d,J=15.7Hz).

[0282] C. Compound SW-II-120

[0283] 1. Synthesis of Intermediate 3

[0284] A solution containing compound 1 (1.22 g, 5.0 mmol, 1.0 eq.), compound 2 (1.30 mg, 10.0 mmol, 2.0 eq.), Pd(PPh3)4 (289 mg, 0.25 mmol, 0.05 eq.), and K2CO3 (1.38 g, 10.0 mmol, 2.0 eq.) in a mixture of toluene (10 ml) and H2O (1 ml) was stirred at 110°C under N2 protection for 1 hour. TLC (petroleum ether:ethyl acetate = 19:1) showed that compound 1 was consumed and a new spot was observed. The reaction mixture was diluted with DCM (50 mL) and washed with H2O (40 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether:ethyl acetate (1:0-10:1) to give compound 3 (0.78 g, 62%) as a colorless oil.

[0285] 1 H NMR (400MHz, CDCl3) δ7.19(d,J=8.1Hz,2H),7.13(d,J=8.1Hz,2H),4.14(q,J=7.1Hz,2H),3.5 7(s,2H),2.62–2.51(m,2H),1.58(d,J=11.1Hz,2H),1.35–1.21(m,9H),0.88(t,J=6.7Hz,3H).

[0286] 2. Synthesis of Intermediate 4

[0287] LiAlH4 (477 mg, 12.56 mmol, 4.0 eq.) was added to a solution of compound 3 (780 mg, 3.14 mmol, 1.0 eq.) in THF (10 mL) at -78°C, and the reaction was stirred at 10°C for 3 hours. Thin-layer chromatography indicated that the reaction proceeded well. The reaction was concentrated, diluted with Na2SO4 (20 mL), and extracted with EA (30 mL x 2). The organic phase was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to afford compound 4 (640 mg, crude) as a colorless oil.

[0288] 3. Synthesis of Intermediate 6

[0289] A solution of compound 4 (640 mg, 3.10 mmol, 1.0 eq.), compound 5 (1.06 g, 4.70 mmol, 1.5 eq.), EDCI (2.98 g, 15.5 mmol, 5.0 eq.), DMAP (1.85 g, 15.0 eq.), and DIEA (4.0 g, 31.0 mmol, 10.0 eq.) in DCM (10 mL) was stirred at 10°C for 16 h under N₂ protection. TLC (DCM:MeOH = 10:1) indicated the reaction was complete and a new major spot was observed. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography eluting with PE:EA (1:0-10:1, v / v) to afford compound 6 (465 mg, 36%) as a colorless oil.

[0290] 4. Synthesis of the final product SW-II-120

[0291] A mixture containing compound 6 (100 mg, 0.25 mmol, 1.0 eq.), compound 7 (161 mg, 0.36 mmol, 1.5 eq.), K2CO3 (104 mg, 0.75 mmol, 3.0 eq.) and KI (83 mg, 0.50 mmol, 2.0 eq.) was stirred at 90 ° C for 16 hours in CPME (1 mL) and CH3CN (1 mL) under N2. The reaction mixture was concentrated under reduced pressure, and the residue was diluted with EtOAc (50 mL) and washed with NaHCO3 (30 mL). The organic layer was dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (1: 0-10: 1, v / v) to give SW-II-120 (100 mg, 52%) as a yellow oil.

[0292] LCMS:Rt:2.500min;MS m / z(ELSD):772.4[M+H] + ;

[0293] HPLC: 99.70% purity, ELSD; RT = 8.675 min.

[0294] 1 H NMR(400MHz, CDCl3)δ7.07(d,J=8.9Hz,4H),4.89–4.73(m,1H),4.23(t,J=7.2Hz,2H),3.83–3.65(m,2H),2.87(t,J=7.2Hz,4H),2.82–2 .67(m,4H),2.61–2.45(m,2H),2.25(td,J=7.5,2.5Hz,4H),1.65–1.44(m,15H),1.27(dd,J=13.2,11.3Hz,42H),0.85(t,J=6.8Hz,9H).

[0295] 13 C NMR (101MHz, CDCl3) δ173.57 (d, J = 11.5Hz), 141.13 (s), 134.88 (s), 128.73 (s), 128.48 (s), 77.45 (s), 77.13(s),76.81(s),74.14(s),64.89(s),57.34(s),56.17(s),53.92(s),35.57(s),34.64(d,J=16.1H z),34.14(d,J=3.3Hz),31.79(d,J=13.4Hz),31.49(s),29.50(d,J=2.2Hz),29.23(s),29.10–28.71(m ),26.85(d,J=5.0Hz),25.49–25.38(m),25.13(d,J=35.4Hz),24.72(s),22.63(d,J=5.8Hz),14.11(s).

[0296] D. Compound SW-II-121

[0297] 1. Synthesis of Intermediate 3

[0298] To a DCM (20 mL) solution containing compound 1 (1.3 g, 5.86 mmol, 1.5 eq.) and compound 2 (1 g, 3.9 mmol, 1.0 eq.) was added EDCI (1.495 g, 7.8 mmol, 2.0 eq.), DMAP (0.19 g, 1.56 mmol, 0.4 eq.), and DIEA (2.57 mL, 15.6 mmol, 4.0 eq.). The reaction mixture was stirred at room temperature under N2 for 16 hours. TLC (petroleum ether: ethyl acetate = 19:1) showed that compound 2 was consumed and the desired product was formed. The reaction mixture was diluted with DCM (20 mL) and washed with H2O (40 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether: ethyl acetate (1:0-10:1) to give compound 3 (1.2 g, 66.9%) as a yellow oil.

[0299] 1 H NMR (400MHz, CDCl3) δ4.92–4.82(m,1H),3.42(t,J=6.8Hz,2H),2.31(t,J=7.5Hz,2H),1.95–1.82(m,2H),1.70–1.19(m,36H),0.90(t,J=6.8Hz,6H).

[0300] 2. Synthesis of Intermediate 5 成

[0301] A solution of EtOH (5 mL) containing compound 3 (5.2 g, 11.30 mmol, 1.0 eq.) and compound 4 (20.6 g, 339 mmol, 30 eq.) was stirred at 60 ° C for 16 hours under N protection. TLC (petroleum ether: ethyl acetate = 19: 1) showed that compound 3 was consumed and TLC (DCM / MeOH = 10 / 1) showed that a new main point was observed. The reaction mixture was concentrated under reduced pressure, and the residue was diluted with EtOAc (50 mL) and washed with H2O (3 × 50 mL). The organic layer was dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM: MeOH (1: 0-10: 1, v / v) to give compound 5 (3 g, 60%) as a yellow oil.

[0302] 3. Synthesis of Intermediate 8

[0303] To a mixed solution of compound 6 (1 g, 4.115 mmol, 1 eq.) and compound 7 (889 mg, 6.173 mmol, 1.5 eq.) in toluene / water (10 mL / 1 mL) were added Pd(pph) (238 mg, 0.206 mmol, 0.05 eq.) and KCO (1.7 g, 12.35 mmol, 3 eq.). The mixture was stirred at 110°C under N2 for 2 hours. TLC (PE:EA = 10:1) indicated the reaction was complete, with a new major spot observed. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous NaSO, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE:EA (1:0-10:1) to afford compound 8 (714 mg, 66%) as a colorless oil.

[0304] 4. Synthesis of Intermediate 9

[0305] Under N protection, LiAlH (2.7 mL, 2.725 mmol, 1 M in THF, 1 eq.) was added to a mixture of compound 8 (714 mg, 2.725 mmol, 1 eq.) in THF (7 mL) at 0°C, and the mixture was stirred at room temperature for 2 hours. TLC (PE:EtOAc=10:1) showed that the reaction was complete and a new major spot was observed. The mixture was quenched with water (2.7 mL) and treated with 2N HCl to adjust the pH between 6 and 7, extracted with EA and washed with brine. The organic layer was dried over anhydrous NaSO, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluting with PE:EA (1:0-10:1) to give compound 9 (103 mg, 63%) as a colorless oil.

[0306] 5. Synthesis of Intermediate 11

[0307] To DCM (3 mL) containing compound 9 (300 mg, 1.364 mmol, 1 eq.) and compound 10 (363 mg, 1.64 mmol, 1.2 eq.) was added EDCI (524 mg, 2.728 mmol, 2 eq.), DMAP (67 mg, 0.546 mmol, 0.4 eq.), and DIEA (704 mg, 5.456 mmol, 4 eq.). The reaction mixture was stirred at room temperature under N2 for 16 hours. TLC (petroleum ether: ethyl acetate = 10:1) showed the formation of the desired product. The reaction mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with petroleum ether: ethyl acetate (1:0-10:1) to give compound 11 (169 mg, 29%) as a colorless oil.

[0308] 6. Synthesis of the final product SW-II-121

[0309] To a CPME / CH3CN (2 mL / 2 mL) mixed solvent containing compound 11 (169 mg, 0.399 mmol, 1 eq.) and compound 5 (176 mg, 0.399 mmol, 1 eq.) was added K2CO3 (330 mg, 2.394 mmol, 6 eq.) and KI (132 mg, 0.798 mmol, 2 eq.). After the addition was complete, the mixture was stirred at 90°C overnight under N2. TLC (DCM:MeOH = 10:1) indicated the reaction was complete and a new major spot was observed. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with DCM:MeOH (1:0-10:1, v / v) to afford compound SW-II-121 (145 mg, 46%) as a yellow oil.

[0310] LCMS:Rt:1.493min; MS m / z(ELSD):786.5[M+H] + ;

[0311] HPLC: 99.869% purity, ELSD; RT = 10.655 min.

[0312] 1 H NMR (400MHz, CDCl3) δ7.11 (s, 4H), 4.92–4.80 (m, 1H), 4.26 (t, J = 7.2Hz, 2H), 3.80 (s, 2H), 2.87 (dd, J = 26.6, 19.4Hz, 7H),2.62–2.51(m,2H),2.28(td,J=7.2,3.6Hz,4H),1.75–1.45(m,14H),1.42–1.09(m,45H),0.88(t,J=6.8Hz,9H).

[0313] 13C NMR (101MHz, CDCl3) δ173.61 (d, J = 12.3Hz), 141.20 (s), 134.90 (s), 128.75 (s), 128.51 (s),77.35(s),77.03(s),76.72(s),74.21(s),64.93(s),54.15(s),35.59(s),34.66( d,J=16.6Hz),34.16(d,J=3.0Hz),31.85(d,J=4.4Hz),31.55(s),29.64–29.15(m),29. 15–28.78(m),26.85(d,J=4.5Hz),25.33(s),24.95(s),24.72(s),22.68(s),14.12(s).

[0314] E. Compound SW-II-122

[0315] 1. Synthesis of compound 3

[0316] Compound 1 (1 g, 4.65 mmol, 1 eq.) and compound 2 (726 mg, 5.58 mmol, 1.2 eq.) were dissolved in toluene / water (10 / 1, 20 mL), and KCO (1.92 g, 13.9 mmol, 3 eq.) and Pd(pph) (269 mg, 0.23 mmol, 0.05 eq.) were added to the mixture. The reaction mixture was heated to 110°C under N2 and stirred for 2 hours. TLC (petroleum ether / ethyl acetate = 19 / 1) showed that compound 1 was consumed and a new major spot was observed. The reaction mixture was quenched with H2O (80 mL) and extracted with ethyl acetate (60 mL x 3). The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-10 / 1) to give compound 3 (800 mg, 78%) as a yellow oil.

[0317] 2. Synthesis of compound 4

[0318] Under nitrogen protection at 0°C, LiAlH4 (3.2 mL, 3.18 mmol, 1 eq.) was added to compound 3 (700 mg, 3.18 mmol, 1.0 eq.) dissolved in THF (14 mL). The reaction was allowed to warm to room temperature and stirred for 2 hours under nitrogen protection. TLC (PE / EtOAc = 10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was quenched with water (3.2 mL) and 1M HCl (3.2 mL), respectively. Water (6 mL) was added to the mixture and extracted with ethyl acetate (60 mL × 3). The organic layer was washed with brine (30 mL × 2), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with ethyl acetate / petroleum ether = 1 / 10 to give compound 4 (600 mg, 98%) as a yellow oil.

[0319] 3. Synthesis of Compound 6

[0320] Compound 4 (680 mg, 3.5 mmol, 1.0 eq.) and compound 5 (1.13 g, 5.1 mmol, 1.5 eq.) were dissolved in DCM (10 mL), and EDCI (1.20 g, 6.25 mmol, 2.0 eq.), DMAP (166 mg, 1.36 mmol, 0.4 eq.), and DIEA (1.78 g, 13.8 mmol, 4.0 eq.) were added to the mixture. After the addition, the reaction mixture was stirred at room temperature overnight under nitrogen. TLC (DCM / MeOH = 30 / 1) showed that the starting material was consumed and a new spot had formed. The mixture was quenched with water (70 mL) and extracted with DCM (80 mL x 3). The combined organic layers were washed with brine (2 x 20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with ethyl acetate / petroleum ether = 3 / 97 solution to give compound 6 (680 mg, 48.5%) as a yellow oil.

[0321] 4. Synthesis of SW-II-122

[0322] Compound 6 (108 mg, 0.27 mmol, 1.2 eq) and compound 7 (100 mg, 0.23 mmol, 1 eq.) were dissolved in CPME (2 mL) and CHCN (2 mL). Potassium carbonate (157 mg, 1.14 mmol, 5.0 eq) and potassium iodide (75 mg, 0.45 mmol, 2.0 eq) were added to the mixture. After the addition, the reaction mixture was stirred at 90°C under nitrogen for 16 hours. TLC (DCM / MeOH = 10 / 1) indicated the reaction was complete. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with DCM / MeOH (1 / 0-10:1, v / v) to obtain SW-II-122 (68 mg, 40%) as a colorless oil.

[0323] LCMS:Rt:1.487min;MS m / z(ELSD):758.5[M+H] + ;

[0324] HPLC: 97.3% purity, ELSD; RT = 7.622 min.

[0325] 1 H NMR (400MHz, CDCl3) δ7.32(d,J=26.4Hz,1H),7.17(dd,J=27.2,21.1Hz,3H),5.09(s,2H),4.91–4.79(m,1H),3.85(s,2H),2.98(s,2H),2.87(s,4H) ,2.65–2.54(m,2H),2.35(t,J=7.6Hz,2H),2.28(t,J=7.6Hz,2H),1.74–1 .57(m,9H),1.50(d,J=5.6Hz,4H),1.37–1.15(m,43H),0.94–0.80(m,9H).

[0326] 13C NMR (101MHz, CDCl3) δ173.55 (d, J = 2.4Hz), 143.35 (s), 135.92 (s), 128.67–128.19 (m), 125.47 (s), 77. 36(s),77.04(s),76.73(s),74.22(s),66.27(s),57.15(s),56.74(s),54.14(s),35.88(s),34.55(s) ,34.15(d,J=3.6Hz),31.79(d,J=15.2Hz),31.43(s),29.52(d,J=2.8Hz),29.25(s),28.92(dd,J=14.2 ,5.8Hz),26.77(d,J=4.8Hz),25.33(s),24.92(s),24.71(s),24.48(s),22.64(d,J=6.8Hz),14.12(s).

[0327] F. Compound SW-II-127

[0328] 1. Synthesis of compound 3

[0329] Compound 1 (1.3 g, 5.86 mmol, 1.5 eq.) and compound 2 (1 g, 3.9 mmol, 1.0 eq.) were dissolved in DCM (20 mL). EDCI (1.495 g, 7.8 mmol, 2.0 eq.) and DMAP (0.19 g, 1.56 mmol, 0.4 eq.) were added to the mixture, followed by DIEA (2.57 mL, 15.6 mmol, 4.0 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 19 / 1) showed that compound 2 was consumed and the desired product was formed. The reaction mixture was diluted with DCM (20 mL) and washed with H2O (40 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-10 / 1) to give compound 3 (1.2 g, 66.9%) as a yellow oil.

[0330] 1 H NMR (400MHz, CDCl3) δ4.92–4.82(m,1H),3.42(t,J=6.8Hz,2H),2.31(t,J=7.5Hz,2H),1.95–1.82(m,2H),1.70–1.19(m,36H),0.90(t,J=6.8Hz,6H).

[0331] 2. Synthesis of compound 5

[0332] Compound 3 (5.2 g, 11.30 mmol, 1.0 eq.) and compound 4 (20.6 g, 339 mmol, 30 eq.) were added to EtOH (5 mL), and the mixture was stirred at 60 ° C for 16 hours under nitrogen protection. TLC (petroleum ether / ethyl acetate = 19 / 1) showed that compound 3 was consumed and TLC (DCM / MeOH = 10 / 1) showed that a new major spot was observed. The reaction mixture was concentrated under reduced pressure. The residue was diluted with EtOAc (50 mL) and washed with H2O (3 × 50 mL). The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM / MeOH (1 / 0-10: 1, v / v) to obtain compound 5 (3 g, 60%) as a yellow oil.

[0333] 1 H NMR (400MHz, CDCl3) δ4.95–4.75(m,1H),3.74–3.58(m,2H),2.87–2.74(m,2H),2.69–2.56(m,2H), 2.36(s,2H),2.28(t,J=7.5Hz,2H),1.65–1.42(m,8H),1.38–1.17(m,30H),0.88(t,J=6.8Hz,6H).

[0334] 3. Synthesis of Compound 8

[0335] Compound 7 (522 mg, 2.5 mmol, 1.2 eq.) and compound 6 (400 mg, 2.083 mmol, 1 eq.) were dissolved in DCM (4 mL). EDCI (800 mg, 4.166 mmol, 2 eq.), DMAP (102 mg, 0.833 mmol, 0.4 eq.), and DIEA (1.075 mg, 8.332 mmol, 4 eq.) were added to the mixture. After the addition, the reaction mixture was stirred at room temperature overnight under nitrogen. TLC (PE:EA = 10:1) showed that the starting material was consumed and a new spot had formed. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0-10 / 1), to afford compound 8 (454 mg, 57%) as a colorless oil.

[0336] 4. Synthesis of SW-II-127

[0337] Compound 8 (100 mg, 0.262 mmol, 1 eq.) and compound 5 (139 mg, 0.314 mmol, 1.2 eq.) were dissolved in CPME / CH3CN (1 mL / 1 mL). Potassium carbonate (217 mg, 1.572 mmol, 6 eq.) and potassium iodide (87 mg, 0.524 mmol, 2 eq.) were added to the mixture. After the addition, the reaction mixture was stirred at 90°C overnight under nitrogen. TLC (DCM / MeOH = 10 / 1) showed that the reaction was complete and the desired product had formed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with DCM / MeOH (1 / 0-10:1, v / v) to obtain compound SW-II-127 (42.49 mg, 22%) as a yellow oil.

[0338] LCMS:Rt:1.323min; MS m / z(ELSD):744.5[M+H] + ;

[0339] HPLC: 99.742% purity, ELSD; RT = 7.339 min.

[0340] 1 H NMR(400MHz, CDCl3)δ7.25(s,2H),7.17(d,J=8.0Hz,2H),5.07(s,2H),4.91–4.82(m,1H),3.83(s,2H),2.90(d,J=44.8Hz,5H), 2.64–2.55(m,2H),2.35(t,J=7.4Hz,2H),2.28(t,J=7.5Hz,2H),1.76–1.46(m,14H),1.42–1.19(m,41H),0.88(t,J=6.8Hz,9H).

[0341] 13C NMR (101MHz, CDCl3) δ173.50 (d, J = 8.5Hz), 133.17 (s), 128.61 (s), 128.34 (s), 77.29 (d, J = 11 .4Hz),77.03(s),76.71(s),74.23(s),66.19(s),54.20(s),35.71(s),34.56(s),34.10(d,J= 8.8Hz),31.80(d,J=15.4Hz),31.43(s),29.53(d,J=2.5Hz),29.25(s),28.95(d,J=10.5Hz),2 8.63(s),26.71(d,J=18.2Hz),25.33(s),24.93(s),24.62(s),22.65(d,J=6.6Hz),14.13(s).

[0342] G. Combination 物 SW-II-134-1

[0343] 1. Synthesis of compound 3

[0344] To a mixture of compound 1 (500 mg, 2.283 mmol, 1 eq.) and compound 2 (890 mg, 6.849 mmol, 3 eq.) in toluene / water (5 mL / 1 mL) were added palladium acetate (51 mg, 0.228 mmol, 0.1 eq.), Ruphos (213 mg, 0.457 mmol, 0.2 eq.), and potassium carbonate (945 mg, 6.849 mmol, 3 eq.). The mixture was stirred at 110°C overnight under nitrogen. TLC (PE / EA = 20 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-20 / 1) to give compound 3 (723 mg, 99.6%) as a colorless oil.

[0345] 2. Synthesis of compound 4

[0346] To a mixture of compound 3 (723 mg, 2.27 mmol, 1 eq.) in THF (8 mL) was added lithium aluminum hydride (2.3 mL, 2.27 mmol, 1 M in THF, 1 eq.) at 0°C under nitrogen. The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated that the reaction was complete and a new major spot was observed. The mixture was quenched with water (2.3 mL) and treated with 2N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to give compound 4 (381 mg, 58%) as a colorless oil without further purification.

[0347] 3. Synthesis of Compound 6

[0348] To a mixture of compound 4 (381 mg, 1.3 mmol, 1 eq.) and compound 5 (352 mg, 1.6 mmol, 1.2 eq.) in DCM (4 mL) was added EDCI (499 mg, 2.6 mmol, 2 eq.) and DMAP (63 mg, 0.52 mmol, 0.4 eq.), followed by DIEA (671 mg, 5.2 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 20 / 1) showed that the desired product had formed. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography, eluted with petroleum ether / ethyl acetate (1 / 0-20 / 1) to give compound 6 (272 mg, 44%) as a colorless oil.

[0349] 4. Synthesis of SW-II-134-1

[0350] To a mixture of compound 6 (150 mg, 0.303 mmol, 1 eq.) and compound 7 (110 mg, 0.333 mmol, 1.1 eq.) in CPME / CH3CN (2 mL / 2 mL) were added potassium carbonate (251 mg, 1.818 mmol, 6 eq.) and potassium iodide (101 mg, 0.61 mmol, 2 eq.). After addition, the mixture was stirred at 90 ° C under nitrogen overnight. TLC (DCM / MeOH=15 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography and eluted with DCM / MeOH (1 / 0-10:1, v / v) to give SW-II-134-1 (168 mg, 75%) as a yellow oil.

[0351] LCMS:Rt:1.276min;MS m / z(ELSD):744.4[M+H] + ;

[0352] HPLC: 98.481% purity, ELSD; RT = 10.724 min.

[0353] 1 H NMR(400MHz, CDCl3) δ7.06(d,J=7.6Hz,1H),7.01–6.93(m,2H),4.25(t,J=7.3Hz,2H),4.05(t,J=6.8Hz,2H),3.85–3.72(m,2H),2 .98–2.69(m,8H),2.62–2.48(m,4H),2.29(t,J=7.5Hz,4H),1.72–1.48(m,14H),1.45–1.17(m,36H),0.89(dt,J=11.9,6.0Hz,9H).

[0354] 13 CNMR (101MHz, CDCl3) δ173.78 (d, J = 16.7Hz), 140.72 (s), 138.81 (s), 134.91 (s), 129.70 (s), 129.22 (s), 126.19 (s),77.30(d,J=11.4Hz),77.03(s),76.72(s),65.02(s),64.49(s),57.42(s),56.36(s),54.08(s),34.76(s),3 4.22(d,J=4.2Hz),32.74(s),32.36(s),31.81(d,J=9.1Hz),31.35(d,J=5.3Hz),29.49(d,J=2.8Hz),29.24(d,J= 2.2Hz), 28.92(s), 28.66(s), 26.86(s), 25.93(s), 25.04(s), 24.78(d,J=6.6Hz), 22.65(d,J=2.6Hz), 14.10(s).

[0355] H. Compound SW-II-134-2

[0356] 1. Synthesis of compound 3

[0357] To a mixture of compound 1 (500 mg, 2.283 mmol, 1 eq.) and compound 2 (1.08 g, 6.849 mmol, 3 eq.) in toluene / water (5 mL / 1 mL) were added palladium acetate (51 mg, 0.228 mmol, 0.1 eq.), Ruphos (213 mg, 0.457 mmol, 0.2 eq.), and potassium carbonate (945 mg, 6.849 mmol, 3 eq.). The mixture was stirred at 110°C overnight under nitrogen. TLC (PE / EA = 20 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-20 / 1) to give compound 3 (854 mg, 100%) as a colorless oil.

[0358] 2. Synthesis of compound 4

[0359] To a mixture of compound 3 (854 mg, 2.28 mmol, 1 eq.) in THF (9 mL) at 0°C under nitrogen was added lithium aluminum hydride (2.3 mL, 2.28 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated completion of the reaction, with a new major spot observed. The mixture was quenched with water (2.3 mL) and treated with 2N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to afford compound 4 (724 mg, 92%) as a colorless oil without further purification.

[0360] 3. Synthesis of Compound 6

[0361] To a mixture of compound 4 (724 mg, 2.09 mmol, 1 eq.) and compound 5 (560 mg, 2.51 mmol, 1.2 eq.) in DCM (8 mL) were added EDCI (803 mg, 4.18 mmol, 2 eq.) and DMAP (102 mg, 0.84 mmol, 0.4 eq.), followed by DIEA (1.078 g, 8.36 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 20 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-20 / 1) to give compound 6 (473 mg, 41%) as a colorless oil.

[0362] 4. Synthesis of SW-II-134-2

[0363] To a mixture of compound 6 (150 mg, 0.27 mmol, 1 eq.) and compound 7 (108 mg, 0.33 mmol, 1.1 eq.) in CPME / CH3CN (2 mL / 2 mL) were added potassium carbonate (225 mg, 1.63 mmol, 6 eq.) and potassium iodide (90 mg, 0.54 mmol, 2 eq.). After addition, the mixture was stirred at 90 ° C under nitrogen overnight. TLC (DCM / MeOH=15 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with DCM / MeOH (1 / 0-10:1, v / v) to give a yellow oily compound SW-II-134-2 (71.77 mg, 33%).

[0364] LCMS:Rt:1.527min;MS m / z(ELSD):800.4[M+H] + ;

[0365] HPLC: 97.311% purity, ELSD; RT = 9.025 min.

[0366] 1 H NMR (400MHz, CDCl3) δ7.06(d,J=7.6Hz,1H),6.96(d,J=9.6Hz,2H),4.25(t,J=7.3Hz,2H),4.05(t,J=6.8Hz,2H),3.80–3.66(m,2H),2.86(dd,J=12.8,5 .6Hz,4H),2.78–2.67(m,4H),2.60–2.52(m,4H),2.29(t,J=7.5Hz,4H),1.5 7(dt,J=15.8,7.3Hz,14H),1.30(d,J=20.3Hz,45H),0.88(t,J=6.7Hz,9H).

[0367] 13C NMR(101MHz, CDCl3)δ173.82(d,J=16.9Hz),140.73(s),138.82(s),134.91(s),129.71(s),129.23(s),126.19( s),77.36(s),77.14(d,J=20.4Hz),76.72(s),65.03(s),64.49(s),57.57(s),56.13(s),54.02(s),34.76(s),3 4.25(d,J=4.2Hz),32.76(s),32.37(s),31.89(d,J=5.3Hz),31.40(d,J=6.0Hz),29.84(d,J=3.7Hz),29.63–29. 14(m),28.97(s),28.65(s),26.93(s),25.66(d,J=54.4Hz),24.80(d,J=6.6Hz),22.68(d,J=1.8Hz),14.12(s).

[0368] I. Compound SW-II-134-3

[0369] 1. Synthesis of compound 3

[0370] To a mixture of compound 1 (10 g, 45 mmol, 1 eq.) and compound 2 (7.8 g, 54 mmol, 1.2 eq.) in DCM (100 mL) were added EDCI (17.3 g, 90 mmol, 2 eq.) and DMAP (2.2 g, 18 mmol, 0.4 eq.), followed by DIEA (23.2 g, 180 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 30 / 1) showed that compound 1 was consumed and the desired product was formed. The reaction mixture was extracted with ethyl acetate (20 mL) and washed with water (40 mL × 3), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with petroleum ether / ethyl acetate (1 / 0-20 / 1) to give compound 3 (4.365 g, 28%) as a colorless oil.

[0371] 2. Synthesis of compound 5

[0372] A mixture of compound 3 (5 g, 14.38 mmol, 1 eq.) and compound 4 (8.8 g, 143.7 mmol, 10 eq.) in ethanol (2 mL) was stirred at 55 ° C under nitrogen for 16 hours. TLC (DCM / MeOH=10 / 1) showed that a new major spot was observed. The reaction mixture was extracted with ethyl acetate (50 mL) and washed with water (3×50 mL). The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with DCM / MeOH (1 / 0-10:1, v / v) to give compound 5 (1.008 g, 21%) as a yellow oil.

[0373] 3. Synthesis of Compound 8

[0374] To a mixture of compound 6 (500 mg, 2.283 mmol, 1 eq.) and compound 7 (699 mg, 6.849 mmol, 3 eq.) in toluene / water (5 mL / 1 mL) were added palladium acetate (51 mg, 0.228 mmol, 0.1 eq.), Ruphos (213 mg, 0.457 mmol, 0.2 eq.), and potassium carbonate (945 mg, 6.849 mmol, 3 eq.). The mixture was stirred at 110°C overnight under nitrogen. TLC (PE / EA = 20 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-20 / 1) to give compound 8 (507 mg, 85%) as a colorless oil.

[0375] 4. Synthesis of Compound 9

[0376] To a mixture of compound 8 (507 mg, 1.935 mmol, 1 eq.) in THF (5 mL) at 0°C under nitrogen was added lithium aluminum hydride (2 mL, 1.935 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated completion of the reaction and a new major spot was observed. The mixture was quenched with water (2 mL) and treated with 2N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to afford compound 9 (492 mg, >100%) as a colorless oil without further purification.

[0377] 5. Synthesis of Compound 10

[0378] To a mixture of compound 9 (492 mg, 2.103 mmol, 1 eq.) and compound 1 (563 mg, 2.523 mmol, 1.2 eq.) in DCM (5 mL) were added EDCI (808 mg, 4.206 mmol, 2 eq.) and DMAP (103 mg, 0.84 mmol, 0.4 eq.), followed by DIEA (1.085 g, 8.412 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-10 / 1) to give compound 10 (329 mg, 36%) as a colorless oil.

[0379] 6. Synthesis of SW-II-134-3

[0380] To a mixture of compound 10 (150 mg, 0.34 mmol, 1 eq.) and compound 5 (134 mg, 0.41 mmol, 1.2 eq.) in CPME / CH3CN (2 mL / 2 mL) were added potassium carbonate (282 mg, 2.04 mmol, 6 eq.) and potassium iodide (113 mg, 0.68 mmol, 2 eq.). After addition, the mixture was stirred at 90 ° C overnight under nitrogen. TLC (DCM / MeOH=10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with DCM / MeOH (1 / 0-10:1, v / v) to give compound SW-II-134-3 (63.59 mg, 25%) as a yellow oil.

[0381] LCMS:Rt:1.247min;MS m / z(ELSD):688.3[M+H] + ;

[0382] HPLC: 95.945% purity, ELSD; RT = 6.186 min.

[0383] 1H NMR (400MHz, CDCl3) δ7.07 (d, J = 7.6 Hz, 1H), 6.97 (dd, J = 9.9, 2.2 Hz, 2H), 4.26 (t, J = 7.2 Hz, 2H), 4.05 (t, J = 6.8 Hz, 2H), 2.88 (dd, J = 14. 8,7.6Hz,4H),2.78–2.74(m,2H),2.67–2.54(m,8H),2.29(t,J=7.5Hz,4H),1.68–1.47(m,15H),1.37–1.22(m,27H),0.98–0.86(m,9H).

[0384] 13 C NMR (101MHz, CDCl3) δ173.86 (d, J = 17.1Hz), 140.66 (s), 138.76 (s), 134.93 (s), 129.74 (s), 129.24 (s), 1 26.19(s),77.36(s),77.04(s),76.72(s),65.01(s),64.48(s),57.73(s),55.73(s),53.93(s),34.76(s) ,34.28(d,J=3.9Hz),33.54(d,J=4.5Hz),32.41(s),31.95(d,J=16.5Hz),29.49(s),29.15(dd,J=21.1,2. 4Hz), 28.66(s), 27.04(s), 25.95(d,J=3.3Hz), 24.85(d,J=6.6Hz), 22.98–22.58(m), 14.08(d,J=7.5Hz).

[0385] J.SW-II-135-1

[0386] 1. Synthesis of compound 3

[0387] Compound 1 (500 mg, 2.16 mmol, 1.0 eq.) and compound 2 (750 mg, 6.46 mmol, 3.0 eq.) were dissolved in toluene / H2O (5 mL / 1 mL), and Ruphos (201 mg, 0.43 mmol, 0.2 eq.), Pd(OAc)2 (48.5 mg, 0.22 mmol, 0.1 eq.) and Cs2CO3 (2.10 g, 6.46 mmol, 3.0 eq.) were added to the mixture. The reaction mixture was stirred at 110 °C under nitrogen protection. oC and heated to reflux for 16 hours. TLC (petroleum ether / ethyl acetate = 10 / 1) showed that the reaction was complete and the desired product was formed. The reaction mixture was washed with H2O (40mL) and extracted 3 times with EA (50mL). The resulting organic phase was washed twice with brine (20mL), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with petroleum ether / ethyl acetate (1 / 0-30 / 1) to obtain compound 3 (540mg, 82.44%) as a yellow oil.

[0388] 2. Synthesis of compound 4

[0389] To compound 3 (540 mg, 1.78 mmol, 1.0 eq.) dissolved in THF (5 mL) was added LiAlH4 (3.55 mL, 3.55 mmol, 2 eq. in 1 M THF) under nitrogen at 0°C. The reaction was allowed to warm to room temperature and stirred for 2 hours under nitrogen. TLC (PE / EtOAc = 10 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with water (10 mL), then adjusted to pH 6-7 with 1 M hydrochloric acid and extracted three times with ethyl acetate (50 mL). The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0-10 / 1) to give compound 4 (442 mg, 90.2%) as a colorless oil.

[0390] 3. Synthesis of Compound 6

[0391] Compound 4 (442 mg, 1.60 mmol, 1.0 eq.) and compound 5 (428.5 mg, 1.92 mmol, 1.2 eq.) were dissolved in DCM (5 mL), and EDCI (612 mg, 3.2 mmol, 2.0 eq.) and DMAP (78.2 mg, 0.64 mmol, 0.4 eq.) were added to the mixture, followed by DIEA (826 mg, 6.4 mmol, 4.0 eq.). The reaction mixture was stirred at room temperature for 16 hours under nitrogen protection. TLC (petroleum ether / ethyl acetate = 10 / 1) showed that compound 4 was consumed and the desired product was formed. The reaction mixture was washed with H2O (40 mL) and extracted 3 times with EA (50 mL). The resulting organic phase was washed twice with brine (20 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-10 / 1) to give compound 3 (342 mg, 44.5%) as a yellow oil.

[0392] 4. Synthesis of SW-II-135-1

[0393] Compound 6 (175 mg, 0.365 mmol, 1.2 eq.) and compound 7 (100 mg, 0.304 mmol, 1.0 eq.) were dissolved in CPME / CH3CN (1 mL / 1 mL). Potassium carbonate (210 mg, 1.52 mmol, 5.0 eq.) and potassium iodide (101 mg, 0.61 mmol, 2.0 eq.) were added to the mixture. After the addition, the reaction mixture was stirred at 90°C overnight under nitrogen. TLC (DCM / MeOH = 10 / 1) showed that the reaction was complete and the desired product had formed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with DCM / MeOH (1 / 0-10:1, v / v) to obtain compound SW-II-135-1 (83.89 mg, 55.6%) as a yellow oil.

[0394] LCMS:Rt:1.356min; MS m / z(ELSD):730.5[M+H] + ;

[0395] HPLC: 100% purity at ELSD; RT=12.614min.

[0396] 1 H NMR(400MHz, CDCl3)δ6.97(d,J=7.6Hz,1H),6.91–6.74(m,2H),4.76(s,1H),3 .99(dt,J=13.6,6.4Hz,4H),3.72–3.58(m,2H),2.85–2.73(m,2H),2.72–2.61( m,4H),2.59–2.41(m,6H),2.22(dd,J=13.2,7.2Hz,4H),1.93–1.79(m,2H),1. 62–1.41(m,14H),1.23(d,J=24.4Hz,32H),0.82(ddd,J=13.6,8.0,5.6Hz,9H).

[0397] 13C NMR (101MHz, CDCl3) δ172.81 (d, J = 6.4Hz), 139.55 (s), 137.38 (s), 137.14 (s), 128.16 (d, J = 2.4Hz), 124.69 ( s),76.51(s),76.19(s),75.88(s),63.43(s),62.78(s),56.53(s),54.90(s),52.84(s),33.23(d,J=2.4Hz) ,31.73(s),31.28(s),30.91(dd,J=20.0,6.4Hz),30.10(d,J=3.2Hz),29.29(s),28.36(d,J=22.8Hz),28.23 (s),27.97(s),27.64(s),25.92(s),24.92(s),24.34(s),23.84(s),21.62(d,J=7.6Hz),13.08(d,J=4.7Hz).

[0398] K. Compound SW-II-135-2

[0399] SW-II-135-2

[0400] 1. Synthesis of compound 3

[0401] Compound 1 (500 mg, 2.16 mmol, 1.0 eq.) and compound 2 (931 mg, 6.46 mmol, 3.0 eq.) were dissolved in toluene / H₂O (5 mL / 1 mL). To this mixture were added Ruphos (201 mg, 0.43 mmol, 0.2 eq.), Pd(OAc)₂ (48.5 mg, 0.22 mmol, 0.1 eq.), and Cs₂CO₃ (2.10 g, 6.46 mmol, 3.0 eq.). The reaction mixture was heated at reflux at 110°C under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 10 / 1) indicated the reaction was complete and the desired product had formed. The reaction mixture was washed with H₂O (40 mL) and extracted three times with EA (50 mL). The resulting organic phase was washed twice with brine (20 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-30 / 1) to give compound 3 (651 mg, 84%) as a yellow oil.

[0402] 2. Synthesis of compound 4

[0403] To compound 3 (651 mg, 1.81 mmol, 1.0 eq.) dissolved in THF (7 mL) was added LiAlH4 (3.62 mL, 3.62 mmol, 1 M in THF, 2 eq.) under nitrogen at 0°C. The reaction was allowed to warm to room temperature and stirred for 2 hours under nitrogen. TLC (PE / EtOAc = 10 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with water (10 mL), then adjusted to pH 6-7 with 1 M hydrochloric acid and extracted three times with ethyl acetate (50 mL). The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0-10 / 1) to give compound 4 (571 mg, 95.2%) as a colorless oil.

[0404] 3. Synthesis of Compound 6

[0405] Compound 4 (571 mg, 1.72 mmol, 1.0 eq.) and compound 5 (459 mg, 2.06 mmol, 1.2 eq.) were dissolved in DCM (6 mL), and EDCI (657 mg, 3.44 mmol, 2.0 eq.) and DMAP (84 mg, 0.68 mmol, 0.4 eq.) were added to the mixture, followed by DIEA (887.5 mg, 6.88 mmol, 4.0 eq.). The reaction mixture was stirred at room temperature for 16 hours under nitrogen protection. TLC (petroleum ether / ethyl acetate = 10 / 1) showed that compound 4 was consumed and the desired product was formed. The reaction mixture was washed with H2O (50 mL) and extracted 3 times with EA (60 mL). The resulting organic phase was washed twice with brine (25 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-10 / 1) to give compound 3 (245 mg, 26.5%) as a yellow oil.

[0406] 4. Synthesis of SW-II-135-2

[0407] Compound 6 (245 mg, 0.456 mmol, 1.5 eq.) and compound 7 (100 mg, 0.3 mmol, 1.0 eq.) were dissolved in CPME / CH3CN (1 mL / 1 mL). Potassium carbonate (210 mg, 1.52 mmol, 5.0 eq.) and potassium iodide (101 mg, 0.61 mmol, 2.0 eq.) were added to the mixture. After the addition, the reaction mixture was stirred at 90°C overnight under nitrogen. TLC (DCM / MeOH = 10 / 1) showed that the reaction was complete and the desired product had formed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with DCM / MeOH (1 / 0-10:1, v / v) to obtain compound SW-II-135-2 (31.41 mg, 21.9%) as a yellow oil.

[0408] LCMS:Rt:1.608min; MS m / z(ELSD):786.4[M+H] + ;

[0409] HPLC: 95.16% purity, ELSD; RT = 7.919 min.

[0410] 1 H NMR(400MHz, CDCl3)δ6.98(d,J=7.6Hz,1H),6.87(d,J=2.4Hz,2H),4.28–4.13(m,1H),4.04–3.95(m,4H),3.94–3.84(m,2H),3.14–2.89(m,6H) ,2.59–2.43(m,6H),2.23(dd,J=13.8,7.2Hz,4H),1.88–1.82(m,2H),1 .70(s,4H),1.57–1.46(m,10H),1.33–1.16(m,40H),0.90–0.72(m,9H).

[0411] 13C NMR(100MHz, CDCl3)δ172.82(d,J=6.8Hz),139.61(s),137.29(d,J=16.4Hz),128.15(s),124.67(s),7 6.41(s),76.09(s),75.77(s),63.50(s),62.87(s),55.49(s),54.92(s),52.98(s),33.16(d,J=2.4Hz ),31.77(s),31.33(s),30.80(d,J=6.5Hz),30.42(d,J=3.6Hz),29.29(s),28.99–28.66(m),28.47(s) ,28.23(d,J=2.8Hz),28.06–27.45(m),25.58(s),24.91(s),23.71(s),22.79(s),21.66(s),13.10(s).

[0412] L. Compound SW-II-136-2

[0413] 1. Synthesis of compound 3

[0414] Compound 1 (3 g, 13.70 mmol, 1.0 eq.) and compound 2 (5.34 g, 41.09 mmol, 3.0 eq.) were dissolved in toluene / H₂O (30 mL / 3 mL). To this mixture were added Ruphos (1.28 g, 2.74 mmol, 0.2 eq.), Pd(OAc)₂ (308.3 mg, 1.37 mmol, 0.1 eq.), and K₂CO₃ (5.67 g, 41.10 mmol, 3.0 eq.). The reaction mixture was heated at reflux at 110°C under nitrogen for 16 hours. TLC (PE / EA = 10 / 1) indicated the reaction was complete and the desired product had formed. The reaction mixture was washed with H₂O (90 mL) and extracted three times with EA (110 mL). The resulting organic phase was washed twice with brine (40 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-30 / 1) to give compound 3 (1.98 g, 45.5%) as a yellow oil.

[0415] 2. Synthesis of compound 4

[0416] To compound 3 (1.98 g, 6.23 mmol, 1.0 eq.) dissolved in THF (20 mL) was added LiAlH₄ (1 M, 12.45 mL, 2.0 eq.) under nitrogen at 0°C. The reaction was allowed to warm to room temperature and stirred under nitrogen for 2 hours. TLC (PE / EtOAc = 10 / 1) indicated completion of the reaction, with a new major spot observed. The mixture was quenched with H₂O (70 mL), then adjusted to pH 6-7 with 1 M hydrochloric acid and extracted three times with EA (80 mL). The organic layer was washed with brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE / EA (1 / 0-10 / 1) to afford compound 4 (1.28 g, 71.1%) as a colorless oil.

[0417] 3. Synthesis of Compound 7

[0418] To compound 4 (900 g, 3.1 mmol, 1.0 eq.) dissolved in DCM (9 mL) under nitrogen at 0°C were added DMSO (3.63 g, 51.72 mmol, 15 eq.), TEA (1.25 g, 12.4 mmol, 4.0 eq.), and PySO (1.27 g, 7.97 mmol, 2.57 eq.). The mixture was stirred at 0°C for 30 minutes, then warmed to room temperature and stirred under nitrogen for 90 minutes. Compound 6 (4.74 g, 13.62 mmol, 3.0 eq.) was then added to the mixture, and the reaction mixture was allowed to react at 25°C under nitrogen for 2 hours. TLC (PE / EA = 10 / 1) indicated the reaction was complete and the desired product had formed. The reaction mixture was washed with H2O (60 mL) and extracted three times with EA (70 mL). The resulting organic phase was washed twice with brine (40 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-10 / 1) to give compound 7 (345 mg, 27.9%) as a yellow oil.

[0419] 4. Synthesis of Compound 8

[0420] Compound 7 (340 mg, 0.95 mmol, 1.0 eq.) and Pd / C (100 mg) were added to MeOH (4 ml), and the reaction mixture was stirred at room temperature under a hydrogen atmosphere for 16 h. TLC (PE / EA = 10 / 1) showed complete consumption of the starting material and the formation of the desired product. The reaction mixture was filtered through Celite and washed with MeOH (40 mL x 2), dried over anhydrous NaSO, and the filtrate was concentrated under reduced pressure to obtain Compound 8 (298 mg, 88.2%) as a pale yellow oil.

[0421] 5. Synthesis of Compound 9

[0422] To compound 8 (298 mg, 0.83 mmol, 1.0 eq.) dissolved in THF (3 mL) was added LiAlH₄ (1 M, 1.66 mL, 2.0 eq.) under nitrogen at 0°C. The reaction was allowed to warm to room temperature and stirred under nitrogen for 2 hours. TLC (PE / EtOAc = 10 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with H₂O (20 mL), then adjusted to pH 6-7 with 1 M hydrochloric acid and extracted three times with EA (30 mL). The organic layer was washed with brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-10 / 1) to afford compound 9 (254 mg, 98.3%) as a colorless oil.

[0423] 6. Synthesis of Compound 11

[0424] Compound 9 (254 mg, 0.80 mmol, 1.0 eq.) and compound 10 (214 mg, 0.96 mmol, 1.2 eq.) were dissolved in DCM (3 mL). EDCI (305.6 mg, 1.6 mmol, 2.0 eq.) and DMAP (39 mg, 0.32 mmol, 0.4 eq.) were added to the mixture, followed by DIEA (412.8 mg, 3.2 mmol, 4.0 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (PE / EA = 10 / 1) showed that compound 9 was consumed and the desired product was formed. The reaction mixture was adjusted to pH 4-6 with 1 M hydrochloric acid and extracted three times with EA (30 mL). The resulting organic phase was washed twice with brine (15 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography using PE / EA (1 / 0-7 / 1) as eluent to give compound 11 (210 mg, 50.5%) as a yellow oil.

[0425] 7. Synthesis of SW-II-136-2

[0426] Compound 11 (200 mg, 0.38 mmol, 1.2 eq.) and compound 12 (105 mg, 0.32 mmol, 1.0 eq.) were dissolved in CPME / CHCN (1.5 mL / 1.5 mL). To this mixture were added KCO (220.2 mg, 1.60 mmol, 5.0 eq.) and KI (106 mg, 0.64 mmol, 2.0 eq.). After the addition, the reaction mixture was stirred at 90°C overnight under nitrogen. TLC (DCM / MeOH = 10 / 1) indicated completion of the reaction and formation of the desired product. The mixture was extracted with EA and washed with water. The organic layer was dried over anhydrous NaSO, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with DCM / MeOH (1 / 0-10:1, v / v) to afford SW-II-136-2 (208 mg, 90.4%) as a yellow oil.

[0427] LCMS:Rt:2.146min; MS m / z(ELSD):773.3[M+H] + ;

[0428] HPLC: 99.49% purity, ELSD; RT = 8.055 min.

[0429] 1 H NMR (400MHz, CDCl3) δ7.04(d,J=7.6Hz,1H),6.92(d,J=9.6Hz,2H),4.45(s,1H),4.06(dd,J=12.0,5.2Hz,4H),3.64(t,J=5.2Hz,2 H),2.72(t,J=5.2Hz,2H),2.65–2.50(m,10H),2.29(t,J=7.6Hz,4H),1.69–1.48(m,18H),1.41–1.24(m,36H),0.95–0.78(m,9H).

[0430] 13C NMR (101MHz, CDCl3) δ173.86 (d, J=2.8Hz), 140.48 (s), 139.24 (s), 138.01 (s), 129.13 (d, J= 14.8Hz),125.67(s),77.37(s),77.05(s),76.73(s),64.45(s),64.23(s),57.88(s), 55.91(s),53.94(s),35.07(s),34.29(d,J=3.2Hz),32.79(s),32.35(s),31.82(d,J= 8.4Hz),31.38(s),29.50(d,J=2.4Hz),29.16(dd,J=18.0,2.0Hz),28.66(s),28.35(s ),27.78(s),27.08(s),26.02(d,J=17.2Hz),24.89(d,J=1.6Hz),22.65(s),14.10(s).

[0431] M. Compound SW-II-137-1

[0432] 1. Synthesis of compound 3

[0433] Compound 1 (500 mg, 1.95 mmol, 1.0 eq.) was dissolved in toluene (5.0 mL), followed by the addition of compound 2 (239 mg, 2.34 mmol, 1.2 eq.), Pd(PPh3)4 (225 mg, 0.19 mmol, 0.1 eq.), water (1 mL), and K2CO3 (808 g, 5.85 mmol, 3.0 eq.). The reaction was allowed to proceed at 110°C for 3 hours under nitrogen. TLC (PE / EA = 5 / 1) indicated complete reaction of the starting material and the formation of the desired product. H2O (70 mL) was added to the reaction mixture, and the mixture was extracted with EA (80 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na2SO4, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-5:1, v / v) as the eluent to afford the compound (320 mg, 70%) as a colorless oil.

[0434] 2. Synthesis of compound 4

[0435] Compound 3 (300 mg, 1.28 mmol, 1.0 eq.) was dissolved in THF (4.0 mL) and LAH (97 mg, 2.56 mmol, 2.0 eq.) was added at 0°C under nitrogen. The reaction was then allowed to react at room temperature for 2 hours. TLC (PE / EA = 10 / 1) indicated complete reaction of the starting material and the formation of the desired product. The mixture was quenched with 1 M HCl (4 mL) and H₂O (10 mL), and extracted with EA (50 mL x 3). The organic phase was washed with saturated brine (2 x 30 mL), dried over anhydrous Na₂SO₄, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-10 / 1, v / v) as the eluent to afford Compound 4 (224 mg, 84.8%) as a yellow oil.

[0436] 3. Synthesis of Compound 6

[0437] Compound 4 (90 mg, 0.47 mmol, 1.0 eq.) was dissolved in DCM (3.0 mL), and compound 5 (127 mg, 0.56 mmol, 1.2 eq.), EDCI (180 mg, 0.94 mmol, 2.0 eq.), DIEA (242 mg, 1.88 mmol, 4.0 eq.), and DMAP (23 mg, 0.18 mmol, 0.4 eq.) were added. The mixture was then allowed to react overnight at room temperature under nitrogen. TLC (PE / EA = 20 / 1) indicated complete reaction of the starting material and formation of the desired product. The reaction was quenched with 1 M HCl solution, the pH adjusted to 4-6, and extracted with EA (40 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na2SO4, filtered, and dried under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-20 / 1, v / v) as eluent to give compound 6 (90 mg, 48.6%) as a colorless oil.

[0438] 4. Synthesis of SW-II-137-1

[0439] Compound 6 (90 mg, 0.25 mmol, 1.0 eq.) was dissolved in MeCN (2 mL) and compound 7 (110 mg, 0.25 mmol, 1.0 eq.), KI (76 mg, 0.50 mmol, 2.0 eq.), CPME (2 mL), and KCO (157 mg, 1.25 mmol, 5.0 eq.) were added. The reaction was allowed to proceed at 90°C overnight under nitrogen. TLC (DCM / MeOH = 10 / 1) indicated complete reaction of the starting material and formation of the desired product. The mixture was quenched with water (50 mL) and extracted with EA (40 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous NaSO, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using DCM / MeOH (1 / 0-10 / 1, v / v) as the eluent to afford the compound (98 mg, 52.12%, SW-II-137-1) as a yellow oil.

[0440] LCMS:Rt:1.596min; MS m / z(ELSD):758.4[M+H] + ;

[0441] HPLC: 98.02% purity, ELSD; RT = 5.993 min.

[0442] 1 H NMR(400MHz, CDCl3) δ7.02(d,J=8.8Hz,4H),4.92–4.71(m,1H),4.01(t,J=6.4Hz,2H),3.78(s,1H),3.55(t,J=5.2Hz,2H),2.76–2.40(m,10H ),2.21(dd,J=15.6,7.7Hz,4H),1.95–1.80(m,2H),1.49(ddd,J=24.4,15.8,6.2Hz,15H),1.34–1.13(m,37H),0.82(dt,J=13.6,7.2Hz,9H).

[0443] 13C NMR(101MHz, CDCl3)δ173.79(s),173.57(s),140.49(s),138.30(s),128.43(s),128.22(s),77.43(s), 77.11(s),76.79(s),74.11(s),63.66(s),57.96(s),55.75(s),53.90(s),35.22(s),34.63(s),34.20( d,J=11.6Hz),33.70(s),31.80(d,J=11.2Hz),30.30(s),29.51(d,J=2.8Hz),29.13(dd,J=9.6,6.8Hz), 27.12(d,J=2.8Hz),26.29(s),25.31(s),24.97(d,J=15.6Hz),22.66(s),22.37(s),14.02(d,J=15.2Hz) .

[0444] N. Compound SW-II-137-2

[0445] 1. Synthesis of compound 3

[0446] Compound 1 (500 mg, 2.06 mmol, 1.0 eq.), compound 2 (286 mg, 2.47 mmol, 1.2 eq.), Pd(PPh3)4 (119 mg, 0.1 mmol, 0.1 eq.), and K2CO3 (851 mg, 6.21 mmol, 3.0 eq.) were dissolved in toluene (5.0 mL), and water (0.5 mL) was added. The mixture was then reacted at 110°C for 3 hours under nitrogen. TLC (PE / EA = 5 / 1) indicated complete reaction of the starting materials and the formation of the desired compound. The reaction was quenched with H2O (70 mL) and extracted with EA (80 mL x 3). The organic phase was washed with saturated brine (2 x 30 mL), dried over anhydrous Na2SO4, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA = 5 / 1, v / v as the eluent to afford Compound 3 (420 mg, 87.5%) as a colorless oil.

[0447] 2. Synthesis of compound 4

[0448] Compound 3 (420 mg, 1.78 mmol, 1.0 eq.) was dissolved in THF (3.0 mL), and LAH (1 M, 7 mL, 2.0 eq.) was added dropwise at 0°C under nitrogen. The reaction was then allowed to react at room temperature for 2 hours. TLC (PE / EA = 5 / 1) indicated complete reaction of the starting material and formation of the desired product. The reaction was quenched with HCl (1 M, 4 mL) and H₂O (10 mL), and extracted with EA (50 mL x 3). The organic phase was washed with saturated brine (2 x 30 mL), dried over anhydrous Na₂SO₄, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA = 5 / 1, v / v as the eluent to afford compound 4 (320 mg, 94%) as a colorless oil.

[0449] 3. Synthesis of Compound 6

[0450] Compound 4 (320 mg, 1.55 mmol, 1.0 eq.) was dissolved in DCM (4.0 mL), and compound 5 (416 mg, 1.86 mmol, 1.2 eq.), EDCI (594 mg, 3.11 mmol, 2.0 eq.), DIEA (802 mg, 6.21 mmol, 4.0 eq.), and DMAP (76 mg, 0.62 mmol, 0.4 eq.) were added. The mixture was then allowed to react overnight at room temperature under nitrogen. TLC (PE / EA = 20 / 1) indicated complete reaction of the starting materials and formation of the desired product. The reaction was quenched with 1 M HCl solution and adjusted to pH 4-6. The mixture was then extracted with DCM (60 mL x 3). The organic phase was washed with saturated brine (2 x 35 mL), dried over anhydrous Na2SO4, filtered, and dried under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA=5 / 1, v / v) to give compound 6 (300 mg, 47.17%) as a colorless oil.

[0451] 4. Synthesis of SW-II-137-2

[0452] Compound 6 (167 mg, 0.41 mmol, 1.2 eq.), compound 7 (150 mg, 0.34 mmol, 1.0 eq.), KI (113 mg, 0.68 mmol, 2.0 eq.) and CPME (2 mL) were dissolved in MeCN (2 mL), and K2CO3 (235 mg, 1.70 mmol, 5.0 eq.) was added. oC and reacted overnight. TLC (DCM / MeOH=10 / 1) showed that the starting material was completely reacted and the desired product was generated. The reaction was quenched with water (50 mL) and extracted with EA (60 ml x 3). The organic phase was dried over anhydrous Na2SO4, filtered, and dried under reduced pressure. The residue was purified on a silica gel column using DCM / MeOH (1 / 0-10 / 1, v / v) as eluent to give the compound as a light yellow oil (105 mg, 40.3%, SW-II-137-2).

[0453] LCMS:Rt:1.660min;MS m / z(ELSD):772.4[M+H] + ;

[0454] HPLC: 98.38% purity, ELSD; RT = 8.743 min.

[0455] 1 H NMR (400MHz, CDCl3) δ7.10 (d, J=8.8Hz, 4H), 5.04–4.74 (m, 1H), 4.08 (t, J=6 .4Hz,2H),3.58(t,J=5.2Hz,2H),2.65(dd,J=9.6,5.6Hz,4H),2.60–2.44(m, 6H),2.29(dd,J=16.4,7.6Hz,4H),2.01–1.88(m,2H),1.59(dt,J=9.2,7.2H z,6H),1.54–1.42(m,8H),1.39–1.11(m,41H),0.88(dt,J=11.8,6.0Hz,9H).

[0456] 13 C NMR(101MHz, CDCl3)δ173.86(s),173.63(s),140.59(s),138.34(s),128.45(s),128.24(s),77.36(s),77 .04(s),76.72(s),74.14(s),63.69(s),58.11(s),55.71(s),53.90(s),35.53(s),34.68(s),34.23(d,J=1 4.8Hz),31.82(d,J=11.6Hz),31.56(s),31.26(s),30.32(s),29.53(d,J=2.8Hz),29.19(dd,J=8.0,4.4Hz ), 27.20 (d, J = 2.4Hz), 26.64 (s), 25.33 (s), 25.02 (d, J = 15.6Hz), 22.62 (d, J = 11.6Hz), 14.08 (d, J = 8.0Hz).

[0457] O. Compound SW-II-137-3

[0458] 1. Synthesis of compound 3

[0459] To a mixture of compound 1 (11.8 g, 53 mmol, 1.2 eq.) and compound 2 (11.2 g, 44 mmol, 1 eq.) in DCM (110 mL) were added EDCI (16.9 g, 88 mmol, 2 eq.) and DMAP (2.1 g, 18 mmol, 0.4 eq.), followed by DIEA (22.7 g, 176 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 30 / 1) showed that compound 1 was consumed and the desired product was formed. The reaction mixture was extracted with ethyl acetate (200 mL) and washed with water (200 mL × 3), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with petroleum ether / ethyl acetate (1 / 0-20 / 1) to give compound 3 (7.391 g, 37%) as a colorless oil.

[0460] 2. Synthesis of compound 5

[0461] A mixture of compound 3 (7.391 mg, 16.07 mmol, 1 eq.) and compound 4 (29.4 g, 482.02 mmol, 30 eq.) in ethanol (2 mL) was stirred at 55 ° C under nitrogen for 16 hours. TLC (DCM / MeOH=10 / 1) showed that a new major spot was observed. The reaction mixture was extracted with ethyl acetate (100 mL) and washed with water (3×100 mL). The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with DCM / MeOH (1 / 0-10:1, v / v) to give compound 5 (3.695 g, 52%) as a yellow oil.

[0462] 3. Synthesis of Compound 8

[0463] To a mixture of compound 6 (1 g, 4.12 mmol, 1 eq.) and compound 7 (803 g, 6.17 mmol, 1.5 eq.) in 1,4-dioxane / water (10 mL / 1 mL) were added Pd(dtbpf)Cl2 (269 mg, 0.41 mmol, 0.1 eq.) and potassium carbonate (1.7 g, 12.36 mmol, 3 eq.). The mixture was stirred at 100°C overnight under nitrogen. TLC (PE / EA = 20 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-20 / 1) to give compound 8 (568 mg, 56%) as a colorless oil.

[0464] 4. Synthesis of Compound 9

[0465] To a mixture of compound 8 (568 mg, 2.29 mmol, 1 eq.) in THF (6 mL) at 0°C under nitrogen was added lithium aluminum hydride (2.3 mL, 2.29 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated completion of the reaction and a new major spot was observed. The mixture was quenched with water (2.3 mL) and treated with 2N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to afford compound 9 (541 mg, >100%) as a colorless oil without further purification.

[0466] 5. Synthesis of Compound 10

[0467] To a mixture of compound 9 (441 mg, 2 mmol, 1 eq.) and compound 1 (536 mg, 2.4 mmol, 1.2 eq.) in DCM (5 mL) were added EDCI (768 mg, 4 mmol, 2 eq.) and DMAP (98 mg, 0.8 mmol, 0.4 eq.), followed by DIEA (1.032 g, 8 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 10 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography eluted with petroleum ether / ethyl acetate (1 / 0-10 / 1) to give compound 10 (372 mg, 44%) as a colorless oil.

[0468] 6. Synthesis of SW-II-137-3

[0469] To a mixture of compound 10 (150 mg, 0.353 mmol, 1 eq.) and compound 5 (156 mg, 0.353 mmol, 1 eq.) in CPME / CH3CN (2 mL / 2 mL) were added potassium carbonate (244 mg, 1.765 mmol, 6 eq.) and potassium iodide (117 mg, 0.706 mmol, 2 eq.). After addition, the mixture was stirred at 90 ° C overnight under nitrogen. TLC (DCM / MeOH=10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with DCM / MeOH (1 / 0-10:1, v / v) to give SW-II-137-3 (56.17 mg, 20%) as a yellow oil.

[0470] LCMS:Rt:1.550min;MS m / z(ELSD):786.4[M+H] + ;

[0471] HPLC: 98.597% purity, ELSD; RT = 13.153 min.

[0472] 1 H NMR(400MHz, CDCl3)δ7.09(s,4H),4.92–4.78(m,1H),4.08(t,J=6.6Hz,2H),3.62(t,J=5.2Hz,2H),2.78–2.50(m,10H), 2.35–2.22(m,4H),2.00–1.88(m,2H),1.57(ddd,J=28.9,13.5,4.5Hz,14H),1.38–1.20(m,42H),0.88(t,J=6.8Hz,9H).

[0473] 13C NMR(101MHz, CDCl3)δ173.83(s),173.60(s),140.60(s),138.33(s),128.44(s),128.24(s),77.36 (s),77.04(s),76.72(s),74.15(s),63.69(s),57.95(s),55.83(s),53.95(s),35.56(s),34.65(s) ),34.21(d,J=13.0Hz),31.81(d,J=12.3Hz),31.54(s),30.32(s),29.52(d,J=3.1Hz),29.34–28.9 4(m),27.13(d,J=2.5Hz),26.31(s),25.33(s),24.99(d,J=15.7Hz),22.64(d,J=5.7Hz),14.11(s).

[0474] P. Compound SW-II-138-1

[0475] 1. Synthesis of Compound 2

[0476] Compound 1 (4 g, 16.46 mmol, 1.0 eq.) was dissolved in MeOH (40 mL), cooled to 0°C, and SOCl2 (3.9 g, 32.92 mmol, 2.0 eq.) was added dropwise. The reaction was then allowed to react at room temperature for 1 hour. TLC (PE / EA = 5 / 1) showed that the starting material had been consumed and the desired product had formed. The system was directly evaporated to dryness under reduced pressure. NaHCO3 solution (70 mL) was added to the residue, and the mixture was extracted with EA (80 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na2SO4, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-5:1, v / v) as the eluent to afford Compound 2 (4.1 mg, 95%) as a yellow oil.

[0477] 2. Synthesis of compound 4

[0478] Compound 2 (500 mg, 1.95 mmol, 1.0 eq.), compound 3 (239 mg, 2.34 mmol, 1.2 eq.), Pd(PPh3)4 (225 mg, 0.19 mmol, 0.1 eq.), and K2CO3 (808 g, 5.85 mmol, 3.0 eq.) were dissolved in toluene (5.0 mL) and water (1 mL) was added. The mixture was then reacted at 110°C under nitrogen for 3 hours. TLC (PE / EA = 5 / 1) indicated complete consumption of the starting material and formation of the desired product. The reaction was quenched with H2O (70 mL) and extracted with EA (80 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na2SO4, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-5:1, v / v) as the eluent to afford compound 4 (320 mg, 70%) as a yellow oil.

[0479] 3. Synthesis of compound 5

[0480] Compound 4 (300 mg, 1.28 mmol, 1.0 eq.) was dissolved in THF (4.0 mL), and LAH (97 mg, 2.56 mmol, 2.0 eq.) was added at 0°C. The reaction was then allowed to react at room temperature under nitrogen for 2 hours. TLC (PE / EA = 5 / 1) indicated complete consumption of the starting material and the formation of the desired product. The reaction was quenched with 1 M HCl (4 mL) and H₂O (10 mL), and extracted with EA (50 mL x 3). The organic phase was washed with saturated brine (2 x 30 mL), dried over anhydrous Na₂SO₄, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-5:1, v / v) as the eluent to afford Compound 5 (224 mg, 84.8%) as a yellow oil.

[0481] 4. Synthesis of Compound 7

[0482] Compound 7 (224 mg, 1.09 mmol, 1.0 eq.) was dissolved in DCM (3.0 mL), and compound 6 (290 mg, 1.30 mmol, 1.2 eq.), EDCI (415 mg, 2.17 mmol, 2.0 eq.), DIEA (561 mg, 4.35 mmol, 4.0 eq.), and DMAP (53 mg, 0.43 mmol, 0.4 eq.) were added. The reaction was then allowed to proceed overnight at room temperature under nitrogen. TLC (PE / EA = 30 / 1) indicated complete consumption of the starting material and formation of the desired product. The reaction was quenched with 1 M HCl solution and adjusted to pH 4-6, followed by extraction with DCM (80 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na2SO4, filtered, and dried under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-30:1, v / v) as eluent to give compound 7 (208 mg, 46.7%) as a colorless oil.

[0483] 5. Synthesis of SW-II-138-1

[0484] Compound 10 (110 mg, 0.25 mmol, 1 eq.), compound 7 (153 mg, 0.37 mmol, 1.5 eq.), KI (83 mg, 0.50 mmol, 2.0 eq.) and CPME (2 mL) were dissolved in MeCN (2 mL) and K2CO3 (172 mg, 1.25 mmol, 5.0 eq.) was added. o The reaction was allowed to proceed overnight at C. TLC (DCM / MeOH = 10 / 1) indicated that the starting material had been consumed and the desired product had formed. The reaction mixture was directly evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using DCM / MeOH (1 / 0-10:1, v / v) as the eluent to afford the compound (65 mg, 32%, SW-II-138-1) as a light yellow oil.

[0485] LCMS:Rt:1.684min;MS m / z(ELSD):772.4[M+H] + ;

[0486] HPLC: 96.56% purity, ELSD; RT = 6.346 min.

[0487] 11H NMR (400 MHz, CDCl3) δ 7.09 (s, 4H), 4.86 (s, 1H), 4.09 (d, J = 6.0 Hz, 2H), 3.97 (s, 2H), 3.07 (d, J = 38.8 Hz, 6H), 2.69–2.51 (m, 4H), 2.28 (td, J = 7.3, 3.6 Hz, 4H), 1.79 (s, 4H), 1.70–1.46 (m, 16H), 1.42–1.17 (m, 37H), 0.90 (dt, J = 13.6, 7.2 Hz, 9H).

[0488] 13 13C NMR (101 MHz, CDCl3) δ 173.80 (s), 173.53 (s), 140.32 (s), 139.13 (s), 128.28 (d, J = 13.6 Hz), 77.43 (s), 77.11 (s), 76.80 (s), 74.21 (s), 64.22 (s), 56.85 (s), 55.98 (s), 53.93 (s), 35.22 (s), 35.01 (s), 34.54 (s), 34.14 (d, J = 5.6 Hz), 33.71 (s), 31.85 (s), 29.50 (d, J = 2.8 Hz), 29.22 (s), 29.12–28.60 (m), 28.26 (s), 27.78 (s), 26.70 (d, J = 4.4 Hz), 25.31 (s), 24.82 (d, J = 17.6 Hz), 24.28 (s), 22.65 (s), 22.37 (s), 14.03 (d, J = 15.2 Hz).

[0489] QSW-II-138-2

[0490] 1. Synthesis of Compound 3

[0491] Compound 1 (500 mg, 1.95 mmol, 1.0 eq.), compound 2 (271 mg, 2.34 mmol, 1.2 eq.), Pd(PPh3)4 (225 mg, 0.20 mmol, 0.1 eq.), and K2CO3 (809 g, 5.86 mmol, 3.0 eq.) were dissolved in toluene (5.0 mL) and water (1 mL). The mixture was then reacted at 110°C under nitrogen for 3 hours. TLC (PE / EA = 5 / 1) indicated complete consumption of the starting material and formation of the desired product. The reaction was quenched with water (70 mL) and extracted with EA (80 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na2SO4, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-30:1, v / v) as the eluent to afford compound 3 (320 mg, 70%) as a colorless oil.

[0492] 2. Synthesis of compound 4

[0493] Compound 3 (320 mg, 1.29 mmol, 1.0 eq.) was dissolved in THF (3.0 mL). o C was added with LAH (67 mg, 1.77 mmol, 2.0 eq), and the mixture was allowed to react at room temperature under nitrogen for 2 hours. TLC (PE / EA = 5 / 1) showed that the starting material was consumed and the desired product was formed. The reaction was quenched with HCl (1 M, 2 mL) and H₂O (10 mL), and extracted with EA (50 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na₂SO₄, filtered, and dried under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-30:1, v / v) as the eluent to afford compound 4 (180 mg, 64%) as a colorless oil.

[0494] 3. Synthesis of Compound 6

[0495] Compound 4 (180 mg, 0.82 mmol, 1.0 eq.) was dissolved in DCM (3.0 mL) and compound 5 (245 mg, 1.10 mmol, 1.2 eq.), EDCI (347 mg, 1.82 mmol, 2.0 eq.), DIEA (470 mg, 3.63 mmol, 4.0 eq.), and DMAP (45 mg, 0.36 mmol, 0.4 eq.) were added. The reaction was then allowed to proceed under nitrogen at room temperature overnight. TLC (PE / EA = 30 / 1) indicated complete consumption of the starting material and formation of the desired product. The reaction was quenched with 1 M HCl solution and adjusted to pH 5-6, followed by extraction with DCM (80 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na2SO4, filtered, and dried under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-30:1, v / v) as eluent to give compound 6 (220 mg, 63.6%) as a colorless oil.

[0496] 4. Synthesis of SW-II-138-2

[0497] Compound 6 (158 mg, 0.37 mmol, 1.5 eq.) and compound 7 (110 mg, 0.25 mmol, 1.0 eq.), KI (83 mg, 0.50 mmol, 2.0 eq.), and CPME (2 mL) were dissolved in MeCN (2 mL), and KCO (172 mg, 1.25 mmol, 5.0 eq.) was added. The reaction was then allowed to proceed at 90°C overnight under nitrogen. TLC (DCM / MeOH = 10 / 1) indicated complete consumption of the starting material and formation of the desired product. The reaction mixture was then evaporated to dryness under reduced pressure, and the residue was purified on a silica gel column using DCM / MeOH (1 / 0-10:1, v / v) as the eluent to afford the desired product (100 mg, 51%, SW-II-138-2) as a colorless oil.

[0498] LCMS:Rt:1.834min; MS m / z(ELSD):786.4[M+H] + ;

[0499] HPLC: 99.20% purity, ELSD; RT = 7.990 min.

[0500] 11H NMR (400 MHz, CDCl3) δ 7.00 (s, 4H), 4.88–4.73 (m, 2H), 4.00 (t, J = 5.6 Hz, 2H), 3.81–3.54 (m, 2H), 3.00–2.81 (m, 2H), 2.81–2.65 (m, 4H), 2.50 (dd, J = 16.4, 8.4 Hz, 4H), 2.20 (td, J = 7.6, 3.2 Hz, 4H), 1.56 (ddd, J = 18.4, 10.4, 5.2 Hz, 13H), 1.43 (d, J = 5.6 Hz, 4H), 1.34–1.07 (m, 40H), 0.81 (dt, J = 11.2, 5.6 Hz, 9H).

[0501] 13 13C NMR (101 MHz, CDCl3) δ 173.78 (s), 173.52 (s), 140.32 (s), 139.11 (s), 128.25 (d, J = 11.6 Hz), 77.49 (s), 77.17 (s), 76.85 (s), 74.14 (s), 64.17 (s), 57.25 (s), 55.82 (s), 53.85 (s), 35.50 (s), 35.01 (s), 34.56 (s), 34.14 (d, J = 7.2 Hz), 31.84 (s), 31.53 (s), 31.23 (s), 29.49 (d, J = 2.8 Hz), 29.21 (s), 28.94 (dd, J = 6.4, 4.4 Hz), 28.25 (s), 27.77 (s), 26.84 (d, J = 4.4 Hz), 25.30 (s), 25.25–24.59 (m), 22.59 (d, J = 11.2 Hz), 14.05 (d, J = 7.6 Hz).

[0502] RSW-II-138-3

[0503] 1. Synthesis of Compound 3

[0504] Compound 1 (500 mg, 1.95 mmol, 1.0 eq.), compound 2 (305 mg, 2.34 mmol, 1.2 eq.), Pd(PPh3)4 (225 mg, 0.20 mmol, 0.1 eq.), and K2CO3 (809 g, 5.86 mmol, 3.0 eq.) were dissolved in toluene (5.0 mL) and water (1 mL) was added. The reaction was then incubated at 110°C for 3 hours under nitrogen. TLC (PE / EA = 5:1) indicated complete consumption of the starting material and formation of the desired compound. The reaction was quenched with water (80 mL) and extracted with EA (80 mL x 3). The combined organic phases were washed with saturated brine (2 x 40 mL), dried over anhydrous Na2SO4, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-5:1, v / v) as the eluent to afford compound 3 (260 mg, 51.3%) as a colorless oil.

[0505] 2. Synthesis of compound 4

[0506] Compound 3 (260 mg, 0.99 mmol, 1.0 eq.) was dissolved in THF (4.0 mL). o C was added with LAH (75 mg, 1.98 mmol, 2.0 eq). The reaction was then allowed to proceed at room temperature under nitrogen for 2 hours. TLC (PE / EA = 5 / 1) indicated complete reaction of the starting material and the formation of the desired compound. The reaction was quenched with 1M HCl (4 mL) and H₂O (20 mL), and extracted with EA (50 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na₂SO₄, filtered, and evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-5:1, v / v) as the eluent to afford compound 4 (230 mg, 98%) as a colorless oil.

[0507] 3. Synthesis of Compound 6

[0508] Compound 4 (240 mg, 1.03 mmol, 1.0 eq.) was dissolved in DCM (4.0 mL), and compound 5 (275 mg, 1.23 mmol, 1.2 eq.), EDCI (392 mg, 2.07 mmol, 2.0 eq.), DIEA (530 mg, 4.10 mmol, 4.0 eq.), and DMAP (50 mg, 0.41 mmol, 0.4 eq.) were added sequentially. The reaction was then allowed to proceed overnight at room temperature under nitrogen. TLC (PE / EA = 20 / 1) indicated complete consumption of the starting material and formation of the desired compound. The reaction was quenched with HCl (1 M) and the pH was adjusted to 5-6. The mixture was then extracted with DCM (80 mL x 3). The combined organic phases were washed with saturated brine (2 x 30 mL), dried over anhydrous Na2SO4, filtered, and dried under reduced pressure. The residue was purified on a silica gel column using PE / EA (1 / 0-20:1, v / v) as eluent to give compound 6 (180 mg, 40.9%) as a colorless oil.

[0509] 4. Synthesis of SW-II-138-3

[0510] Compound 6 (164 mg, 0.37 mmol, 1 eq.), compound 7 (110 mg, 0.24 mmol, 1.0 eq.), KI (83 mg, 0.49 mmol, 2.0 eq.), and CPME (2 mL) were dissolved in MeCN (2 mL) and KCO (172 mg, 1.24 mmol, 5.0 eq.) was added. The mixture was then reacted at 90°C overnight under nitrogen. TLC (DCM / MeOH = 10 / 1) indicated complete consumption of the starting material and formation of the desired product. The reaction mixture was then evaporated to dryness under reduced pressure. The residue was purified on a silica gel column using DCM / MeOH (1 / 0-10:1, v / v) as the eluent to afford the desired product (108 mg, 52.76%, SW-II-138-3) as a colorless oil.

[0511] LCMS:Rt:2.007min;MS m / z(ELSD):800.4[M+H] + ;

[0512] HPLC: 97.95% purity, ELSD; RT = 9.455 min.

[0513] 1H NMR (400MHz, CDCl3) δ7.08(s,4H),4.86(p,J=6.4Hz,1H),4.08(s,2H),3.60(t,J=5.2Hz,3H),2.76–2.42( m,10H),2.28(td,J=7.6,2.8Hz,4H),1.70–1.42(m,18H),1.28(d,J=20.0Hz,41H),0.88(t,J=6.8Hz,9H).

[0514] 13 C NMR(101MHz, CDCl3)δ173.85(s),173.59(s),140.39(s),139.15(s),128.27(d,J=12.0Hz),77.38(s),7 7.07(s),76.75(s),74.13(s),64.17(s),58.06(s),55.75(s),53.92(s),35.57(s),35.03(s),34.66(s) ,34.22(d,J=13.2Hz),31.81(d,J=12.4Hz),31.54(s),29.52(d,J=2.9Hz),29.34–28.95(m),28.29(s), 27.79 (s), 27.16 (d, J = 3.6Hz), 26.50 (s), 25.32 (s), 24.99 (d, J = 17.6Hz), 22.64 (d, J = 5.6Hz), 14.10 (s).

[0515] S. Compound SW-II-139-1

[0516] 1. Synthesis of compound 3

[0517] To a mixture of compound 1 (1 g, 4.37 mmol, 1 eq.) and compound 2 (852 g, 6.55 mmol, 1.5 eq.) in 1,4-dioxane / water (10 mL / 1 mL) were added Pd(dtbpf)Cl2 (286 mg, 0.437 mmol, 0.1 eq.) and potassium carbonate (1.8 g, 13.11 mmol, 3 eq.). The mixture was stirred at 100°C overnight under nitrogen. TLC (PE / EA = 20 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-20 / 1) to give compound 3 (691 mg, 68%) as a colorless oil.

[0518] 2. Synthesis of compound 4

[0519] To a mixture of compound 3 (691 mg, 2.95 mmol, 1 eq.) in THF (7 mL) at 0°C under nitrogen was added lithium aluminum hydride (3 mL, 2.95 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was quenched with water (3 mL) and treated with 2N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to afford compound 4 (547 mg, 90%) as a colorless oil without further purification.

[0520] 3. Synthesis of Compound 6

[0521] To a mixture of compound 4 (447 mg, 2.17 mmol, 1 eq.) and compound 5 (581 mg, 2.6 mmol, 1.2 eq.) in DCM (5 mL) were added EDCI (833 mg, 4.34 mmol, 2 eq.) and DMAP (106 mg, 0.87 mmol, 0.4 eq.), followed by DIEA (1.12 g, 8.68 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-20 / 1) to give compound 6 (455 mg, 51%) as a colorless oil.

[0522] 4. Synthesis of SW-II-139-1

[0523] To a mixture of compound 6 (150 mg, 0.365 mmol, 1 eq.) and compound 7 (161 mg, 0.365 mmol, 1 eq.) in CPME / CH3CN (2 mL / 2 mL) were added potassium carbonate (252 mg, 1.825 mmol, 6 eq.) and potassium iodide (121 mg, 0.73 mmol, 2 eq.). After addition, the mixture was stirred at 90 ° C under nitrogen overnight. TLC (DCM / MeOH=10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with DCM / MeOH (1 / 0-10:1, v / v) to give a yellow oily compound SW-II-139-1 (54.53 mg, 19%).

[0524] LCMS:Rt:1.521min;MS m / z(ELSD):772.4[M+H] + ;

[0525] HPLC: 99.637% purity, ELSD; RT = 12.347 min.

[0526] 1 H NMR (400MHz, CDCl3) δ7.20(t,J=7.7Hz,1H),7.03(t,J=6.8Hz,3H),4.94–4.78(m,1H),4.27(t,J=7.2Hz,2H),3.65(t,J=5.1Hz,2H),2.90(t,J=7.2H z,2H),2.73(t,J=4.9Hz,2H),2.67–2.41(m,6H),2.28(td,J=7.5,2.7Hz, 4H),1.67–1.45(m,14H),1.41–1.19(m,42H),0.88(dd,J=7.9,5.7Hz,9H).

[0527] 13C NMR (101MHz, CDCl3) δ173.65 (d, J = 11.3Hz), 143.17 (s), 137.67 (s), 129.04 (s), 128.34 (s), 126.61 (s), 126 .11(s),77.30(d,J=11.6Hz),77.04(s),76.72(s),74.16(s),64.85(s),57.88(s),55.93(s),53.97(s),35 .94(s),35.13(s),34.64(s),34.20(d,J=10.5Hz),31.80(d,J=13.7Hz),31.50(s),29.52(d,J=2.9Hz),29. 34–28.92(m),27.08(d,J=3.9Hz),26.10(s),25.33(s),25.05(s),24.82(s),22.64(d,J=6.5Hz),14.11(s).

[0528] T. Compound SW-II-139-2

[0529] 1. Synthesis of compound 3

[0530] To a mixture of compound 1 (1 g, 4.37 mmol, 1 eq.) and compound 2 (668 g, 6.55 mmol, 1.5 eq.) in 1,4-dioxane / water (10 mL / 1 mL) were added Pd(dtbpf)Cl2 (286 mg, 0.437 mmol, 0.1 eq.) and potassium carbonate (1.8 g, 13.11 mmol, 3 eq.). The mixture was stirred at 100°C overnight under nitrogen. TLC (PE / EA = 20 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-20 / 1) to give compound 3 (605 mg, 67%) as a colorless oil.

[0531] 2. Synthesis of compound 4

[0532] To a mixture of compound 3 (605 mg, 2.94 mmol, 1 eq.) in THF (7 mL) was added lithium aluminum hydride (3 mL, 2.94 mmol, 1 M in THF, 1 eq.) at 0°C under nitrogen. The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated completion of the reaction and a new major spot was observed. The mixture was quenched with water (3 mL) and treated with 2N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to afford compound 4 (534 mg, >100%) as a colorless oil without further purification.

[0533] 3. Synthesis of Compound 6

[0534] To a mixture of compound 4 (434 mg, 2.44 mmol, 1 eq.) and compound 5 (652 mg, 2.93 mmol, 1.2 eq.) in DCM (5 mL) were added EDCI (937 mg, 4.88 mmol, 2 eq.) and DMAP (119 mg, 0.976 mmol, 0.4 eq.), followed by DIEA (1.259 g, 9.76 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-20 / 1) to give compound 6 (355 mg, 38%) as a colorless oil.

[0535] 4. Synthesis of SW-II-139-2

[0536] To a mixture of compound 6 (122 mg, 0.319 mmol, 1 eq.) and compound 7 (140 mg, 0.319 mmol, 1 eq.) in CPME / CH3CN (2 mL / 2 mL) were added potassium carbonate (220 mg, 1.595 mmol, 5 eq.) and potassium iodide (106 mg, 0.638 mmol, 2 eq.). After addition, the mixture was stirred at 90 ° C overnight under nitrogen. TLC (DCM / MeOH=10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with DCM / MeOH (1 / 0-10:1, v / v) to give SW-II-139-2 (45.48 mg, 19%) as a yellow oil.

[0537] LCMS:Rt:1.346min;MS m / z(ELSD):744.3[M+H] + ;

[0538] HPLC: 97.994% purity, ELSD; RT = 11.235 min.

[0539] 1 H NMR (400MHz, CDCl3) δ7.20(t,J=7.8Hz,1H),7.03(t,J=7.6Hz,3H),4.91–4.81(m,1H),4.27(t,J=7.2Hz,2H),3.89–3.75(m ,2H),2.99–2.79(m,7H),2.64–2.48(m,2H),2.28(td,J=7.5,3.1Hz,4H),1.74–1.08(m,53H),0.90(dt,J=13.6,7.2Hz,9H).

[0540] 13 C NMR (101MHz, CDCl3) δ173.60 (d, J = 11.7Hz), 143.13 (s), 137.65 (s), 129.06 (s), 128.34 (s), 126.64 (s), 126.11 (s) ),77.30(d,J=11.4Hz),77.04(s),76.72(s),74.22(s),64.88(s),57.28(s),56.55(s),54.11(s),35.60(s),35.1 2(s),34.56(s),34.15(d,J=4.0Hz),33.68(s),31.86(s),29.52(d,J=2.8Hz),29.24(s),28.91(dd,J=7.0,4.2Hz) ,26.81(d,J=3.9Hz),25.33(s),25.12–24.98(m),24.83(d,J=22.2Hz),22.67(s),22.40(s),14.04(d,J=14.4Hz).

[0541] U. Compound SW-II-140-1

[0542] 1. Synthesis of compound 3

[0543] To a mixture of compound 1 (1 g, 4.37 mmol, 1 eq.) and compound 2 (852 g, 6.55 mmol, 1.5 eq.) in 1,4-dioxane / water (10 mL / 1 mL) were added Pd(dppf)Cl2 (286 mg, 0.437 mmol, 0.1 eq.) and potassium carbonate (1.8 g, 13.11 mmol, 3 eq.). The mixture was stirred at 100°C overnight under nitrogen. TLC (PE / EA = 20 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-20 / 1) to give compound 3 (748 mg, 73%) as a colorless oil.

[0544] 2. Synthesis of compound 4

[0545] To a mixture of compound 3 (748 mg, 3.2 mmol, 1 eq.) in THF (8 mL) at 0°C under nitrogen was added lithium aluminum hydride (3.2 mL, 3.2 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated completion of the reaction and a new major spot was observed. The mixture was quenched with water (3 mL) and treated with 2N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to afford compound 4 (493 mg, 75%) as a colorless oil without further purification.

[0546] 3. Synthesis of Compound 6

[0547] To a mixture of compound 4 (393 mg, 1.91 mmol, 1 eq.) and compound 5 (511 mg, 2.29 mmol, 1.2 eq.) in DCM (5 mL) were added EDCI (733 mg, 3.82 mmol, 2 eq.) and DMAP (93 mg, 0.76 mmol, 0.4 eq.), followed by DIEA (986 mg, 7.64 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with petroleum ether / ethyl acetate (1 / 0-20 / 1) to give compound 6 (327 mg, 42%) as a colorless oil.

[0548] 4. Synthesis of SW-II-140-1

[0549] To a mixture of compound 6 (150 mg, 0.365 mmol, 1 eq.) and compound 7 (161 mg, 0.365 mmol, 1 eq.) in CPME / CH3CN (2 mL / 2 mL) were added potassium carbonate (302 mg, 2.19 mmol, 6 eq.) and potassium iodide (121 mg, 0.73 mmol, 2 eq.). After addition, the mixture was stirred at 90 ° C under nitrogen overnight. TLC (DCM / MeOH=10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with DCM / MeOH (1 / 0-10:1, v / v) to give a yellow oily compound SW-II-140-1 (180 mg, 64%).

[0550] LCMS:Rt:1.568min;MS m / z(ELSD):772.4[M+H] + ;

[0551] HPLC: 98.053% purity, ELSD; RT = 8.702 min.

[0552] 1 H NMR (400MHz, CDCl3) δ7.23–7.05(m,4H),4.95–4.79(m,1H),4.25(t,J=7.4Hz,2H),3.62(t,J=4.8Hz,2H),2.96(dd,J=15.4,8.0 Hz,2H),2.74–2.49(m,8H),2.28(dd,J=14.2,7.2Hz,4H),1.67–1.44(m,14H),1.41–1.20(m,42H),0.90(dt,J=13.2,7.1Hz,9H).

[0553] 13C NMR (101MHz, CDCl3) δ173.68 (d, J = 10.2Hz), 141.26 (s), 135.23 (s), 129.73 (s), 129.37 (s), 126. 72(s),125.92(s),77.35(s),77.03(s),76.71(s),74.17(s),64.52(s),57.99(s),55.87(s),53 .94(s),34.66(s),34.21(d,J=11.5Hz),32.75(s),31.83(d,J=9.8Hz),31.32(s),29.65–28.88( m), 27.15 (d, J = 3.7Hz), 26.35 (s), 25.33 (s), 25.07 (s), 24.83 (s), 22.66 (d, J = 3.4Hz), 14.12 (s).

[0554] VSW-II-140-2

[0555] 1. Synthesis of compound 3

[0556] To a mixture of compound 1 (1 g, 4.37 mmol, 1 eq.) and compound 2 (668 g, 6.55 mmol, 1.5 eq.) in 1,4-dioxane / water (10 mL / 1 mL) were added Pd(dppf)Cl2 (286 mg, 0.437 mmol, 0.1 eq.) and potassium carbonate (1.8 g, 13.11 mmol, 3 eq.). The mixture was stirred at 100°C overnight under nitrogen. TLC (PE / EA = 20 / 1) indicated the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography eluting with PE / EA (1 / 0-20 / 1) to give compound 3 (406 mg, 45%) as a colorless oil.

[0557] 2. Synthesis of compound 4

[0558] To a mixture of compound 3 (406 mg, 1.97 mmol, 1 eq.) in THF (5 mL) at 0°C under nitrogen was added lithium aluminum hydride (2 mL, 1.97 mmol, 1 M in THF, 1 eq.). The mixture was stirred at room temperature for 3 hours. TLC (PE / EA = 5 / 1) indicated completion of the reaction and a new major spot was observed. The mixture was quenched with water (2 mL) and treated with 2N hydrochloric acid to adjust the pH between 6 and 7, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo to afford compound 4 (341 mg, 97%) as a colorless oil without further purification.

[0559] 3. Synthesis of Compound 6

[0560] To a mixture of compound 4 (241 mg, 1.35 mmol, 1 eq.) and compound 5 (361 mg, 1.62 mmol, 1.2 eq.) in DCM (3 mL) were added EDCI (518 mg, 2.7 mmol, 2 eq.) and DMAP (66 mg, 0.54 mmol, 0.4 eq.), followed by DIEA (697 mg, 5.4 mmol, 4 eq.). The reaction mixture was stirred at room temperature under nitrogen for 16 hours. TLC (petroleum ether / ethyl acetate = 15 / 1) showed the formation of the desired product. The reaction mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography eluted with petroleum ether / ethyl acetate (1 / 0-20 / 1) to give compound 6 (185 mg, 32%) as a colorless oil.

[0561] 4. Synthesis of SW-II-140-2

[0562] To a mixture of compound 6 (185 mg, 0.483 mmol, 1 eq.) and compound 7 (213 mg, 0.483 mmol, 1 eq.) in CPME / CH3CN (2 mL / 2 mL) were added potassium carbonate (400 mg, 2.898 mmol, 6 eq.) and potassium iodide (160 mg, 0.966 mmol, 2 eq.). After addition, the mixture was stirred at 90 ° C overnight under nitrogen. TLC (DCM / MeOH=10 / 1) showed that the reaction was complete and a new major spot was observed. The mixture was extracted with ethyl acetate and washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluted with DCM / MeOH (1 / 0-10:1, v / v) to give SW-II-140-2 (161 mg, 45%) as a yellow oil.

[0563] LCMS:Rt:1.696min;MS m / z(ELSD):744.3[M+H] + ;

[0564] HPLC: 94.658% purity, ELSD; RT = 5.938 min.

[0565] 1 H NMR (400MHz, CDCl3) δ7.22–7.03(m,4H),4.94–4.78(m,1H),4.25(t,J=7.3Hz,2H),3.70–3.54(m,2H),2.96(t,J =7.4Hz,2H),2.77–2.41(m,8H),2.28(dd,J=14.3,7.1Hz,4H),1.65–1.18(m,52H),0.91(dt,J=13.3,7.1Hz,9H).

[0566] 13 C NMR (101MHz, CDCl3) δ173.67 (d, J = 10.8Hz), 141.22 (s), 135.23 (s), 129.73 (s), 129.39 (s), 126.72 (s), 12 5.92(s),77.36(s),77.04(s),76.72(s),74.17(s),64.52(s),57.92(s),55.92(s),53.96(s),34.66(s),3 4.21(d,J=11.2Hz),33.51(s),32.44(s),31.83(d,J=9.3Hz),29.53(d,J=2.9Hz),29.14(dd,J=11.3,8.5H z), 27.12 (d, J = 4.1Hz), 26.23 (s), 25.33 (s), 25.06 (s), 24.82 (s), 22.73 (d, J = 9.9Hz), 14.08 (d, J = 8.8Hz).

[0567] Example 2 Comparison of preparations prepared with different formulas of cationic lipid M5

[0568] 2.1. Preparation of LNP-mRNA and LPP-mRNA Preparations

[0569] 2.1.1 Preparation of lipid nanoparticle (LNP-mRNA) formulation:

[0570] Preparation of mRNA aqueous solution: Luciferase mRNA (SEQ ID NO: 1) was diluted with 50 mM sodium citrate buffer (pH = 4.0) to a 0.083 mg / mL mRNA aqueous solution.

[0571] Preparation of lipid solution: According to the lipid types and lipid ratios listed in Table 1, MC3:DSPC:cholesterol:PEG-DMG were dissolved in ethanol solution at a molar ratio of 50:10:38.5:1.5 to prepare a 6 mg / mL lipid solution.

[0572] Preparation of LNPs: Using microfluidic technology (Inano D, Maiana (Shanghai) Technology Co., Ltd., model: Inano D), lipid solution and mRNA aqueous solution were mixed at an mRNA: lipid mass ratio of 1:20 under the following conditions: volume (Volume) = 4.0 mL; flow rate ratio (Flow rate ratio) = 3 (lipid solution): 1 (mRNA aqueous solution), total flow rate (Total flow rate) = 12 mL / min to obtain LNP-mRNA solution.

[0573] Centrifugal ultrafiltration: The LNP-mRNA solution was added to an ultrafiltration tube for centrifugal ultrafiltration concentration (centrifugal force 3400g, centrifugation time 60min, temperature 4°C), and the volume was adjusted to an mRNA concentration of 0.1 mg / mL to obtain the LNP-mRNA preparation numbered MC3.

[0574] 2.1.2 Preparation of lipid polyplex (LPP-mRNA) preparation:

[0575] Preparation of mRNA aqueous solution: Luciferase mRNA (SEQ ID NO: 1) was diluted with 8 mM sodium citrate buffer (pH 4.0) to a 0.1 mg / mL mRNA aqueous solution.

[0576] Preparation of lipid solution: Dissolve each lipid in ethanol solution according to the lipid ratio listed in Table 1 to prepare a 6 mg / mL lipid solution.

[0577] Preparation of protamine sulfate solution: Dissolve protamine sulfate in nuclease-free water to prepare a protamine sulfate solution with a working concentration of 0.125 mg / mL.

[0578] Preparation of core nanoparticle solution: Using microfluidics technology, a protamine sulfate solution and an mRNA solution were mixed at a mass ratio of 1:4 under the following conditions to obtain a core nanoparticle solution composed of protamine and mRNA: volume = 4.0 mL; flow rate ratio = 5 (mRNA): 1 (protamine solution), total flow rate = 12 mL / min, start waste = 0.35 mL, end waste = 0.1 mL, room temperature.

[0579] Preparation of LPP: The core nanoparticle solution and the lipid solution were mixed twice at an mRNA:lipid mass ratio of 1:20 under the following conditions: volume = 4.0 mL, flow rate ratio = 3 (lipid solution): 1 (core nanoparticle solution), total flow rate = 12 mL / min, front waste = 0.35 mL, rear waste = 0.1 mL, room temperature to obtain LPP-mRNA solution.

[0580] Centrifugal ultrafiltration: The LPP-mRNA solution was subjected to ultrafiltration to remove ethanol (centrifugal force 2000-3000 rpm, centrifugation time 20-40 min, repeated three times, temperature 4°C), and the volume was adjusted to an mRNA concentration of 0.1 mg / mL to obtain LPP-mRNA preparations numbered A14, B11, B12, B17, B18, B19, and B23.

[0581] Table 1. Prescriptions of cationic lipid M5

[0582] In vivo luciferase expression of preparations prepared with different formulations

[0583] This example uses LPP solutions of MC3-LNP, A14, B11, B12, B17, B18, B19, and B23 prepared as in Examples 2.1.1 and 2.1.2 to detect in vivo luciferase expression in preparations prepared with different formulations. The specific detection method is as follows:

[0584] Six-week-old female Balb / C mice weighing about 20 g (Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.) were used, and 1×10 6 Mouse B-cell lymphoma A20 cells. When the tumor grows to about 300-500mm 3At 40 days of age, A20 subcutaneous tumor-bearing mice were divided into nine groups (MC3-LNP, A14, B11, B12, B17, B18, B19, and B23, four mice each). Each group received 50 μL of LPP solution containing 5 μg of luciferase mRNA via intratumoral injection. Six hours after administration, mice were intraperitoneally injected with 150 mg / kg of D-luciferin substrate. Seven minutes after substrate injection, bioluminescence was measured using a Xenogen IVIS-200 imaging system to assess luciferase mRNA expression and distribution in the mice.

[0585] Six hours after administration, the luciferase signal expression results for the preparations prepared with different formulations are shown in Figures 1A and 1B. Figure 1B shows luciferase expression in the tumor and liver, respectively, from left to right. It was observed that the LPP solutions prepared with each formulation had higher luciferase expression in the tumor than the MC3-LNP solution, indicating that the LPP solutions prepared with each formulation had higher expression efficiency in the tumor than the MC3-LNP solution.

[0586] The liver / tumor luciferase expression ratio is shown in Figure 1C. The LPP solutions prepared by each prescription have a lower liver / tumor luciferase expression ratio, which is significantly lower than that of MC3-LNP. This indicates that the LPP solutions prepared by each prescription have better tumor targeting than the MC3-LNP solution, with less expression in the liver and less hepatotoxicity.

[0587] The tumor / systemic luciferase expression ratio is shown in Figure 1D. The LPP solutions prepared by each prescription have a higher tumor / systemic luciferase expression ratio, which is significantly higher than that of MC3-LNP. This indicates that the LPP solutions prepared by each prescription have higher expression efficiency in the tumor and better tumor targeting than the MC3-LNP solution, less expression in other tissues or organs outside the tumor, and less systemic toxicity.

[0588] 2.3 Antitumor effects of preparations prepared with different prescriptions

[0589] This example uses LPP solutions containing MC3-LNP, A14, B11, B12, B17, B18, B19, and B23 containing IL-12 mRNA (SEQ ID NO: 2) prepared as in Examples 2.1.1 and 2.1.2 to test the tumor inhibition effects of preparations prepared with different formulations. The specific testing method is as follows:

[0590] Six-week-old female C57BL / 6 mice weighing approximately 20 g (Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.) were used, and each mouse was subcutaneously injected unilaterally with 1×10 6 Mouse skin melanoma B16F10 cells. When the tumor grows to about 100mm 3The B16F10 tumor-bearing mice were divided into 8 groups (PBS, A14, B11, B12, B17, B18, B19 and B23 groups, 8 mice in each group). On days 1, 4, 8 and 11, each LPP solution (50 μL) containing 5 μg of IL-12 mRNA was administered to the mice by intratumoral injection. The tumor volume of each group of B16F10 subcutaneous tumor-bearing mice on day 0 before injection was approximately 100 mm. 3 All mice were observed for 17 days starting from day 0. The body weight and tumor volume of mice were recorded and plotted on day 0, day 2, day 4, day 7, day 9, day 11, day 14 and day 17. 3 as the observation endpoint.

[0591] The changes in tumor volume of mice are shown in Figure 2A. The mice in the PBS group were killed on the 14th day because the tumor volume was too large. It was observed that on the 14th day, the tumor volume of each preparation group was significantly reduced compared with the PBS group. The tumor volume of the remaining groups of mice did not reach the observation endpoint on the 14th day and was observed until the 17th day. On the 17th day, the tumor volume of the A14 group, B11 group and B19 group was also significantly reduced compared with the B18 group and B23 group. The above results show that the preparations prepared by each prescription have a significant tumor inhibitory effect. Among them, the A14, B11 and B19 preparations have better therapeutic effects than the B18 and B23 preparations, indicating that changes in the lipid ratio in the lipid composition will affect the therapeutic effect on tumors.

[0592] The weight changes of mice are shown in FIG2B . There was no significant change in the weight of mice in each group, indicating that each preparation had no obvious toxicity, had little side effect on mice, and was highly safe.

[0593] Considering that the above experimental results show that the tumor inhibition effects of preparations prepared with other formulations are better than those of preparations B18 and B23, this example also uses another mouse tumor model, the A20 tumor-bearing mouse model, to further test the tumor inhibition effects of various preparations other than B18 and B23 to study the effect of lipid ratio on tumor inhibition. The specific detection method is as follows:

[0594] Six-week-old female Balb / C mice weighing about 20 g (Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.) were used, and 1×10 6 Mouse B cell lymphoma A20 cells. When the tumor grows to about 200mm 3The A20 tumor-bearing mice were divided into 6 groups (PBS, A14, B11, B12, B17 and B19 groups, 9 mice in each group). On days 1, 4, 8 and 11, each LPP solution (50 μL) containing 5 μg of IL-12 mRNA was administered to the mice by intratumoral injection. The tumor volume of the A20 subcutaneous tumor-bearing mice in each group on day 0 before injection was approximately 200 mm. 3 All mice were observed for 25 days starting from day 0 before injection, and the body weight and tumor volume of mice were recorded and graphed on days 0, 3, 5, 7, 9, 11, 15, 18, 22, and 25.

[0595] The changes in tumor volume in mice are shown in Figure 3A. Compared with the PBS group, the tumor volume of each formulation group was significantly reduced, among which the tumor volume of mice in the B11 group decreased most significantly, and there was no significant difference between the formulation groups. The above results show that the formulations prepared by each formulation also have significant tumor inhibition effects in A20 tumor-bearing mice. Among them, the B11 formulation has a better therapeutic effect than the formulations prepared by the other formulations, indicating that changes in the lipid ratio in the lipid composition will affect the therapeutic effect on tumors. The preferred lipid composition contains 40 mol% M5, 15 mol% DOPE, 43.5 mol% cholesterol and 1.5 mol% PEG-DMG.

[0596] The weight changes of mice are shown in FIG3B . There was no significant change in the weight of A20 tumor-bearing mice in each preparation group, indicating that each preparation had obvious toxicity, little side effect on mice, and high safety.

[0597] Example 3 Comparison of preparations prepared with different formulas of cationic lipids ALC-0315, SW-II-127 and SW-II-135-1

[0598] In this example, the preparation methods described in Examples 2.1.1 and 2.1.2 were used to prepare LPP and LNP formulations containing the cationic lipids ALC-0315, SW-II-127, and SW-II-135-1, respectively, as shown in Table 2. Luciferase signal expression in mice was tested for LNP and LPP formulations prepared with different formulations. The specific detection method is as follows:

[0599] Six-week-old female C57BL / 6 mice weighing approximately 20 g (Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.) were used, and each mouse was subcutaneously injected unilaterally with 1×10 6 Mouse skin melanoma B16F10 cells. When the tumor grows to about 450mm 3B16F10 tumor-bearing mice were divided into six groups (Groups 1-1, 1-2, 1-3, 1-4, 1-5, and 1-6, with three mice in each group). Each LPP and LNP solution (50 μL) containing 5 μg of luciferase mRNA was administered intratumorally. Six hours after administration, mice were intraperitoneally injected with 150 mg / kg of D-luciferin substrate. Seven minutes after substrate injection, bioluminescence was measured using a Xenogen IVIS-200 imaging system to assess luciferase mRNA expression and distribution in the mice.

[0600] Table 3 shows the tumor / systemic luciferase expression ratios for formulations prepared with different formulations. All formulations showed that, under the same formulation, the LPP group had a higher tumor / systemic luciferase expression ratio in mice than the LNP group. This indicates that, despite the different cationic lipids, the LPP formulation exhibited higher tumor expression efficiency, better targeting, and lower systemic toxicity than the LNP formulation under the same formulation. SW-II-135-1 had the highest tumor / systemic luciferase expression ratio, demonstrating its high tumor expression and excellent targeting, making it a preferred cationic lipid.

[0601] Table 2. Different formulations of cationic lipids ALC-0315, SW-II-127, and SW-II-135-1

[0602] Table 3. Tumor / systemic luciferase expression ratios of preparations prepared with different formulations

[0603] Example 4 Comparison of preparations prepared with different formulations of cationic lipid SW-II-127

[0604] To further investigate the lipid composition of LPP lipid compositions suitable for intratumoral injection, this example employed the preparation methods described in Examples 2.1.1 and 2.1.2 to prepare LPP and LNP formulations, as shown in Table 4, all containing SW-II-127 as the cationic lipid, with varying phospholipid and PEG types. Luciferase signal expression in mice was then measured using the different formulations. The specific assay methods are as follows:

[0605] Six-week-old female C57BL / 6 mice weighing approximately 20 g (Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.) were used, and each mouse was subcutaneously injected unilaterally with 1×10 6 Mouse skin melanoma B16F10 cells. When the tumor grows to about 450mm 3At 48 hours post-dose, B16F10 tumor-bearing mice were divided into eight groups (2-1, 2-2, 2-3, 2-4, 2-5, 2-6, 2-7, and 2-8, with three mice in each group). Each solution (50 μL) containing 5 μg of luciferase mRNA was administered via intratumoral injection. Six hours after administration, mice were intraperitoneally injected with 150 mg / kg of D-luciferin substrate. Seven minutes after substrate injection, bioluminescence was measured using a Xenogen IVIS-200 imaging system to assess luciferase mRNA expression and distribution in the mice.

[0606] Table 5 shows the tumor / systemic luciferase expression ratios for formulations prepared with different formulations. Mice in groups 2-5 and 2-7 administered with LPP formulations had higher tumor / systemic luciferase expression ratios than mice in groups 2-1 and 2-3 administered with LNP formulations of the same formulation. These results demonstrate the influence of PEG type on the expression and targeting of LPP formulations within tumors. When PEG-DMG was used, LPP formulations exhibited higher expression and superior targeting within tumors compared to LNP formulations, particularly when combined with DOPE.

[0607] Table 4. Different formulations of cationic lipids for SW-II-127

[0608] Table 5. Tumor / systemic luciferase expression ratios of preparations prepared with different formulations of cationic lipids for SW-II-127

[0609] Example 5 Comparison of preparations prepared with different formulations of cationic lipid SW-II-138-1

[0610] To further investigate the lipid ratios of LPP lipid compositions suitable for intratumoral injection, this example employed the preparation methods described in Examples 2.1.1 and 2.1.2 to prepare LPP and LNP formulations with the same lipid species and varying lipid ratios, as shown in Table 6. Luciferase signal expression in mice was then measured using the different formulations. The specific assay methods are as follows:

[0611] Six-week-old female C57BL / 6 mice weighing approximately 20 g (Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.) were used, and each mouse was subcutaneously injected unilaterally with 1×10 6 Mouse skin melanoma B16F10 cells. When the tumor grows to about 450mm 3At 48 days of age, mice were divided into 8 groups (3-1, 3-2, 3-3, 3-4, 3-5, 3-6, 3-7, and 3-8, each containing 3 mice). Each group received 50 μL of a solution prepared from each formulation containing 5 μg of luciferase mRNA via intratumoral injection. Six hours after administration, mice were intraperitoneally injected with 150 mg / kg of D-luciferin substrate. Seven minutes after substrate injection, bioluminescence was measured using a Xenogen IVIS-200 imaging system to assess luciferase mRNA expression and distribution in the mice.

[0612] Table 7 shows the tumor / whole-body luciferase expression ratios for formulations prepared with different formulations. Mice in groups 3-5 and 3-6 administered with LPP formulations had higher tumor / whole-body luciferase expression ratios than mice in groups 3-1 and 3-2 administered with LNP formulations of the same formulation. These results demonstrate the influence of lipid ratio on the expression and targeting of LPP formulations within tumors. Under the same conditions, when the molar percentage of cationic lipids is less than 50%, LPP formulations exhibit higher expression and superior targeting within tumors.

[0613] Table 6. Different formulations of cationic lipids for SW-II-138-1

[0614] Table 7. Tumor / systemic luciferase expression ratios of formulations prepared with different formulations of cationic lipid SW-II-138-1

[0615] Example 6 Preparation of human 1L-12 mRNA

[0616] 6.1 Design and Synthesis of DNA Templates

[0617] The applicant designed and synthesized an optimized DNA open reading frame (ORF) sequence encoding IL-12 (p70) (amino acid sequence of SEQ ID NO: 3). The nucleic acid IL-12 JC encoding IL-12 (p70) is shown in Table 8.

[0618] A T7 promoter sequence (SEQ ID NO: 14), a 5'-UTR sequence (SEQ ID NO: 10), and a 3'-UTR sequence (SEQ ID NO: 11) were also designed, and a Kozak sequence was included in the 5'-UTR sequence (SEQ ID NO: 10).

[0619] Then, the T7 promoter sequence, 5'-UTR sequence, DNA ORF, and 3'-UTR sequence were connected in order, and whole gene synthesis was performed using pUC57 as a vector (Suzhou Jinweizhi Biotechnology Co., Ltd.) to obtain a plasmid DNA template.

[0620] A DNA template was obtained by PCR amplification using a pair of tailing PCR primers (upstream primer (SEQ ID NO: 15): 5′TTGGACCCTCGTACAGAAGCTAATACG 3′; and downstream poly(T) long primer (SEQ ID NO: 16): 5′TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTTCCTACTCAGGCTTTATTCAAAGACCA 3′) and a high-fidelity DNA polymerase-based PCR amplification kit (Novozymes Biotech Co., Ltd.).

[0621] 6.2. In vitro transcription of mRNA from DNA templates

[0622] Using the purified PCR product prepared in Example 6.1 (Takara purification kit) as a template, a co-transcriptional capping reaction was performed by T7 RNA polymerase to perform in vitro transcription of RNA to produce Cap1 mRNA. 1-Methyl-pseudouridine triphosphate was used instead of uridine triphosphate (UTP) during in vitro transcription. Therefore, the modification ratio of 1-methyl-pseudouridine in the in vitro transcribed Cap1 mRNA was 100%. After transcription, the DNA template was digested with DNaseI (Thermo Fisher Scientific) to reduce the risk of residual DNA template.

[0623] mRNA was purified using Dynabeads Myone (Thermo Fisher Scientific). The purified mRNA was dissolved in 1 mM sodium citrate buffer (pH 6.5 ± 0.1), sterile filtered, and stored frozen at -80°C until use. The obtained mRNA sequence is shown in Table 8.

[0624] Table 8. Sequence of nucleic acid IL-12 JC

[0625] Based on the above method, the applicant also designed and synthesized a non-expression control nucleic acid sequence by base deletion and mutation of the optimized DNA open reading frame (ORF) sequence encoding IL-12 (p70), which does not express IL-12 (see SEQ ID NOs: 18, 19, 20, and 21 for the corresponding nucleic acid sequences).

[0626] Example 7 Preparation of mRNA vaccine formulation

[0627] Preparation of mRNA aqueous solution: Dilute the IL-12JC mRNA prepared as in Example 6.2 with 10 mM citric acid-sodium citrate buffer (pH 4.0) to a 0.2 mg / mL mRNA solution.

[0628] Preparation of lipid solution: cationic lipid (M5): DOPE: cholesterol: mPEG2000-DMG were dissolved in anhydrous ethanol at a molar ratio of 40:15:43.5:1.5 to prepare a 10 mg / mL lipid solution.

[0629] Preparation of protamine sulfate solution: Dissolve protamine sulfate in nuclease-free water to prepare a protamine sulfate solution with a working concentration of 0.25 mg / mL.

[0630] Preparation of core nanoparticle solution: Using microfluidic technology (Maianna (Shanghai) Technology Co., Ltd., model: Inano D), the protamine sulfate solution and the mRNA solution were mixed under the following conditions to obtain a core nanoparticle solution formed by protamine and mRNA: volume = 4.0 mL; flow rate ratio = 5 (mRNA): 1 (protamine solution), total flow rate = 12 mL / min, start waste = 0.35 mL, end waste = 0.1 mL, room temperature.

[0631] Preparation of LPP: The core nanoparticle solution and the lipid solution were mixed twice under the following conditions: volume = 4.0 mL, flow rate ratio = 1 (lipid solution): 3 (core nanoparticle solution), total flow rate = 12 mL / min, front waste = 0.35 mL, rear waste = 0.1 mL, room temperature, diluted with PBS to obtain LPP solution.

[0632] Centrifugal ultrafiltration: The LPP solution was subjected to 2-3 ultrafiltration centrifugations to remove ethanol (speed 3000 rpm, centrifugation time 30 min, temperature 4°C). The ultrafiltrate was a 9% sucrose solution, and the LPP preparation SW0715 containing IL-12 JC mRNA was obtained.

[0633] In addition, LPP preparation SW0715-N containing a non-expressed control mRNA sequence was prepared using the same preparation method as a control.

[0634] Example 8 Expression of SW0715 in A375 tumor-bearing mice

[0635] This example uses the LPP preparation SW0715 containing IL-12 JC mRNA prepared as in Example 7 to detect its expression in vivo. The specific detection method is as follows:

[0636] Female BALB / c nude mice (Shanghai Lingchang Biotechnology Co., Ltd.) aged 6-8 weeks and weighing approximately 18-22 g were used. Human malignant melanoma A375 cells (Cell Bank, Chinese Academy of Sciences) were injected subcutaneously into each mouse. 3 The A375 tumor-bearing mice were divided into three groups (SW0715 5 μg group, SW0715 0.5 μg group and SW0715-N group, with 15 mice in each of the SW0715 5 μg group and the SW0715 0.5 μg group, and 3 mice in the SW0715-N group). The mice were administered a single injection of SW0715 containing 5 μg IL-12 JC mRNA, SW0715 containing 0.5 μg IL-12 JC mRNA, and SW0715-N containing 5 μg non-expressing control mRNA (50 μL each) by intratumoral injection. Mouse serum and tumor tissues were collected 6, 24, 48, 96, and 144 hours after administration, and the serum IL-12 (p70) content was detected using a human IL-12 (p70) ELISA kit (Human IL12 p70 DuoSet ELISA KIT, catalog number: DY1270-05, supplier: R&D Systems) to detect the expression of SW0715 in vivo (the immunization procedure is shown in Figure 4).

[0637] The ELISA (enzyme-linked immunosorbent assay) assay for IL-12 (p70) was performed as follows: Briefly, a 96-well plate (100 mL / well) was coated overnight with human IL-12p70 capture antibody diluted in PBS according to the manufacturer's instructions. The next day, the wells were aspirated and the plate washed three times. The plate was blocked with diluent (1% BSA in PBS) for 1 hour (300 mL / well), after which the wells were aspirated and the plate washed three times. The diluent was added to the blank wells (100 mL / well), and samples or standards of varying concentrations were added to the remaining wells (100 mL / well). The plates were mixed, covered with a film sealer, and incubated at room temperature for 2 hours. After 2 hours, the wells were aspirated and the plate washed three times. Subsequently, the detection antibody was added to each well (100 mL / well), mixed, covered with a film sealer, and incubated at room temperature for 2 hours. After 2 hours, the wells were aspirated and the plate washed three times. Then, add 100 mL of Streptavidin-HRP working solution to each well, mix thoroughly, and incubate the plate at room temperature for 20 minutes. After 20 minutes, aspirate the solution and wash the plate three times. Finally, add 100 mL of chromogenic substrate (TMB) to each well and incubate the plate at room temperature in the dark for 20 minutes. Then, add 50 mL of reaction stop solution to each well, mix thoroughly, and immediately measure the OD450 value. Calculate the IL-12 (p70) content in each sample using the standard curve.

[0638] The experimental results are shown in Figure 4. The IL-12 JC mRNA contained in SW0715 is highly expressed in vivo and the expressed IL-12 (p70) has a long half-life. The IL-12 (p70) content expressed in the serum of mice in the SW0715 5 μg group was still much higher than that in the negative control group (SW0715-N) 144 hours after administration.

[0639] Example 9 Expression of SW0715 in vitro

[0640] To evaluate the expression of SW0715 in vitro, the applicant transfected different amounts of SW0715 into cells and detected the level of human IL-12 (p70) in the cells. The specific detection method is described below.

[0641] A375 cells and human breast cancer cells MDA-MB-231 (Cell Bank, Chinese Academy of Sciences) were cultured at 6×10 5 Cells / well were seeded in a 96-well plate. 18 hours after seeding, LPP preparation SW0715 containing 2.5 μg IL-12 JC mRNA and SW0715-N containing 2.5 μg non-expressing control mRNA were added to A375 cells and MDA-MB-231, respectively. The transfected cells were placed in a cell culture incubator and cultured for 24 hours at 37°C 5% CO2. The cell supernatant was collected and the human IL-12 (p70) ELISA kit (ELISA Human IL12 p70 DuoSet ELISA KIT, catalog number: DY1270-05, supplier: R&D Systems) was used to detect the level of human IL-12 (p70) in the cells according to the manufacturer's instructions. For specific operation methods, see Example 8.

[0642] The test results are shown in Figure 5. With increasing dosage, the level of human IL-12 (p70) expressed by SW0715 gradually increased in both A375 and MDA-MB-231 cells, demonstrating that the in vitro expression of SW0715 is dose-dependent. The ELISA results for SW0715-N were below the limit of quantification and are not shown in the figure.

[0643] Example 10 Cellular immune response induced by SW0715

[0644] This example uses the LPP preparation SW0715 containing IL-12 JC mRNA prepared as in Example 7 to detect the cellular immune response induced by it. Specifically, it is tested whether the expression product of SW0715 can activate CD8 + T cells. The specific detection method is as follows:

[0645] A375 cells were cultured at 6 × 105 Cells were seeded per well in a 96-well plate. Eighteen hours after seeding, the LPP formulation SW0715 containing 2.5 μg of IL-12 JC mRNA and the LPP formulation SW0715-N containing 2.5 μg of a non-expressing control mRNA were added to the A375 cells. The transfected cells were cultured in a cell culture incubator at 37°C and 5% CO₂ for 48 hours, after which the cell supernatant was collected for analysis.

[0646] Human peripheral blood mononuclear cells (PBMC) were sorted and isolated using magnetic beads (CD8 MicroBeads, human, Miltenyi Biotec, catalog number: 130-045-201). + Based on baseline stimulation (1 μg / mL phytohemagglutinin-L (PHA-L) stimulation, Phytohemagglutinin-L Solution. Invitrogen, Cat. No. 00-4977-03), CD8 T cells were stimulated with the supernatant of cells treated with SW0715 or with the supernatant of cells treated with SW0715-N (as a control). + T cells were treated with 1 μg / mL of IFN-γ (stimulating concentration). After 48 hours of incubation, cell supernatants were collected and assayed for IFN-γ levels using a human IFN-γ Precoated ELISA kit (Dayou, Cat. No. 1110002) according to the manufacturer's instructions. Briefly, the assay plates were removed from their sealed bags, which had been equilibrated to room temperature. Dilution Buffer R (100 mL / well) was added to the blank wells, and samples or standards of varying concentrations (100 mL / well) were added to the remaining corresponding wells. Subsequently, biotinylated antibody working solution (50 mL / well) was added to each well. After mixing, the plates were covered with a film sealer and incubated at room temperature for 2 hours. The plates were then washed three times after 2 hours. Streptavidin-HRP working solution (100 mL / well) was then added to each well, mixed, covered with a film sealer, and the plates were incubated at room temperature for 20 minutes. The plates were then washed three times. Finally, 100 mL / well of chromogenic substrate (TMB) was added, the plate was incubated in the dark at room temperature for 15 minutes, and then 100 mL / well of reaction stop solution was added. After mixing, the OD450 value was measured immediately. The IFN-γ content in each sample was calculated according to the standard curve. The negative control was the supernatant of cells treated with SW0715-N, and the positive control was recombinant human IL-12 protein (rhIL12, synthesized by Sino Biological, the amino acid sequence of which is shown in SEQ ID NO: 17).

[0647] The experimental results are shown in Figure 6. SW0715 can induce cellular immune responses, and its expression product can effectively activate primary CD8+ T cells in vitro.

[0648] Example 11 Tumor Inhibition Effect of SW0715

[0649] This example uses the LPP preparation SW0715 containing IL-12 JC mRNA prepared as in Example 7 to test its tumor inhibition effect. The specific detection method is as follows:

[0650] Female NCG immunodeficient mice aged 6-8 weeks and weighing about 18-22 g (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were used, and 5×10 6 Human breast cancer cells MDA-MB-231 cells; and 5 days after the inoculation of MDA-MB-231 tumor cells, human peripheral blood mononuclear cells (PBMC) (5x10 6 cells / mouse) to obtain an NCG mouse model that reconstructs the human immune system. 3 The MDA-MB-231 tumor-bearing mice were divided into four groups (SW0715 0.4 μg group, SW0715 2.0 μg group, SW0715 10.0 μg group, and SW0715-N 10.0 μg group, with 8 mice in each group). On days 0, 7, 14, and 21, each group of mice was administered SW0715 containing 0.4, 2.0, and 10.0 μg of IL-12 mRNA and SW0715-N containing 10.0 μg of non-expressing control mRNA (50 μL) by intratumoral injection. All mice were observed for 27 days starting from day 0, and the length and width of the tumor were measured twice a week using a vernier caliper. The tumor volume was calculated as V = 0.5 × a × b 2 , a, b represent the long diameter and wide diameter of the tumor, respectively. All data were analyzed using GraphPad and expressed as mean ± standard error of the mean (mean ± SEM). One-way ANOVA LSD (L) test was used in GraphPad to compare the differences between the experimental and control groups. A p < 0.05 was considered significant.

[0651] The changes in tumor volume of mice are shown in Figure 7. On day 27 after administration, the average tumor volume of the SW0715-N control group was 652.63±45.31mm 3 The average tumor volumes of mice in the SW0715 0.4 μg, SW0715 2.0 μg, and SW0715 10.0 μg groups were 347.61 ± 19.12 mm 3 、345.74±28.81mm 3 、307.42±12.70mm 3As can be seen, the tumor volumes of mice in the SW0715 0.4μg, SW0715 2.0μg, and SW0715 10.0μg groups were significantly reduced compared to the SW0715-N 10.0μg group. Furthermore, the growth trend of tumor volume in the SW0715 0.4μg, SW0715 2.0μg, and SW0715 10.0μg groups was significantly slower than that in the SW0715-N 10.0μg group. The lowest dose of SW0715, 0.4μg, achieved a significant tumor-suppressing effect, while the highest dose of SW0715, 10.0μg, showed the best tumor-suppressing effect.

[0652] Although the present invention has been disclosed above with reference to preferred embodiments, this is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

[0653] Sequence Listing

Claims

1. A lipid composition comprising a therapeutic agent or a prophylactic agent and a lipid encapsulating the therapeutic agent or the prophylactic agent, wherein the lipid encapsulating the therapeutic agent or the prophylactic agent comprises a cationic lipid, a phospholipid, a steroid and a polyethylene glycol-modified lipid; the composition further comprises a cationic polymer, wherein the cationic polymer and the therapeutic agent or the prophylactic agent are associated as a complex and are co-encapsulated in the lipid to form a lipid multimer complex; wherein the cationic lipid comprises a lipid compound of formula (I), or a pharmaceutically acceptable salt thereof, in, R1 and R2 are each independently selected from C1-C 12 Alkyl and C2-C 12 alkenyl; R3 and R4 are each independently selected from C1-C 12 Alkyl, C2-C 12 Alkenyl, C6-C 10 Aryl and 5-10 membered heteroaryl; R3 and R4 are each independently optionally substituted by t R6, where t is an integer selected from 1-5; R6 are each independently selected from C1-C 12 Alkyl and C2-C 12 alkenyl; M1 and M2 are each independently selected from -OC(O)-, -C(O)O-, -SC(S)-, and -C(S)S-; R5 is selected from -C1- 12 Alkylene-Q, Q is selected from -OR7 and -SR7, R7 is independently selected from H, C1-C 12 Alkyl, C2-C 12 Alkenyl, C1-C 12 Alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C6-C 10 Aryl and 5-10 membered heteroaryl; m and n are each independently an integer selected from 1-12.

2. The lipid composition of claim 1, wherein the therapeutic or prophylactic agent is a nucleic acid, such as RNA, particularly mRNA.

3. The lipid composition of claim 1 or 2, wherein the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof:

4. The lipid composition according to claim 1 or 2, wherein At least one of R3 and R4 is C6-C 10 aryl or 5-10 membered heteroaryl.

5. The lipid composition of claim 4, wherein R1 and R2 are each independently selected from C1-C 12 alkyl.

6. The lipid composition of claim 4 or 5, wherein R3 and R4 are each independently selected from C1-C 12 Alkyl and C6-C 10 aryl; The condition is that one of R3 and R4 is C6-C 10 Aryl, the other is C1-C 12 alkyl; R3 and R4 are each independently substituted by t R6, where t is an integer selected from 1-3; R6 are each independently selected from C1-C 12 alkyl.

7. The lipid composition according to any one of claims 4 to 6, wherein M1 and M2 are each independently selected from: -OC(O)- and -C(O)O-.

8. The lipid composition according to any one of claims 4 to 7, wherein R5 is selected from -C 1-5 Alkylene-Q, Q is -OH.

9. The lipid composition according to any one of claims 4 to 8, wherein m and n are each independently an integer selected from 2-7.

10. The lipid composition according to any one of claims 4 to 9, wherein R4 is substituted at the first or last position of R2; and / or R3 is substituted at the first or last position of R1.

11. The lipid composition according to any one of claims 4 to 10, wherein t is 1 or 2, and R6 is substituted at the meta and / or para position relative to R1 or R2 on the benzene ring.

12. The lipid composition according to any one of claims 4 to 11, wherein t is 1 or 2, and R6 is independently selected from C1-C 10 alkyl.

13. The lipid composition of any one of claims 4 to 12, wherein the cationic lipid comprises a compound of formula (II), or a pharmaceutically acceptable salt thereof: wherein R1, R2, R4, R5, R6, M1, M2, t, m and n are as defined in any one of claims 4 to 12; Preferably, in formula (II) R1 is selected from C1-C6 alkyl; R2 is selected from C1-C 10 alkyl; R4 is selected from C1-C 10 alkyl; M1 and M2 are each independently selected from: -OC(O)- and -C(O)O-; R5 is selected from -C 1-5 Alkylene-Q, Q is selected from -OR7 and -SR7, R7 is independently selected from H, C1-C 12 Alkyl and C2-C 12 alkenyl; m and n are each independently an integer selected from 2-9; t is an integer selected from 1-3; R6 are each independently selected from C1-C 12 Alkyl and C2-C 12 Alkenyl.

14. The lipid composition of any one of claims 4 to 12, wherein the cationic lipid comprises a compound of formula (III), or a pharmaceutically acceptable salt thereof: wherein R1, R2, R4, R5, R6, t, m and n are as defined in any one of claims 4 to 12; Preferably, in formula (III), R1 is selected from C1-C6 alkyl; R2 is selected from C1-C 10 alkyl; R4 is selected from C1-C 10 alkyl; R5 is selected from -C 1-3 Alkylene-Q, Q is selected from -OH and -SH; t is 1 or 2; R6 is selected from C1-C 12 Alkyl and C2-C 12 alkenyl; m and n are each independently an integer selected from 2-7.

15. The lipid composition of any one of claims 4-12, wherein the cationic lipid comprises a compound of formula (IV), or a pharmaceutically acceptable salt thereof: wherein R1, R2, R4, R6, t, m and n are as defined in any one of claims 4 to 12; Preferably, in formula (IV), R1 is selected from C1-C6 alkyl; R2 is selected from C1-C 10 alkyl; R4 is selected from C1-C 10 alkyl; t is 1 or 2; R6 are each independently selected from C1-C 12 Alkyl and C2-C 12 alkenyl; m and n are each independently an integer selected from 2-7.

16. The lipid composition of claim 4, wherein the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof: Preferably, the cationic lipid is SW-II-127, SW-II-135-1 or SW-II-138-1.

17. The lipid composition of any one of claims 1 to 16, wherein the phospholipids comprise 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diondecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl Phosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), or a combination thereof; DSPC, DOPE or a combination thereof is preferred.

18. The lipid composition of claim 17, wherein the steroid comprises cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol and derivatives thereof; preferably, the steroid is cholesterol.

19. The lipid composition of claim 18, wherein the polyethylene glycol-modified lipid comprises 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-dioleoyl-rac-glycero, methoxy-polyethylene glycol (DOGPEG)) and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG); preferably DSPE-PEG, DMG-PEG or a combination thereof.

20. The lipid composition of claim 19, comprising 10-70 mol% cationic lipid, 10-70 mol% phospholipid, 10-70 mol% steroid and 0.05-20 mol% polyethylene glycol-modified lipid; Preferably comprising 30-45 mol% of cationic lipids, 10-20 mol% of phospholipids, 30-48.5 mol% of steroids and 1-1.5 mol% of polyethylene glycol-modified lipids; and / or cationic lipids, DOPE, cholesterol, and DMG-PEG; Preferably, it comprises 40% cationic lipid, 15% DOPE, 43.5% cholesterol and 1.5% DMG-PEG.

21. The lipid composition of claim 20, wherein the cationic polymer comprises poly-L-lysine, protamine, polyethyleneimine (PEI) or a combination thereof; preferably, the cationic polymer is protamine.

22. The lipid composition of any one of claims 1 to 21, wherein the therapeutic or prophylactic agent is a polynucleotide comprising a coding region encoding IL-12, wherein The IL-12 comprises the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 3; and wherein the polynucleotide is RNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 85% identical to the nucleotide sequence of SEQ ID NO: 4; or The polynucleotide is a DNA, wherein the coding region comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having at least 85% identity to the nucleotide sequence of SEQ ID NO:

5.

23. The lipid composition of claim 22, wherein the polynucleotide further comprises a 5'-UTR; and / or the polynucleotide further comprises a 3'-UTR; Preferably, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 8; and / or the 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 9; or The 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 10; and / or the 3'-UTR comprises the nucleotide sequence of SEQ ID NO:

11.

24. The lipid composition of claim 22 or 23, wherein the polynucleotide further comprises a poly(A) sequence; Preferably, the poly(A) sequence comprises the nucleotide sequence of SEQ ID NO: 12; or The poly(A) sequence comprises the nucleotide sequence of SEQ ID NO:

13.

25. The lipid composition of any one of claims 22-24, wherein The polynucleotide is RNA, comprising the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence having at least 85% identity with the nucleotide sequence of SEQ ID NO: 6; or The polynucleotide is a DNA comprising the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence having at least 85% identity with the nucleotide sequence of SEQ ID NO:

7.

26. A pharmaceutical composition comprising the lipid composition of any one of claims 1 to 25, and optionally a pharmaceutically acceptable excipient.

27. The lipid composition of any one of claims 1 to 25 or the pharmaceutical composition of claim 26 for use in tumor administration; The tumor administration preferably includes intratumoral administration, subcutaneous administration around the tumor, or administration into the artery that supplies blood to the tumor, and most preferably intratumoral injection.

28. Use of the lipid composition of any one of claims 1-25 or 27 or the pharmaceutical composition of claim 26 or 27 in the preparation of a medicament for treating cancer; preferably, the cancer is a solid tumor or a hematological tumor.

29. The use of claim 28, wherein the cancer is a cancer characterized by lost or aberrant protein or polypeptide activity.

30. The use of claim 28 or 29, wherein The solid tumor comprises squamous cell carcinoma, adenocarcinoma, basal cell carcinoma, renal cell carcinoma, mammary duct carcinoma, soft tissue sarcoma, osteosarcoma, melanoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, pancreatic cancer, neuroendocrine cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, brain cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial cancer or uterine cancer, esophageal cancer, salivary gland cancer, kidney cancer, liver cancer, prostate cancer, vulvar cancer, thyroid cancer or head and neck cancer; The blood tumor includes leukemia, lymphoma, myeloma, acute myeloid leukemia, chronic myeloid leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma or multiple myeloma.

31. A method of delivering a therapeutic or prophylactic agent to a mammalian tumor in a subject, the method comprising administering to the subject the lipid composition of any one of claims 1-25 or 27 or the pharmaceutical composition of claim 26 or 27, wherein the administering comprises contacting the tumor with the lipid composition or the pharmaceutical composition, thereby delivering the therapeutic or prophylactic agent to the tumor.

32. A method for producing a target polypeptide in a mammalian tumor in a subject, the method comprising contacting the tumor with a lipid composition of any one of claims 1-25 or 27 or a pharmaceutical composition of claim 26 or 27, wherein the therapeutic or prophylactic agent is mRNA, and wherein the mRNA encodes the target polypeptide, whereby the mRNA can be translated in the tumor to produce the target polypeptide.

33. An intratumor injection comprising the lipid composition according to any one of claims 1 to 25 and a pharmaceutically acceptable excipient for injection.

Images