Human t cell receptor pairs responsive to HLA-A*02: 01 restrictive human prostate acid phosphatase (PAP) epitopes

Abstract

Aspects of the present disclosure relate to methods and compositions related to the preparation of immune cells, including engineered T cells having T cell receptors targeting human prostate acid phosphatase (PAP) and useful in prostate cancer therapy.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of co-pending and commonly assigned U.S. Provisional Patent Application No. 63 / 315,825, filed March 2, 2022, entitled “HUMAN T CELL RECEPTOR PAIR REACTIVE WITH HLA-A*02:01 RESTRICTED HUMAN PROSTATIC ACID PHOSPHATASE (PAP) EPITOPE,” under 35 U.S.C. § 119(e), which is incorporated herein by reference.

[0003] Statement Regarding Federal Funding

[0004] This invention was made with government support under Grant No. CA009120 awarded by the National Institutes of Health. The government has certain rights in this invention. Technical Field

[0005] Embodiments of the present disclosure relate to at least the fields of immunology, cell biology, molecular biology, and medicine. Background Art

[0006] Prostate cancer is a disease that develops when prostate cells mutate and begin to multiply uncontrollably. Currently, prostate cancer is the second most commonly diagnosed cancer and the fourth leading cause of cancer-related deaths among men in developed countries worldwide.

[0007] Compared with normal counterparts, it has been shown that typical antigens overexpressed by prostate cancer cells include proteins, such as prostatic acid phosphatase (PAP), prostate specific antigen (PSA), prostate specific membrane antigen (PSMA) and prostate stem cell antigen (PSCA). Prostate cancer cells can spread (metastasis) from the prostate to other parts of the body, especially bones and lymph nodes. Prostate cancer can cause pain, dysuria, erectile dysfunction and other symptoms. Usually, prostate cancer develops most frequently in men over the age of 50, representing the most common patient population. However, even if it is determined to be possible, prostate cancer is still often undiscovered. Prostate cancer is determined usually by physical examination or by screening blood tests, such as PSA (prostate specific antigen) test. When suspected prostate cancer, usually by removing a piece of prostate (biopsy) and checking under a microscope to confirm cancer. Further tests can be performed, such as X-rays and bone scans, to determine whether prostate cancer has spread.

[0008] The treatment of prostate cancer is still an unresolved challenge. Conventional therapy methods can be applied to treat prostate cancer, such as surgery, radiotherapy, hormone therapy, occasional chemotherapy, proton therapy or some combinations of these. However, the age and potential health of the men and the degree of diffusion, microscopic outward appearance and the reaction of the cancer to the initial treatment are important for determining the result of the disease. Because prostate cancer is a disease diagnosed usually in elderly men, before the cancer in slow progress can spread or cause symptoms, many people will die from other reasons. This makes the treatment selection difficult. Whether deciding to treat localized prostate cancer (the tumor included in the prostate) with the intention of curing is a trade-off between the beneficial and harmful effects expected in terms of patient survival and quality of life.

[0009] As is known in the art, the immune system plays an important role in the treatment and prevention of many diseases. According to current knowledge, mammals provide various mechanisms to protect the organism by recognizing and killing, for example, tumor cells. For the purposes of the present invention, these tumor cells must be detected and distinguished from the normal (healthy) cells and tissues of the organism.

[0010] It is an object of the present invention to provide compositions and methods useful for treating prostate cancer (PCa). SUMMARY OF THE INVENTION

[0012] Prostatic acid phosphatase (PAP) is a well-known prostate / prostate cancer antigen and a potential target for cancer therapy. As described herein, an HLA-A*02:01-restricted PAP epitope was identified using a variety of physical methods coupled to liquid chromatography-mass spectrometry (LC-MS), including weak acid elution, immunoprecipitation, and secreted MHC IP using the ARTEMIS platform. The recovered PAP epitope was then used to stimulate peripheral mononuclear cells (PBMCs) from over 20 healthy donors. Responsive T cells, isolated using recently developed CLInt-seq and TCRα / β sequencing technologies, were analyzed using 10X Genomics single-cell TCR sequencing. Polynucleotides encoding paired TCRα / β chains were then introduced into normal human T cells and tested for functionality. Using this approach, we discovered 21 TCRα / β peptide pairs that specifically recognized and were activated by seven different PAP peptides. All 21 TCRs showed reactivity when screened against Jurkat-NFAT-GFP cells and peptide-pulsed K562-A2 cells. Of these 21 TCRs, at least seven could be specifically stained with homotetramers. These seven candidate TCRs could be successfully paired and stimulated in human T cells. When co-cultured with cells expressing both HLA-A2 and full-length PAP, at least one TCR (PAP-TCR-156) exhibited significant IFNγ signaling and inhibited target cell growth. The discovery of these PAP epitopes and cognate TCR sequences could be used for new cancer immunotherapies and vaccines.

[0013] The invention disclosed herein has multiple embodiments utilizing the above findings. Embodiments of the invention include, for example, a composition of matter comprising a polynucleotide encoding a T cell receptor (TCR) alpha chain polypeptide and / or a TCR beta chain polypeptide; wherein when transduced into a CD8 + When expressed in T cells, the α chain polypeptide and / or TCR β chain polypeptide can form a T cell receptor that recognizes / binds to a polypeptide epitope on human prostatic acid phosphatase (PAP). In typical embodiments of the present invention, the polynucleotide is placed in a vector comprising one or more regulatory sequences, etc., for expressing the polypeptide in a cell. Embodiments of the present invention also include cells (e.g., CD8 + T cells).

[0014] In certain embodiments of the present invention, a T cell receptor that recognizes / binds to PAP targets at least one polypeptide epitope selected from the group consisting of ILLWQPIPV (SEQ ID NO: 47), TLMSAMTNL (SEQ ID NO: 48), IRSTDVDRTL (SEQ ID NO: 52), IMYSAHDTTV (SEQ ID NO: 55), KVYDPLYCESV (SEQ ID NO: 58), LLLARAASLSL (SEQ ID NO: 59), and LLFFWLDRSVLA (SEQ ID NO: 62). In some embodiments of the present invention, a T cell receptor that recognizes / binds to PAP recognizes / binds to an HLA-A*02:01 restricted epitope. In some embodiments of the present invention, a polynucleotide encoding a T cell receptor (TCR) alpha chain polypeptide or a TCR beta chain polypeptide (e.g., a TCR encoded by SEQ ID NO: 1-SEQ ID NO: 42) is engineered to introduce one or more mutations into the selected TCR polypeptide that provide the TCR with increased target killing sensitivity, typically while maintaining physiological affinity (e.g., a capture key mutation). In certain embodiments of the present invention, the polynucleotide encoding a T cell receptor (TCR) α chain polypeptide or a TCR β chain polypeptide encodes a segment of at least 5 or at least 10 amino acids of the αV region polypeptide sequence and / or βV region polypeptide sequence shown in Table A and / or Table B.

[0015] Embodiments of the present invention also include methods for inhibiting the growth of prostate cancer cells. Generally, these methods comprise inoculating prostate cancer cells with a CD8 T cell receptor (TCR) transduced with a polynucleotide encoding a T cell receptor (TCR) α chain polypeptide and a TCR β chain polypeptide. + T cell combination; when transduced into CD8 + When expressed in a T cell, the α chain polypeptide and the TCR β chain polypeptide can form a T cell receptor that recognizes / binds to a polypeptide epitope on human prostatic acid phosphatase (PAP). In certain embodiments of the present invention, the polynucleotide encoding the T cell receptor (TCR) α chain polypeptide or TCR β chain polypeptide encodes the α CDR3 region polypeptide sequence and / or the β V region polypeptide sequence shown in Table A; and / or the polynucleotide is one shown in Table B. Typically, in these methods, the polynucleotide encoding the TCR α / β polypeptide pair is transduced into a CD8 + T cells, which are then combined with prostate cancer cells in vivo to treat individuals with prostate cancer.

[0016] Embodiments of the present invention also include methods for assessing a patient's immune response to prostate cancer or prostate cancer vaccination. Typically, these methods include observing the induction or activation of T cells obtained from a patient suffering from prostate cancer or with prostate cancer vaccination, wherein the induction or activation of T cells is observed in response to the exposure of T cells to polypeptide epitopes present on human prostatic acid phosphatase (PAP); and the induction or activation of observed T cells provides evidence of the patient's immune response to prostate cancer or prostate cancer vaccination. Related embodiments of the present invention include methods for assessing a patient's immune response to prostate cancer or prostate cancer vaccination. Typically, these methods include observing TCR polypeptide sequences disclosed herein or the presence of relevant TCR polypeptide sequences obtained from a patient suffering from prostate cancer or with prostate cancer vaccination, wherein the presence of TCR polypeptide sequences disclosed herein or relevant TCR polypeptide sequences demonstrates the patient's immune response to prostate cancer or prostate cancer vaccination. Yet another embodiment of the present invention is a method for producing a peptide-MHC multimer composition that can be used to evaluate a patient's T cell response to prostate cancer or prostate cancer vaccination, the method comprising combining or conjugating at least one polypeptide epitope present on human prostatic acid phosphatase (PAP) with an MHC multimer (e.g., an oligomeric form of an MHC molecule) to prepare the peptide-MHC multimer composition.

[0017] From the following detailed description, other objects, features and advantages of the present invention will become apparent to those skilled in the art. However, it should be understood that while indicating some embodiments of the present invention, the detailed description and specific examples are provided by way of illustration and non-restriction. Without departing from the spirit of the present invention, many changes and modifications can be made within the scope of the present invention, and the present invention includes all such modifications. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Figure 1: Overall project flow chart and summary of the TCR screening process. (Left) Both monoallelic and multiallelic HLA A0201 cell lines were treated with three different physical methods to extract peptides on MHC class I. The sequences of these peptides were then determined by LC-MS, yielding 27 different PAP epitopes. (Right) The peptides were then screened on PBMCs from >20 individuals, and reactive clones were identified using the CLint-seq protocol (see, e.g., Utility Model: PCT Application Serial No. PCT / US20 / 49055, incorporated herein by reference).

[0020] Figure 2 A-2B: Schematic diagram and data from a T2 stabilization assay designed to assess peptide-MHC I stability. Figure 2 (a) Schematic diagram of the overall process of T2 determination; Figure 2 (b) Graphical data showing the slope of the natural logarithm of A2 fluorescence intensity versus diluted peptide concentration for various PAP peptides. Figure 2 Positive candidates in the T2 assay shown in B were PAP-A2-14, PAP-A2-20, PAP-A2-21, PAP-A2-22, PAP-A2-25, and PAP-A2-27.

[0021] Figure 3 : Schematic diagram and data from studies using the secreted form A of the MHC I single-chain trimer to assess peptide-MHC stability. Figure 3 (a) Schematic diagram of the SCT construct; Figure 3 (b) SDS-PAGE gel results of the relative production of each PAPSCT compared to the positive control (+) WT1 peptide RMFPNAPYL.

[0022] Figure 4 : Schematic diagram and data from studies testing candidate TCRs in Jurkat-NFAT-GFP for rapid screening. Figure 4 (a) Schematic diagram of the Jurkat-NFAT-GFP system for TCR screening. Figure 4 (b) Example of FACS results of Jurkat-NFAT-GFP screening (TCR-218); top: DMSO as a negative control with TCR-218; bottom: PAP-A2-21 as a positive hit with TCR-218.

[0023] Figure 5 : Data from functional testing of candidate TCRs observed using various methods. Figure 5 (a) IFNγ results on PBMCs of different TCR constructs with peptide dilutions; F5: positive control against MART1 peptide (EAAGIGILTV); NGFR: negative control with DMSO. Figure 5 (b) IFNγ results of candidate TCR constructs on PBMCs from cell lines with or without full-length PAP; black bars: PBMCs TCR-engineered with K562-A2; gray bars: PBMCs TCR-engineered with K562-A2-PAP. Figure 5 (c) Cytotoxicity curves of TCR-156 by incucyte using the total GFP signal of target cells to quantify the number of target cells; blue: K562-A2 target cells of PBMCs engineered with TCR-156; red: K562-A2-PAP target cells of PBMCs engineered with TCR-156.

[0024] Figures 6A-6D: Data from functional testing of TCR mutants observed using various methods. Figure 6A Data from studies of PAP-TCR-156 mutants are presented (see Table B) and show that introduction of substitution mutations can enhance the potency of TCRs such as PAP-TCR-156 without loss of specificity. Figure 6B Data from studies showing that PAP-TCR-156 mutants kill K62 A2 cells in the absence (left panel) and presence (right panel) of PAP are presented, demonstrating that the introduction of mutations can enhance the cytotoxicity of TCRs such as PAP-TCR-156 without loss of specificity. Figure 6C Presented are data from a study showing specific cytotoxicity of the PAP-TCR-156 mutant against prostate cancer cell lines overexpressing PAP and HLA-A2 (left panel: PC3 control cells, right panel: PAP-expressing PC3 cells). Figure 6D Data from studies with PAP-TCR-156 mutants are presented, demonstrating that these embodiments of the invention exhibit cytotoxicity towards PC3-A2-PAP at lower E:T ratios (4:1 ratio in the left panel and 1:1 ratio in the right panel).

[0025] Figure 7 : Data from a functional screening assay of TCR156 variants that showed enhanced function in a PAP peptide titration assay. The left panel shows data from unmutated TCR156 (wt) and TCR156 variants 156-29, 156-30, 156-31, 156-32, 156-33, and 156-34; and the right panel shows data from unmutated TCR156 (wt) and TCR156 variants 156-35, 156-36, 156-37, 156-38, and 156-39. Detailed Description of the Invention

[0027] In the description of the embodiments, reference may be made to the accompanying drawings which form a part of the present invention, and in which specific embodiments in which the present invention may be practiced are shown by way of example. It should be understood that other embodiments may be utilized and that structural changes may be made without departing from the scope of the present invention. Certain aspects of the invention disclosed below may also be found in Mao et al., Proc Natl Acad Sci USA. 2022 Aug 2; 119 (31) (hereinafter referred to as “Mao et al.”), the contents of which are incorporated herein by reference.

[0028] Prostatic acid phosphatase (PAP) is a well-known prostate / prostate cancer antigen and can serve as a target for cancer therapy (Kantoff et al., NEJM, 2010 Jul 29;363(5):411-22). The HLA-A*02:01 restricted PAP epitope was identified by using a variety of physical methods coupled with liquid chromatography mass spectrometry (LC-MS), including weak acid elution (MAE), co-immunoprecipitation (CoIP), and secreted MHC IP (sMHC IP) based on the ARTEMIS platform ( Figure 1 ), identified. A total of 27 candidate PAP peptides were identified from all three methods (Table 1 of Mao et al.). The recovered PAP epitopes were then used to stimulate peripheral mononuclear cells (PBMCs) from more than 20 healthy donors. Reactive T cells isolated by the recently developed CLInt-seq and TCRα / β sequencing technologies were analyzed by 10X Genomics single-cell TCR sequencing ( Figure 1 )(Nesterenko et al., PNAS March 30, 2021 118(13)e2100106118). Paired TCRα / β chains were then introduced into normal human T cells and tested for their functionality. We recovered 21 TCRα / β pairs from our previous study that specifically recognized 7 different PAP peptides and were activated by 7 different PAP peptides in the Jurkat-NFAT-GFP system ( Figure 2 ; Tables 2 and 3 of Mao et al.). Of these 21 TCRs, at least 7 could be specifically stained by homotetramers. These 7 candidates could successfully pair and stimulate human T cells. This knowledge of the PAP epitope and cognate TCR sequences could potentially be used to develop new cancer immunotherapies and vaccines.

[0029] Embodiments of the present invention include compositions of matter comprising one or more vectors comprising TCR polynucleotides disclosed herein. A "vector" is a combination of substances that comprises an isolated nucleic acid, and which can be used to deliver the isolated nucleic acid to the interior of a cell. Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ions or amphipathic compounds, plasmids, and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted as including non-plasmids and non-viral compounds that promote nucleic acid transfer into cells, such as polylysine compounds, liposomes, etc. Examples of viral vectors include but are not limited to Sendai virus vectors, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.

[0030] Typically, a vector is an expression vector. The term "expression" as used herein is defined as the transcription and / or translation of a specific nucleotide sequence driven by its promoter. In this context, the term "expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to the nucleotide sequence to be expressed. The expression vector comprises enough cis-acting elements for expression; other elements for expression can be provided by a host cell or an in vitro expression system. Expression vectors include all vectors known in the art, such as cosmids, plasmids (e.g., naked plasmids or plasmids contained in liposomes) and viruses (e.g., Sendai virus, lentivirus, retrovirus, adenovirus, and adeno-associated virus) incorporating recombinant polynucleotides.

[0031] Typically, the compositions of the invention comprise one or more Vα / Vβ polynucleotides, e.g., a polynucleotide encoding a TCR Vα polypeptide in combination with a polynucleotide encoding a TCR Vβ polypeptide, such that the Vα / Vβ TCR can be expressed in mammalian cells (e.g., CD8 T cells) transduced with the vector. + The term "transduced" or "transfected" or "transformed" as used herein refers to a process whereby exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transformed" or "transduced" cell is a cell that has been transfected, transformed, or transduced with an exogenous nucleic acid. Cells include primary subject cells and their progeny.

[0032] In another aspect, the invention includes a method for generating modified T cells comprising introducing one or more nucleic acids encoding a TCR disclosed herein (e.g., a nucleic acid placed in a lentiviral vector) into a T cell (e.g., a CD8 T cell obtained from an individual diagnosed with cancer). + The present invention also includes modified T cells in which gene expression is downregulated or knocked out (e.g., modified T cells having a knocked-out endogenous T cell receptor and an exogenous / introduced T cell receptor that recognizes the PAP peptide associated with HLA). As used herein, the term "knockdown" refers to a decrease in gene expression of one or more genes. As used herein, the term "knockout" refers to abolition of gene expression of one or more genes.

[0033] The modified T cells described herein may be included in a composition for a treatment regimen. The composition may include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of a pharmaceutical composition comprising modified T cells may be administered. The pharmaceutical composition of the present invention may include modified T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The compositions of the present invention are preferably formulated for intravenous administration.

[0034] Adoptive immunotherapy with T cells carrying antigen-specific TCRs has therapeutic potential in the treatment of cancer. + Genetic engineering of T cells has the advantage of redirecting T cells to selected antigens (such as PAP epitopes recognized by TCR). In this context, in one aspect, the present invention includes a method for stimulating a T cell-mediated immune response to a target cell or tissue in a subject, comprising administering to the subject an effective amount of a modified CD8 + T cells. In this embodiment, CD8 + T cells are modified as described elsewhere herein. Embodiments of the present invention also include administering multiple modified CD8 T cells targeting the PAP epitope. + For example, embodiments of the present invention include administering at least two different modified CD8 + T cells, such as first modified CD8 T cells targeting the PAP peptide associated with first human leukocyte antigen + T cells with a second CD8 T cell targeting the PAP peptide associated with a second human leukocyte antigen + T cell combination.

[0035] Embodiments of the present invention include compositions of matter comprising polynucleotides encoding T cell receptor (TCR) alpha chain polypeptides and / or TCR beta chain polypeptides; wherein the polynucleotides are placed in a vector, and when the vector is transduced into a CD8 +When expressed in a T cell, the α chain polypeptide and / or TCR β chain polypeptide encoded by the polynucleotide forms a T cell receptor that recognizes a polypeptide epitope of human prostatic acid phosphatase (PAP). In certain embodiments of the present invention, the T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase in combination with the human leukocyte antigen HLA-A*02:01. In some embodiments of the present invention, the T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase selected from the group consisting of ILLWQPIPV (SEQ ID NO: 47), TLMSAMTNL (SEQ ID NO: 48), IRSTDVDRTL (SEQ ID NO: 52), IMYSAHDTTV (SEQ ID NO: 55), KVYDPLYCESV (SEQ ID NO: 58), LLLARAASLSL (SEQ ID NO: 59), and LLFFWLDRSVLA (SEQ ID NO: 62). In certain embodiments of these compositions, the polynucleotide encodes the amino acids of the TCR variable region, and the vector comprises a vector polynucleotide encoding the TCR constant region fused in frame to the TCR variable region (see, e.g., US Patent Publication Nos. 20220354889, 20200138865, 20210363245, and 20210155941; and Coren et al., Biotechnologes. 2015 Mar 1; 58(3):135-9 (which describes addgene TM Typically in these compositions, the polynucleotide is placed in a cell (e.g., human CD8 + T cells). Optionally, for example, the polynucleotide is placed in a CD8 + In T cells, the CD8 + T cells are obtained from an individual diagnosed with a cancer expressing human prostatic acid phosphatase antigen (e.g., prostate cancer); and CD8 + T cells are transduced with a vector comprising a polynucleotide encoding a TCR Vα polypeptide in combination with a polynucleotide encoding a TCR Vβ polypeptide, such that the heterologous TCR is expressed in CD8 + The cell surface of the T cells is expressed, where the heterologous TCR recognizes human prostatic acid phosphatase peptide associated with human leukocyte antigen expressed on the cancer cell surface.

[0036] In certain compositions of the invention, the polynucleotide encodes a segment of at least 5, 10, 25, 50, or 100 amino acids of the TCR polypeptide embodiments of the invention shown in Table A or Table B below (e.g., at least 5 or 10 amino acids present in an αCDR1 polypeptide sequence, an αCDR2 polypeptide sequence, an αCDR3 polypeptide sequence, a βCDR1 polypeptide sequence, a βCDR2 polypeptide sequence, or a βCDR3 polypeptide sequence). In certain compositions of the invention, the polynucleotide encodes a segment of at least 100 amino acids having at least 98% sequence identity to the amino acids encoded by SEQ ID NO: 1-SEQ ID NO: 42. In some embodiments of the present invention, the T cell receptor (TCR) alpha chain polypeptide and / or TCR beta chain polypeptide encoded by the polynucleotide comprises an amino acid substitution mutation of a wild-type TCR amino acid sequence (e.g., SEQ ID NO: 1-SEQ ID NO: 42) selected to optimize its interaction with its cognate ligand (see, e.g., Sibener et al., Cell 174, 672–687, July 26, 2018; and Zhao et al., Science 376, 155 (2022), the contents of which are incorporated herein by reference). In illustrative examples of such mutants, the polynucleotide encodes a segment of at least 5, 10, 25, 50, or 100 amino acids encoded by SEQ ID NO: 115-SEQ ID NO: 138.

[0037] Embodiments of the present invention include methods for killing cancer cells that express a human prostatic acid phosphatase peptide associated with a human leukocyte antigen expressed on the surface of the cancer cells. For example, embodiments of the present invention include methods for inhibiting the growth of prostate cancer cells comprising contacting prostate cancer cells with a CD8 T cell receptor (TCR) transduced with a polynucleotide encoding a T cell receptor (TCR) alpha chain polypeptide and a TCR beta chain polypeptide. + T cell combination; when transduced into CD8 +When expressed in a T cell, the α chain polypeptide and the TCR β chain polypeptide can form a T cell receptor that recognizes a polypeptide epitope on human prostatic acid phosphatase (PAP) expressed on prostate cancer cells, thereby inhibiting the growth of prostate cancer cells. In certain of these embodiments, the T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase in combination with the human leukocyte antigen HLA-A*02:01. In some embodiments of the invention, the T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase selected from the group consisting of KELKFVTL (SEQ ID NO:43), FQKRLHPYK (SEQ ID NO:44), LSGLHGQDL (SEQ ID NO:45), FQKRLHPYK (SEQ ID NO:46), ILLWQPIPV (SEQ ID NO:47), TLMSAMTNL (SEQ ID NO:48), VLAKELKFV (SEQ ID NO:49), MEQHYELGEY (SEQ ID NO:50), GEYFVEMYYR (SEQ ID NO:51), IRSTDVDRTL (SEQ ID NO:52), IWSKVYDPLY (SEQ ID NO:53), SVHNFTLPSW (SEQ ID NO:54), IMYSAHDTTV (SEQ ID NO:55), DFIATLGKLSG (SEQ ID NO:56), DVYNGLLPPYA (SEQ ID NO:57), KVYDPLYCESV (SEQ ID NO:58), In certain embodiments of these methods, the CD8 +T cells are combined in vivo to treat an individual with prostate cancer. Optionally, in these methods, the polynucleotide encodes a segment of at least 100 amino acids that has at least 98% sequence identity to the amino acids encoded by SEQ ID NO: 1-SEQ ID NO: 42 (as known in the art, sequence identity is the ratio of the number of identical amino acids between two aligned sequences / segments to the length of the alignment, expressed as a percentage).

[0038] Embodiments of the present invention include methods for assessing a patient's immune response to prostate cancer or prostate cancer vaccination. Typically, these methods include observing the induction or activation of T cells obtained from a patient suffering from prostate cancer or having prostate cancer vaccination, wherein the induction or activation of the T cells is observed in response to the exposure of the T cells to a polypeptide epitope present on human prostatic acid phosphatase (PAP); and the observed induction or activation of the T cells provides evidence of the patient's immune response to prostate cancer or prostate cancer vaccination. In these methods, optionally, the T cells express a T cell receptor that recognizes a polypeptide epitope of human prostatic acid phosphatase selected from the following: ILLWQPIPV (SEQ ID NO: 47), TLMSAMTNL (SEQ ID NO: 48), IRSTDVDRTL (SEQ ID NO: 52), IMYSAHDTTV (SEQ ID NO: 55), KVYDPLYCESV (SEQ ID NO: 58), LLLARAASLSL (SEQ ID NO: 59), and LLFFWLDRSVLA (SEQ ID NO: 62).

[0039] Embodiments of the present invention encompass methods for treating diseases or conditions characterized by PAP expression. The methods of treatment comprise administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising the modified T cells described herein. The term "subject" is intended to include living organisms (e.g., mammals) in which an immune response can be elicited. As used herein, a "subject" or "patient" can be a human or a non-human mammal. Non-human mammals include, for example, livestock and pets, such as sheep, cattle, pigs, dogs, cats, and murine mammals. Preferably, the subject is a human. In typical embodiments of the invention, the human has a cancer that expresses a PAP epitope recognized by a TCR. In some embodiments of the invention, the cells of the cancer form a solid tumor. In illustrative embodiments of the invention, the cancer cells are prostate cancer cells.

[0040] Related embodiments of the present invention include methods for the prevention and / or treatment of an individual diagnosed with, suspected of having, or at risk of developing or recurring cancer, wherein the cancer comprises cancer cells expressing an APAP epitope recognized by a TCR. The method comprises administering to the individual a modified human T cell comprising a recombinant polynucleotide encoding a TCR, wherein the T cell is capable of directly recognizing cancer cells expressing an APAP epitope recognized by the TCR, and wherein the direct recognition of the cancer cell comprises HLA class II-restricted binding of the TCR to the APAP epitope recognized by the TCR expressed by the cancer cell.

[0041] Regarding the engineered CD8 + The method generally comprises administering to an individual in need thereof an effective amount (e.g., by intravenous or intraperitoneal injection) of a T cell containing CD8 + Compositions of T cells. Suitable pharmaceutical compositions can be suitable for administration by any appropriate route such as parenteral (including subcutaneous, intramuscular or intravenous), enteral (including oral or rectal), inhalation or intranasal. Such compositions can be prepared by any method known in the pharmaceutical art, for example by mixing the active ingredient with a carrier or excipient under sterile conditions.

[0042] In another aspect, the present invention includes a polynucleotide or modified CD8 + Use of T cells in the preparation of a medicament for treating a disease or condition characterized by PAP expression in a subject in need thereof. In an exemplary embodiment of the invention, the disease is a cancer expressing a PAP epitope disclosed herein, such as prostate cancer.

[0043] The technology in this field is well developed, and many methods and materials known in the art can be applied to the invention disclosed herein. Such methods and materials are disclosed, for example, in US Patent Publication Nos. 20190247432, 20190119350, 20190002523, 20190002522, 20180371050, 20180057560, 20170029483, 20160024174, and 20150141347, the contents of which are incorporated herein by reference.

[0044] Certain aspects of the present invention are disclosed in Mao et al. Proc Natl Acad Sci USA. 2022 Aug 2; 119(31):e2203410119. doi: 10.1073 / pnas.220341011, the contents of both of which are incorporated herein by reference. All publications mentioned herein (e.g., publications disclosed herein, such as Zah et al., Nature Communications volume 11, Article number: 2283 (2020) and international patent applications PCT / US19 / 49484, WO 2021 / 046121, and PCT / US2020 / 037486, and Kantoff, Phillips et al. "Sipuleucel-T Immunotherapy for Castration-Resistant Prostate Cancer." N Engl J Med 2010; 363: 411-422; Fong, Lawrence et al. "Dendritic cell-based xenoantigen vaccination for prostate cancer immunotherapy." J Immunol 2001; 167(12)7150-7156; and Nesterenko, Pavlo et al. "Droplet-based mRNA sequencing of fixed and permeabilized cells by CLInt-seq allows for antigen-specific TCR cloning." PNAS 2021; 118(3)) is incorporated by reference to disclose and describe aspects, methods and / or materials related to the cited disclosure. Many of the techniques and procedures described or cited herein are well understood and commonly used by those skilled in the art. Unless otherwise defined, all technical terms, symbols, and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those skilled in the art to which the invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or ease of reference, and the inclusion of such definitions herein should not necessarily be construed as representing a substantial difference relative to what is generally understood in the art. Example

[0045] Example 1: Physical and in silico immunopeptidomic profiling of the cancer antigen prostatic acid phosphatase reveals targets enabling TCR isolation

[0046] Certain aspects of the invention disclosed below are found in Mao et al., Proc Natl Acad Sci USA, Aug 2, 2022; 119(31) (hereinafter referred to as "Mao et al."), the contents of which are incorporated herein by reference.

[0047] Tissue-specific antigens can serve as targets for cancer immunotherapy based on adoptive T cell transfer. T cell recognition of tumors is mediated by the interaction between the peptide-major histocompatibility complex (pMHC) and the T cell receptor (TCR). Revealing the identity of peptides bound to MHC is crucial for discovering cognate TCRs and predicting potential toxicity. We performed a multimodal immunopeptidomics analysis of prostatic acid phosphatase (PAP), a recognized tissue antigen. Three physical methods, including weak acid elution, immunoprecipitation, and secretory MHC precipitation, were used to capture the comprehensive signature of PAP on HLA-A*02:01. A total of twenty-seven PAP peptides were identified, while the commonly used algorithm NetMHCpan 4.0 only predicted five of these peptides. Peripheral blood mononuclear cells (PBMCs) from more than 20 healthy donors were screened using PAP peptides. 21 cognate TCRs targeting seven different epitopes were identified using single-cell isolation technology that detects intracellular IFNγ and TNFα. One TCR showed reactivity to a cell line expressing both full-length PAP and HLA-A*02:01. Our results demonstrate that a combined multimodal immunopeptidomics approach productively revealed target peptides and identified the first cloned TCR sequence for prostatic acid phosphatase.

[0048] Prostatic acid phosphatase (PAP) is a target for prostate cancer immunotherapy

[0049] One approach to preventing “on-target off-tumor” toxicity is to select tissue antigens that are expressed on non-essential organs. Patients with advanced prostate cancer often undergo radical prostatectomy to remove the prostate (11). We selected prostatic acid phosphatase (PAP) from among many previously defined prostate tissue antigens because: 1. PAP expression is restricted to the prostate and prostate cancer (12); 2. PAP expression can be found in >95% of prostate cancers (13); 3. Elevated serum PAP is found in >60% of patients with recurrent prostate cancer (14); and 4. The secreted form of PAP does not compete with TCR-PAP recognition because the interaction is restricted to peptides bound to MHC I.

[0050] Previous efforts to target PAPs resulted in the first FDA-approved cancer vaccine, sipuleucel-T (Provenge) (15). Clinical trials demonstrated an improvement in median overall survival of 4.1 months in patients with metastatic castration-resistant prostate cancer (15). The T cell proliferative response of vaccinated individuals was measured by the stimulation index (SI) (15). The SI is defined as the number of T cells cultured with an antigen. 3 H-thymidine incorporation was divided by that of the control group (15). A positive T cell proliferation response was defined as an SI > 5 measured at week 6 post-immunization (15). Among patients receiving Provenge, 27.2% of patients demonstrated a response against PAP (8.0% for placebo) (15). Recent studies have also provided video evidence that T cells from patients treated with sipuleucel-T are able to lyse PAP. + target cells (16). Neither the presented PAP epitope nor the cognate TCR sequence has been determined at the molecular level. Recovering TCRs that specifically recognize the PAP epitope could lead to products for potential therapeutic treatments.

[0051] In silico prediction of epitopes on MHC I is an important but insufficient strategy

[0052] A variety of computational methods have been developed to predict peptide-MHC binding affinity based on knowledge of experimentally determined epitopes (17-19). In silico predictions can generate results rapidly and have been widely used (18). Previous efforts to identify PAP epitopes have also relied primarily on motif-based predictions (20,21). In a recent study, Wells et al. formed a consortium (TESLA) that included 25 different prediction platforms for comparison (22). Only 6% of the predicted peptides were found to be immunogenic by staining pMHC multimers (22). Finding consensus within the in silico pipeline has also been difficult. In TESLA, there was limited overlap between the different algorithms: a median of 13% and a maximum of 62% were found between any two randomly selected methods (22). Determining peptides that bind to MHC I by prediction alone is challenging for two reasons: 1. selecting the best single tool to use and 2. assessing the false positives and false negatives of the predictions.

[0053] Use physical analysis to determine the immunopeptidome

[0054] An alternative approach to determining the immunopeptidome is to directly isolate peptides bound to MHC I and characterize them by liquid chromatography-mass spectrometry (LC-MS). A variety of physical methods have been developed to determine the immunopeptidome using mass spectrometry, including mild acid elution (MAE), co-immunoprecipitation with MHC (CoIP), and secreted MHC immunoprecipitation (sMHC-IP). MAE was one of the earliest methods to separate peptides from MHC I by destabilizing the peptide-MHC complex with an isotonic acid buffer (23). While this method is rapid and convenient, it can generate non-MHC-bound peptides from other extracellular proteins. CoIP purifies peptide-MHC I complexes with monoclonal antibodies to produce results with less contamination from non-MHC peptides (24,25). This requires large quantities of antibody and expression of the antigen of interest and the desired HLA type on the target cells. sMHC-IP techniques require engineering and expressing soluble single-chain MHC in cell lines for affinity capture (26,27). This approach requires manipulation of cell lines and may generate peptides that can only be presented on artificial constructs. There is no consensus on the optimal method. To capture a more comprehensive immunopeptidomic signature of PAP, we combined the three aforementioned methods on HLA-A*02:01, one of the most common subtypes (28).

[0055] Identification of TCRs from antigen-reactive single T cells

[0056] To date, single-cell MHC I-restricted TCR sequences targeting the PAP epitope have not been identified and published on the publicly available Immune Epitope Database (IEDB) (29). One of the major challenges is the enrichment and identification of cognate T cells for single-cell sequencing. We recently developed a technology, CLint-seq, to ​​enable single T cell isolation of activated cells. Cells were fixed with a disulfide-based reversible crosslinker (DSP) and sorted based on intracellular activation markers by fluorescence-activated cell sorting (FACS) (30). The use of a reversible crosslinker allows the release of cellular mRNA from mRNA-protein crosslinked complexes. These mRNAs can then be efficiently reverse transcribed and meet a quality compatible with the 10X Genomics single-cell TCR sequencing platform (30,31). T cells stimulated with cognate peptides can produce cytokines such as IFNγ and TNFα, which can be captured and stained intracellularly. Using the physically identified PAP epitope, 21 peptide-reactive TCRs were successfully isolated from healthy donor PBMCs using CLint-seq.

[0057] result:

[0058] Multimodal immunopeptidomic profile of PAP on HLA-A*02:01

[0059] A comprehensive HLA-A*02:01 immunopeptidomic signature of PAP was determined using both physical and computational methods. The commonly used algorithm NetMHCpan 4.0 was applied to derive an overview of PAP epitopes on HLA-A*02:01 (18). Using the top 2 percent as a cutoff, 40 PAP peptides were selected as potential good binders on HLA-A*02:01 (Supplementary Table 1 of Mao et al.).

[0060] To confirm the presence of these predicted peptides and others, three previously published physical methods were performed, including mild acid elution (MAE), coimmunoprecipitation (CoIP), and secreted MHC immunoprecipitation (sMHC-IP) ( Figure 1 The MAE protocol uses an acidic buffer (pH 3.3) to dissociate peptide-MHC I complexes. It was applied to monoallelic (K562-A2-PAP) and multiallelic (M202-PAP) HLA-A*02:01 + Cell line. K562-A2-PAP is considered a mono-HLA allele cell line because wild-type K562 cells lack surface MHC class I (32). This strategy identified a total of 11 PAP peptides (Supplementary Figure 1). Figure 1 a; Table 1).

[0061] Because treatment with MAE can induce the release of non-MHC peptides, an alternative approach, CoIP, was performed on the same two cell lines. This approach uses a monoclonal antibody (clone W6 / 32) to enrich MHC I (24, 25, 33) released from the cell surface after lysis. Peptides bound to MHC I were then dissociated from the purified product and analyzed by LC-MS / MS. Twelve PAP peptides were recovered by CoIP (Supplementary Figure 1). Figure 1 a; Table 1). Two peptides overlapped with those found by MAE (Supplementary Figure 1 of Mao et al. Figure 1 a; Table 1).

[0062] Secretory MHC-IP (sMHC-IP) was previously developed to perform enhanced expression of an engineered soluble form of MHC I as a single-chain dimer (sCD) (26,27). The recently published sMHC-IP platform, ARTEMIS, achieved robust expression and secretion of soluble HLA-A*02:01 molecules (27). This engineered form contains a hexahistidine tag (6x His tag) to increase the efficiency of enrichment by Ni-NTA agarose. Eight peptides were recovered in sMHC-IP, including six that were not found in the other two physical methods (Supplementary Figure 2). Figure 1 a, Table 1). No single peptide was found by all three methods (Supplementary Figure 1 of Mao et al. Figure 1a; Table 1). Comparison between the physical and computer simulation methods showed that there were only five overlapping peptides, which accounted for 12.5% ​​of the total peptides predicted by NetMHCpan 4.0 (Supplementary Figure 1). Figure 1 b; Table 1).

[0063] All physically recovered PAP epitopes were then subjected to BLAST analysis against a human protein library to test their specificity for PAP (34). All 27 PAP peptides were unique to the PAP sequence. Peptides with similar sequences were mostly from other members of the acid phosphatase family, such as lysosomal acid phosphatase and testicular acid phosphatase (Supplementary Table 2 of Mao et al.).

[0064] Evaluation of HLA-A*02:01 specificity of recovered PAP peptides

[0065] Some peptides recovered by physical methods may originate from non-HLA-A*02:01 subtypes or peptide fragments that are not on MHC I. To assess the HLA-A*02:01 specificity of the recovered PAP epitopes, a T2 cell binding assay was performed. The T2 cell line lacks the transporter associated with antigen processing protein (TAP), which is responsible for loading peptides onto MHC I. Therefore, only a limited number of unstable MHC I (including HLA-A*02:01) molecules are naturally present on T2 cells (35). In the T2 binding assay, chemically synthesized candidate peptides (>80% purity) are exogenously added to the growth medium. Epitopes with A*02:01 specificity can form stable peptide-MHC complexes and induce the accumulation of these molecules. The amount of HLA-A*02:01 can then be quantified using flow cytometry using an anti-A2 antibody conjugated with FITC (clone BB7.2) ( Figure 2 a).

[0066] Twenty-seven PAP peptides identified by physical methods were tested in the T2 binding assay. Six of the 27 PAP peptides showed high HLA-A2 signals when exogenously pulsed on T2 cells (Table 1, Table 2, of Mao et al.). Figure 2 b) All six peptides were detected by sMHC-IP, including one epitope found by both sMHC-IP and CoIP. Five of these six peptides passed the 2% selection cutoff of NetMHCpan 4.0 as strong HLA-A*02:01 binders (Table 1 of Mao et al.).

[0067] Peptide-MHC I complexes processed by endogenous mechanisms can exhibit different stabilities compared to exogenous peptide pulses (such as in T2 binding assays). This may be due to post-translational modifications (PTMs). A recently developed technique, secreted single-chain trimers (SCT), has been used to assess the relative stability of pMHCs of interest (36). In the secreted SCT construct, the MHC I heavy chain (HLA-A*02:01 α chain with H74L and Y84C mutations), light chain (β-microglobulin), and the corresponding peptide are tethered to a single chain molecule ( Figure 3 a). The constructs were expressed in cells and released into the culture supernatant. Only peptides favored by HLA-A*02:01 were expected to generate stable SCTs with high yields. The amount of SCTs was measured by band intensity on SDS-PAGE and normalized to a well-known WT1 cancer epitope (RMFPNAPYL) restricted on HLA-A*02:01 ( Figure 3 b)(37,38).

[0068] When using a cutoff of 0.2 normalized to the control WT1 epitope, nine peptides were found to have relatively high stability to HLA-A*02:01 ( Table 1 of Mao et al.; Figure 3 b). Five of these nine PAP peptides were not among the top 2% of candidates selected by NetMHCpan 4.0 (Table 1 of Mao et al.). Only four of these nine peptides scored positive in the T2 binding assay, suggesting that each evaluation technique addresses different aspects of peptide-MHC stability (Table 1 of Mao et al.). Notably, PAP_A2_24 showed a higher yield (1.40) than the positive control, but its prediction score in NetMHCpan 4.0 was poor (24.22%) (Table 1 of Mao et al.; Figure 3 b).

[0069] Post-translationally modified PAP peptides show increased binding affinity for HLA-A*02:01

[0070] PAP-A2-24 showed conflicting results for HLA-A*02:01 binding in different stability assays. One possible explanation is that PAP-A2-24 has been post-translationally modified. Previous literature reported N-glycosylation on the asparagine (N220 of PAP) of PAP-A2-24 (39). To investigate whether there is an N-glycosylated form of PAP-A2-24, the SCT products of PAP-A2-24 (SVHNFTLPSW (SEQ ID NO:54)) and PAP-A2-25 (IMYSAHDTTV (SEQ ID NO:55)) were treated with PNGase F, which can specifically remove N-glycans (40). SDS-PAGE results showed that PAP-A2-24 SCT showed a band with a significantly higher molecular weight than that of PAP-A2-25 before PNGase F treatment. After deglycosylation, the two SCTs migrated at similar distances in the gel (Supplementary Figure 2). Figure 2 a). These results indicate that, in addition to the glycosylation sites on the MHC I heavy and light chains, PAP-A2-24 contains additional N-glycans. The only sequence difference between PAP-A2-24 SCT and PAP-A2-25 SCT is in their peptide fragments. The additional N-glycans are likely located within the peptide (SVHNFTLPSW (SEQ ID NO: 54)).

[0071] The spectra were also reanalyzed to confirm whether the deglycosylated form of PAP-A2-24 was also present. Previous reports have shown that N-glycosylated asparagine (N) can undergo enzymatic deamidation to aspartic acid (D) (41). In the CoIP results, two forms were detected by LC-MS: SVHNFTLPSW (SEQ ID NO: 54) and SVHDFTLPSW (SEQ ID NO: 69) (Supplementary text of Mao et al.). Figure 2 b).

[0072] Isolation of PAP peptide-specific TCRs from PBMCs of healthy individuals

[0073] PBMCs collected from multiple commercially available normal donors (n>20) were screened for TCRs that were reactive to the PAP peptide. 27 chemically synthesized peptides were added to total PBMCs, which contain a mixture of antigen presenting cells (e.g., monocytes and B cells) capable of priming T cells. The T cells were then allowed to culture and expand for 10 days. The CLint-seq protocol was then applied to these stimulated cells to isolate reactive candidate T cells (30). TNFα was detected by FACS as discussed above. + / IFNγ +Fixed CD8 T cell populations were sorted to enrich for reactive populations. TCR pairs that appeared more than once in 10X Genomics sequencing results (frequency >1) were selected as potential PAP-reactive clones. A total of 124 candidate α / β pairs were recovered from eight healthy individuals, including three women, four men, and one unknown individual (Supplementary Table 3 in Mao et al.).

[0074] To determine whether these TCRs are reactive against PAP, the TCR variable regions of both the α and β chains from all selected candidates were synthesized into DNA fragments for cloning. The constant regions of both the α and β chains (TRAC and TRBC) were replaced with mouse constant regions to reduce mispairing with endogenous human TCRs. The paired TCR α and β chains were linked with a mutant self-cleaving 2A peptide linker (F2Aopt) to ensure equal expression (42).

[0075] The engineered TCR sequence was then cloned into the pMAX-Cloning vector for rapid functional screening using electroporation. The pMAX construct containing the TCR of interest was electroporated into the Jurkat-CD8-NFAT-GFP cell line, which was used as a reporter system. In Jurkat-CD8-NFAT-GFP cells, binding and activation of the NFAT promoter repeat sequence induced GFP expression following TCR activation ( Figure 4 a). GFP expression can then be quantified by flow cytometry to determine whether the TCR recognizes the cognate peptide-MHC I. Murine TCR β chains were measured by FACS to estimate transfection efficiency. K562 cells were transduced with HLA-A*02:01-IRES-GFP (K562-A2) via lentivirus and used as target cells during testing (Methods). Individual chemically synthesized PAP peptides were added to and presented by K562-A2 cells. Effector cells (Jurkat) and target cells (K562) were mixed in a 2:1 ratio. Of 124 candidate clones, 21 TCRs were found to recognize 7 different PAP peptides previously identified by LC-MS (Table 1 of Mao et al.; Supplementary Table 4). These 21 TCRs were derived from 3 individuals, including 2 males and 1 female (Supplementary Tables 3, 4 of Mao et al.).

[0076] Functional validation of candidate TCRs in human PBMCs

[0077] Twenty-one candidate TCRs that showed reactivity in the Jurkat-CD8-NFAT-GFP system were tested in human PBMC cells. Selected TCR constructs with mouse constant regions were then transduced using a truncated low-affinity nerve growth factor receptor (δLNGFR) as a transduction marker. Candidate TCRs were transduced into human PBMCs using the pMSGV retroviral system (9) (Methods). Surface dLNGFR levels were measured by FACS to estimate transduction efficiency. Murine TCR β chains were also quantified by FACS to assess whether TCRs were trafficked to the cell surface. Tetramers containing individual PAP peptides of interest were generated and used in engineered PBMCs to ensure specific recognition (Supplementary Figure 1). Figure 3 ).

[0078] Stimulated T cells that recognize cognate peptides bound to MHC class I can release cytokines such as IFNγ. By using recombinant IFNγ as a standard, an ELISA was performed to quantify the released IFNγ (Methods). Individual PAP peptides were exogenously added to K562-A2 cells. Engineered PBMCs and target K562-A2 cells were mixed at a ratio of 2:1 (effector:target). Supernatants from co-culture experiments were then collected after 48 hours. When expressed in human PBMCs, seven TCRs showed significant IFNγ signals against three different PAP peptides ( Figure 5 a; Table 1 of Mao et al.). Notably, five of these seven TCRs were directed against a peptide (PAP-21) that was not cut off (<2%) by prediction using the NetMHCpan 4.0 algorithm (Table 1 of Mao et al.).

[0079] TCRs that displayed high IFNγ signals in PBMCs were tested with serial dilutions of the cognate peptide to compare their relative potency with that of a clinically tested TCR, F5. This TCR was previously isolated from a melanoma patient and is directed against the MART1 epitope (EAAGIGILTV) (6). The F5 TCR can induce tumor regression in patients without affinity maturation to increase its potency and served as a control in our experiments (6). Chemically synthesized peptides were tested at various concentrations on K562-A2. PBMCs expressing candidate PAPTCRs were mixed at a 2:1 (effector:target) ratio. IFNγ ELISA was performed on the collected supernatants 48 hours later. Notably, one PAP TCR (PAP-TCR-204) showed similar levels of activation compared to F5 (by peptide dilution), while the remaining six TCRs showed weaker results ( Figure 5 a).

[0080] PBMCs expressing these seven TCRs were then co-cultured with target cells expressing full-length PAP to test their ability to recognize processed PAP epitopes. Full-length PAP isoform 2 (TM-PAP) was transduced into the K562-A2 cell line via lentivirus. The transduced population was single-cell sorted and expanded to create a clonal cell line with strong PAP expression. TCR-engineered PBMCs were mixed with target K562-A2-PAP cells at a ratio of 16:1 (effector:target cells). PBMCs transduced with the F5 TCR and the empty vector dLNGFR (no TCR) alone were used as negative controls. ELISA was performed on the co-culture supernatant 48 hours later. One TCR (PAP-TCR-156) showed specific full-length PAP recognition, with IFNγ ( Figure 5 b). Four TCRs (128, 215-1, 218, and 219) generate low IFNγ signals (approximately 3,000 pg / ml) ( Figure 5 b).

[0081] The cytotoxicity of candidate PAP TCRs was assessed by recording total live target cells using the IncuCyte platform. Target K562-A2-PAP cells co-expressed GFP and could be analyzed by live imaging and GFP - PBMC cell differentiation. Live cell imaging was performed every two hours to record the number of target cells over a 120-hour time course. The GFP signal was then processed by the IncuCyte analysis tool to estimate the area of ​​target cells. One of the candidate TCRs, PAP-TCR-156, was able to inhibit the growth of cells expressing full-length PAP ( Figure 5 c). The total GFP area of ​​K562-A2-PAP was maintained at similar levels during 150 hours of co-culture with PBMC expressing PAP-TCR-156 ( Figure 5 c). As a negative control, K562-A2 cells showed a threefold increase in total GFP area ( Figure 5 c).

[0082] Materials and Methods Weak acid elution A weak acid elution protocol was used to elute MHC I-associated peptides, which was largely based on a previously published protocol with some variations (53). 1–2 × 10 8cells. M202-PAP cells were dissociated with 1X PBS + 1mM EDTA, while K562-A2-PAP cells were collected by centrifugation at 1500RPM for 5 minutes. The target cells were then washed three times with 1× HBSS buffer (Thermo Fisher). 25ml of weak acid elution buffer (0.131M citric acid, 0.066M Na2HPO4, 150mM NaCl, 0.3uM aprotinin, 5mM iodoacetamide, pH=3.3) was applied to the target cells and gently shaken for 2 minutes at room temperature. The sample was then centrifuged at 4000xg at 4 degrees Celsius for 5 minutes, and the supernatant was collected. Formic acid was added to the sample to a final concentration of 0.1% (v / v). A 3ml C18 solid phase extraction column (3M) was pre-rinsed three times with 99.9% acetonitrile (ACN) + 0.1% formic acid. The MAE sample was then added to a C18 column, followed by three washes with a 0.1% formic acid solution in water. The C18 column was then eluted three times with 200 μl of 40% ACN, 5% formic acid, and 55% HO. The sample was then passed through a 3 kd centrifugal filter (Millipore) at 4000 x g and 4°C for 90 min. The flow-through was then dried by vacuum centrifugation and stored at -20°C until MS analysis.

[0083] MHCICoIP The CoIP protocol was modified based on a previously published protocol (54, 55). 1-2 x 10 8 M202-PAP or K562-A2 PAP cells were first washed three times with 1X PBS. The cells were then lysed with CoIP lysis buffer (20 mM Tris (pH 8.0), 1 mM EDTA, 100 mM NaCl, 1% Triton X-100, 60 mM n-octylglucoside, 1 mM PMSF (Sigma-Aldrich), protease inhibitors (Roche Life Science), and 1 mg / ml DNase I (Roche Life Science)). 7 1 ml of lysis buffer was added to each cell. The sample was then shaken at 4°C for 1 hour. The lysate was then centrifuged at 10,000 x g for 20 minutes to pellet the debris. The supernatant was then mixed with GammaBind Plus Sepharose beads (GE Lifesciences) conjugated with W6 / 32 antibody (BioXCell) at a rate of 10 8The beads were mixed at a ratio of 100 cells to 1 ml of beads. The beads and lysate mixture was shaken at 4°C for 180 min. The mixture was then loaded onto a Poly-Prep chromatography column (Bio-Rad). The column was then washed four times with 10 ml of wash buffer I (CoIP wash buffer I: 20 mM Tris (pH 8.0), 1 mM EDTA, 100 mM NaCl, 60 mM n-octylglucoside, and 1 mg / ml DNase I), four times with 10 ml of wash buffer II (CoIP wash buffer II: 10 mM Tris (pH 8.0), and once with 10 ml of ultrapure H2O (Thermo Fisher). Peptides were released from the beads by adding 10% acetic acid (Sigma) for 2 min and cleaned with 0.45 μm Costar Spin-X centrifuge tube filters (Corning) by centrifugation at 3000 x g for 30 sec. The samples were then snap-frozen and stored at −70°C until further processing.

[0084] Secreted MHC-IP using the ARTEMIS protocol The ARTEMIS protocol was based on a previously published protocol (27). Expression of both secreted HLA-A2 and PAP was achieved in Freestyle 293-F cells (Thermo Fisher) using a lentiviral transduction system. 400 ml of supernatant containing secreted MHC I was purified by Ni-NTA agarose (1 μL slurry per 1 ml supernatant). The slurry was loaded onto a Poly-Prep column and washed. The denatured samples were stored at −70° C. until further processing.

[0085] LC-MS analysis :

[0086] The eluted sample was loaded onto a HyperSep C18 column (Thermo Scientific 60108-390) and washed three times with 0.1% formic acid, followed by elution with elution buffer (40% acetonitrile, 0.1% formic acid). The desalted sample was lyophilized by high-speed vacuum and then reconstituted in water. Next, the sample was treated with a detergent removal kit to remove residual detergent in the lysis buffer. Finally, the sample was acidified to contain 5% formic acid before loading onto the LC-MS. The sample was delivered to an Orbitrap Fusion Lumos hybrid mass spectrometer by a 140-min gradient (0-5-min, 1-5.5% B, 5-128 min, 5.5-27.5% B, 128-135 min, 27.5-35% B, 135-136 min, 35-80% B, 136-138 min, 80% B, 138-138.5 min, 80-1% B, 138.5-140 min, 1% B, B: 80% CAN + 0.1% formic acid). Acquisition was carried out in the following data dependent acquisition (DDA) mode: full MS scans were acquired at a resolution of 120 K in an Orbitrap mass spectrometer, and singly charged ions and multiply charged ions at >800 m / z were selected for high energy collisional dissociation (HCD) fragmentation at 32% collision energy, and then MS / MS scans were performed at a resolution of 15 K in an Orbitrap. Dynamic exclusion was enabled to not repeatedly select ions with the same m / z within 60 seconds. Database searches were performed against the EMBL human reference proteome (UP000005640human_9606) using the Crux pipeline (v3.2) using nonspecific digestion, PSM and peptide FDR set to a 1% threshold. T2 peptide binding assay: T2 cells (ATCC) were cultured in IMDM (Thermo Fisher) with 20% FBS (Omega Scientific). Before peptide loading, 2 x 10 5 Each cell was resuspended in 100 μl of serum-free RPMI (Thermo Fisher) and added to each well of a 96U bottom tissue culture plate (Corning). Chemically synthesized peptides were diluted to various concentrations in serum-free RPMI and added to designated wells containing T2 cells. Cells were co-cultured with peptides in a 37°C incubator overnight. Cells were then washed twice with 1X PBS and stained with 2 μl of anti-HLA-A2 FITC antibody (clone BB7.2, Biolegend) per well. The amount of HLA-A2 molecules was quantified by FACS.

[0087] SCT quantitative determination:The SCT construct with a single PAP peptide (mutant H74L / Y84C) was synthesized according to a previously published protocol (36).

[0088] Cell culture: K562 (ATCC), M202 (a gift from A. Ribas at UCLA), and Jurkat-NFAT-ZsGreen (a gift from D. Baltimore at Caltech) were cultured in RPMI 1640 (Thermo Fisher) supplemented with 10% FBS (Omega Scientific) and glutamine (Fisher Scientific). 293T (ATCC) cells were cultured in DMEM (Thermo Fisher) supplemented with 10% FBS and glutamine. Primary peripheral blood mononuclear cells (PBMCs) for stimulation were cultured in TCRPM1 supplemented with 50 U / ml IL-2 (Peprotech) and chemically synthesized PAP peptides of interest (>80% purity, Elim Biopharm) as previously described (P Nesterenko, Cell Reports, 2021). TCRPMI medium contains: RPMI 1640 (Thermo Fisher), 10% FBS (Omega Scientific), Glutamax (Thermo Fisher), 10 mM HEPES (Thermo Fisher), non-essential amino acids (Thermo Fisher), sodium pyruvate (Thermo Fisher), and 50 μM β-mercaptoethanol (Sigma). PBMCs for retroviral transduction were first activated with CD3 / CD28 dynabeads (Thermo Fisher) and cultured in the following T cell medium (TCM): AIM V medium (Thermo Fisher), 5% human AB serum (Omega Scientific), 50 U / ml IL-2 (Peprotech), 0.5 ng / ml IL-15 (Peprotech), Glutamax (Thermo Fisher), and 50 μM β-mercaptoethanol (Sigma).

[0089] CLInt-seq:Reactive T cells were isolated from stimulated PBMC using CLInt-seq according to a previously published protocol (30). After 7–10 days of co-culture with the PAP peptide pool, PBMC were transferred to 96-well U-plates and allowed to rest overnight. The cells were then incubated with 10 μg / ml of the peptide pool and 1 μg / ml of CD28 / 49d antibody (BD Biosciences) for 1 hour, followed by the addition of Brefeldin A (Biolegend). After approximately 8 hours of incubation at 37°C, the cells were processed as previously described and analyzed by FACS for CD3 + / CD4 - / CD8 + / TNFα + / IFNγ + The population was stained (56).

[0090] Single-cell TCR sequencing : CD8 that produces both TNFα and IFNγ + T cells were sorted into approximately 30 μl of 0.04% BSA solution. If fewer than 1,000 cells were isolated, 5,000–10,000 K562 cells were sorted into the same tube as the carrier population. A single-cell TCR V(D)J library was then constructed at 10X Genomics by the UCLA Technology Center for Genomics & Bioinformatics. TCR pairs were then sequenced on a MiSeq (Illumina).

[0091] Jurkat-NFAT-GFP assay: Rapid screening of candidate TCRs was performed in Jurkat-NFAT-GFP cells as described previously ( 56 ).

[0092] TCR transduction in PBMCs: Candidate TCRs were engineered in PBMCs according to a previous publication (56).

[0093] Preparation of MHC tetramers: MHC tetramers used to stain candidate PAP TCRs were synthesized and prepared according to a previously published protocol ( 57 ).

[0094] T cell activation assay:For peptide-pulsed co-culture experiments, target cells were mixed with TCR-engineered PBMCs at a 1:2 (T:E) ratio in the target cell's desired culture medium and supplemented with 1 μg / ml anti-CD28 / CD49d antibody (BD Biosciences). For cell lines expressing full-length PAP, target cells were first treated with 2 ng / ml IFNγ and 3 ng / ml TNFα for 8-10 hours. Target cells and PBMCs were then mixed at a 1:16 (T:E) ratio for co-culture analysis. Supernatants were collected 48 hours later and analyzed by ELISA (BD Biosciences) to estimate IFNγ concentrations.

[0095] Cytotoxicity assays by IncuCyte: Target cells were plated onto 96-well tissue culture plates coated with 0.001% poly-L-lysine (Sigma) and stored at 37°C for approximately 2 hours. TCR-engineered PBMCs were then added to the desired wells at an effector:target ratio of 2:1 (peptide-pulsed target cells) or 16:1 (full-length PAP target cells). GFP surface area was used to estimate T cell killing, and plates with cell mixtures were analyzed for 120 hours using the IncuCyte system.

[0096] discuss

[0097] Our studies using multiple immunopeptidomics approaches revealed 27 potential HLA-A*02:01-restricted PAP peptides. We were able to recover 21 candidate PAP TCRs targeting seven identified epitopes. When engineered into human PBMCs, seven TCRs displayed reactivity against three different epitopes on peptide-pulsed target cells. One TCR (PAP-TCR-156) recognized the peptide presented on a cell line expressing full-length PAP and the HLA-A*02:01 allele.

[0098] All three physical assays (MAE, CoIP, and sMHC-IP) were able to generate immunogenic peptides. For TCRs that functioned effectively in PBMCs, all three cognate peptides were detectable by sMHC-IP. Despite our relatively small sample size, sMHC-IP appears to be the most efficient method for recovering immunogenic epitopes.

[0099] Epitopes identified by physical methods can be used to develop reagents for PAP-specific T cells. The peptide of interest can be refolded into MHC-based multimers, which serve as detection and isolation reagents. A common format is called a "tetramer," in which four peptide-MHC molecules are attached to a streptavidin molecule. More complex multimeric versions can be obtained by adding more fluorescent dyes and increasing the number of MHC monomers (such as pentamers or dextran). (43) The generation of MHC multimers depends primarily on knowing the identity of the peptide. The seven PAP TCRs we recovered against three different PAP peptides could be specifically stained by their homotetramers. Other candidates in our list can also be used to prepare multimers. These reagents can be used to prescreen PAP-reactive T cells in patients who have been treated with Provenge or healthy donors.

[0100] One of the PAP epitopes (PAP-A2-24) showed altered affinity for HLA-A*02:01 after glycosylation. Both the native form and the deglycosylated form (N to D) were detected by LC-MS. Post-translational modifications such as glycosylation may generate a larger pool of epitopes for immunotherapy, as cancers can produce abnormal carbohydrate modifications on proteins (44, 45).

[0101] One of our candidate TCRs, PAP-TCR-156, showed potential to recognize cell lines expressing full-length PAP. Validation of this TCR revealed weak T cell responses in IFNγ and cytotoxicity assays. The potency of these candidate TCRs needs to be increased for future applications and testing.

[0102] One way to enhance T cell sensitivity and potency is to increase the affinity of their TCR, a process called “TCR affinity maturation” (46). Previous results have shown that higher affinity can lead to faster and stronger responses (47). Common methods for TCR affinity maturation include 1. non-targeted mutagenesis, 2. site-directed mutagenesis, and 3. single amino acid (AA) screening of the TCR complementarity determining regions (CDRs) (7,48,49).

[0103] Using alternative sources of T cells can also provide us with highly potent TCRs. PBMCs from healthy donors were used as our T cell source. TCRs against tissue antigens such as PAP can already be deleted during thymic negative selection (50). T cells from athymic in vitro cultures can serve as a better source because these T cells do not undergo negative selection (51,52). Interrogating the PAP epitopes we identified for T cells from these alternative sources could provide TCRs with higher affinity and specificity.

[0104] The PAP-specific TCRs we identified can serve as a starting point for in vivo experiments and potential clinical development. The PAP epitope information collected can be used to create detection and capture reagents. It is understood that future engineering and refinement will be required to increase the potency of candidate TCRs. T cells from alternative sources can also be used to increase the diversity of our candidate TCR pool.

[0105] Table A: Exemplary PAP TCR embodiments of the present invention

[0106] Embodiments of the present invention include compositions comprising a substance encoding a TCR polynucleotide (e.g., a TCR polynucleotide placed in a vector). In typical embodiments, the polynucleotide encodes a Vα T cell receptor polypeptide and / or a Vβ T cell receptor polypeptide; and is placed in a vector such that when a Vα / Vβ T cell receptor comprising a Vα T cell receptor polypeptide and / or a Vβ T cell receptor polypeptide is expressed on a CD8 + When expressed in T cells, it is expressed by CD 8 + The Vα / Vβ T cell receptors expressed by T cells recognize / target the prostatic acid phosphatase peptide associated with human leukocyte antigen (e.g., HLA-A*02:01).

[0107] Twenty-one exemplary working TCR embodiments of the present invention are disclosed below.

[0108] 1. PAP-TCR-128

[0109] A. Target peptide sequence: LLLARAASLSL (SEQ ID NO: 59) ("PAP_A2_21").

[0110] B. Vα CDR3 region polypeptide sequence: CAASVDEKLTF (SEQ ID NO: 70)

[0111] C. VβV region polypeptide sequence: CASSMYNEQFF (SEQ ID NO: 71)

[0112] D. Polynucleotide sequence of the V(D)J region of the α chain: Gaccagcaagttaagcaaaattcaccatccctgagcgtccaggaaggaagaatttctattctgaactgtgactat actaacagcatgtttgattatttcctatggtacaaaaaataccctgctgaaggtcctacattcctgatatctataagttccattaaggataaaaatgaagatggaagattcactgttttcttaaacaaaagtgccaagcacctctctctgcacattgtgccctcccagcctggagactctgcagtgtacttctgtgcagcaagcgtagatgagaaattaacctttgggactggaacaagactcaccatcatacccaat(SEQ ID NO:1)

[0113] E. Polynucleotide sequence of the V(D)J region of the β chain:

[0114] GatactggagtctcccagaaccccagacacaagatcacaaagaggggacagaatgtaactttcaggtgtgatccaatttctgaacacaaccgcctttattggtaccgacagaccctggggcagggcccagagtttctgacttacttccagaatgaagctcaactagaaaaatcaaggctgctcagtgatcggttctctgcagagaggcctaagggatctttctccaccttggagatccagcgcacagagcagggggactcggccatgtatctctgtgccagcagcatgtacaatgagcagttcttcgggccagggacacggctcaccgtgctagagGACCT(SEQ ID NO:2)

[0115] 2. PAP-TCR-131

[0116] A. Target peptide sequence: IMYSAHDTTV(SEQ ID NO:55)(“PAP_A2_25”).

[0117] B. Polypeptide sequence of the VαCDR3 region: CAVNANYGGATNKLIF(SEQ ID NO:72)

[0118] C. VβV region polypeptide sequence: CAISGGEVTTYEQYF (SEQ ID NO:73)

[0119] D. α-chain V(D)J region polynucleotide sequence:

[0120] Gcccagtctgtgagccagcataaccaccacgtaattctctctgaagcagcctcactggagttgggatgcaactattcctatggtggaactgttaatctcttctggtatgtccagtaccctggtcaacaccttcagcttctcctcaagtacttttcaggggatccactggttaaaggcatcaagggctttgaggctgaatttataaagagtaaattctcctttaatctgaggaaaccctctgtgcagtggagtgacacagctgagtacttctgtgccgtgaatgcaaattatggtggtgctacaaacaagctcatctttggaactggcactctgcttgctgtccagccaaat (SEQ ID NO:3)

[0121] E. β-chain V(D)J region polynucleotide sequence:

[0122] Gatgctggaatcacccagagcccaagacacaaggtcacagagacaggaacaccagtgactctgagat

[0123] gtcaccagactgagaaccaccgctatatgtactggtatcgacaagacccggggcatgggctgaggctgatccatta

[0124] ctcatatggtgttaaagatactgacaaaggagaagtctcagatggctatagtgtctctagatcaaagacagaggatttc

[0125] ctcctcactctggagtccgctaccagctcccagacatctgtgtacttctgtgccatcagtggtggggaggtaaccacctacgagcagtacttcgggccgggcaccaggctcacggtcacagagGACCT (SEQ ID NO:4)

[0126] 3. PAP-TCR-137

[0127] A. Target peptide sequence: ILLWQPIPV (SEQ ID NO: 47) ("PAP_A2_14").

[0128] B. Vα CDR3 region polypeptide sequence: CATDAPTNFGNEKLTF (SEQ ID NO: 74)

[0129] C. VβV region polypeptide sequence: CASSQRWTSGVWETQYF (SEQ ID NO: 75)

[0130] D.α chain V(D)J region polynucleotide sequence:

[0131] Agtcaacagggagaagaggatcctcaggccttgagcatccaggagggtgaaaatgccaccatgaactgcagttacaaaactagtataaacaatttacagtggtatagacaaaattcaggtagaggccttgtccacctaattttaatacgttcaaatgaaagagagaaacacagt ggaagattaagagtcacgcttgacacttccaagaaaagcagttccttgttgatcacggcttcccgggcagcagacactgcttcttacttctgtgctacggacgcccctactaactttggaaatgagaaattaacctttgggactggaacaagactcaccatcatacccaat(SEQ ID NO:5)

[0132] E.β chain V(D)J region polynucleotide sequence:

[0133] Gacacagctgtttcccagactccaaaatacctggtcacacagatgggaaacgacaagtccattaaatgtgaacaaaatctgggccatgatactatgtattggtataaacaggactctaagaaatttctgaagataatgtttagctacaataataaggagctcattataaatgaaacagtt ccaaatcgcttctcacctaaatctccagacaaagctcacttaaatcttcacatcaattccctggagcttggtgactctgctgtgtatttctgtgccagcagccaacggtggactagcggggtgtgggagacccagtacttcgggccaggcacgcggctcctggtgctcgagGACCT(SEQ ID NO:6)

[0134] 4. PAP-TCR-149

[0135] A. Target peptide sequence: ILLWQPIPV (SEQ ID NO: 47) ("PAP_A2_14").

[0136] B. Vα CDR3 region polypeptide sequence: CAASDNNDMRF (SEQ ID NO: 76)

[0137] C. VβV region polypeptide sequence: CASSQTQGFGELFF (SEQ ID NO: 77)

[0138] D.α chain V(D)J region polynucleotide sequence:

[0139] Aaccagcaagttaagcaaaattcaccatccctgagcgtccaggaaggaagaatttctattctgaactgtgactatactaacagcatgtttgattatttcctatggtacaaaaaataccctgctgaaggtcctacattcctgatatctataagttc cattaaggataaaaatgaagatggaagattcactgtcttcttaaacaaaagtgccaagcacctctctctgcacattgtgccctcccagcctggagactctgcagtgtacttctgtgcagcaagtgataacaatgacatgcgctttggagcagggaccagactgacagtaaaaccaaat(SEQ ID NO:7)

[0140] E. β-chain V(D)J region polynucleotide sequence:

[0141] GaaacgggagttacgcagacaccaagacacctggtcatgggaatgacaaataagaagtctttgaaatgtgaacaacatctgggtcataacgctatgtattggtacaagcaaagtgctaagaagccactggagctcatgtttgtctacagtcttgaagaacgggttgaaaacaacagtgtgccaagtcgcttctcacctgaatgccccaacagctctcacttattccttcacctacacaccctgcagccagaagactcggccctgtatctctgcgccagcagccaaactcaggggttcggggagctgttttttggagaaggctctaggctgaccgtactggagGACCT(SEQ ID NO:8)

[0142] 5. PAP-TCR-154

[0143] A. Target peptide sequence: LLFFWLDRSVLA (SEQ ID NO:62) (“PAP_A2_23”).

[0144] B. VαCDR3 region polypeptide sequence: CQGAQKLVF (SEQ ID NO:78)

[0145] C. VβV region polypeptide sequence: CASSGVGYETQYF (SEQ ID NO:79)

[0146] D. α-chain V(D)J region polynucleotide sequence:

[0147] Gctcagacagtcactcagtctcaaccagagatgtctgtgcaggaggcagagaccgtgaccctgagctgcacatatgacaccagtgagagtgattattatttattctggtacaagcagcctcccagcaggcagatgattctcgttattcgccaagaagcttataagcaacagaatgcaacagagaatcgtttctctgtgaacttccagaaagcagccaaatccttcagtctcaagatctcagactcacagctgggggatgccgcgatgtatttctgtgcttgtcagggagcccagaagctggtatttggccaaggaaccaggctgactatcaacccaaat (SEQ ID NO:9)

[0148] E. β-chain V(D)J region polynucleotide sequence:

[0149] GatgtgaaagtaacccagagctcgagatatctagtcaaaaggacgggagagaaagtttttctggaatgtgtccaggatatggaccatgaaaatatgttctggtatcgacaagacccaggtctggggctacggctgatctatttctcatatgatgttaaaatgaaagaaaaaggagatattcctgaggggtacagtgtctctagagagaagaaggagcgcttctccctgattctggagtccgccagcaccaaccagacatctatgtacctctgtgccagctcgggggtgggatatgagacccagtacttcgggccaggcacgcggctcctggtgctcgagGACCT (SEQ ID NO:10)

[0150] 6. PAP-TCR-156

[0151] A. Target peptide sequence: TLMSAMTNL (SEQ ID NO:48) (“PAP_A2_22”).

[0152] B. Vα CDR3 region polypeptide sequence: CAVNNARLMF (SEQ ID NO:80)

[0153] C. Vβ V region polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO:81)

[0154] D. α-chain V(D)J region polynucleotide sequence:

[0155] Cagaaggaggtggagcagaattctggacccctcagtgttccagagggagccattgcctctctcaactgcacttacagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat (SEQ ID NO:11)

[0156] E. β-chain V(D)J region polynucleotide sequence:

[0157] GattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcccctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT (SEQ ID NO:12)

[0158] 7. PAP-TCR-168

[0159] A. Target peptide sequence: IRSTDVDRTL (SEQ ID NO: 52) ("PAP_A2_13").

[0160] B. Vα CDR3 region polypeptide sequence: CAASYPYTGRRALTF (SEQ ID NO: 82)

[0161] C. VβV region polypeptide sequence: CAASYPYTGRRALTF (SEQ ID NO: 83)

[0162] D.α chain V(D)J region polynucleotide sequence:

[0163] Ggagagaatgtggagcagcatccttcaaccctgagtgtccaggagggagacagcgctgttatcaagtgtacttattcagacagtgcctcaaactacttcccttggtataagcaagaacttggaaaaagacctcagcttattatagacattcgttcaaatgtgggcgaaaagaaa gaccaacgaattgctgttacattgaacaagacagccaaacatttctccctgcacatcacagagacccaacctgaagactcggctgtctacttctgtgcagcaagttacccctacacgggcaggagagcacttacttttgggagtggaacaagactccaagtgcaaccaaAT(SEQ ID NO:13)

[0164] E.β chain V(D)J region polynucleotide sequence:

[0165] Gacactgaagttacccagaccaaaacacctggtcatgggaatgacaaataagaagtctttgaaatgtgaacaacatatggggcacagggctatgtattggtacaagcagaaagctaagaagccaccggagctcatgtttgtctacagctatgagaaactctctataaatgaa agtgtgccaagtcgcttctcacctgaatgccccaacagctctctcttaaaccttcacctacacgccctgcagccagaagactcagccctgtatctctgcgccagcagccaagattggggggacgagcagttcttcgggccagggacacggctcaccgtgctagAGGACCT(SEQ ID NO:14)

[0166] 8. PAP-TCR-173

[0167] A. Target peptide sequence: ILLWQPIPV (SEQ ID NO: 47) ("PAP_A2_14").

[0168] B. Vα CDR3 region polypeptide sequence: CAVEAYSGGYQKVTF (SEQ ID NO: 84)

[0169] C. VβV region polypeptide sequence: CASSMYNEQFF (SEQ ID NO: 71)

[0170] D.α chain V(D)J region polynucleotide sequence:

[0171] aaggaccaagtgtttcagccttccacagtggcatcttcagagggagctgtggtggaaatcttctgtaatcactctgtgtccaatgcttacaacttcttctggtaccttcacttcccgggatgtgcaccaagactccttgttaaaggctcaaagccttctcagcagggacgatacaacatGACCTatgaacggttctcttcatcgctgctcatcctccaggtgcgggaggcagatgctgctgtttactactgtgctgtggaggcatattctgggggttaccagaaagttacctttggaactggaacaaagctccaagtcatcccaaAT(SEQ ID NO:15)

[0172] E. β-chain V(D)J region polynucleotide sequence:

[0173] GatactggagtctcccagaaccccagacacaagatcacaaagaggggacagaatgtaactttcaggtgtgatccaatttctgaacacaaccgcctttattggtaccgacagaccctggggcagggcccagagtttctgacttacttccagaatgaagctcaactagaaaaatcaaggctgctcagtgatcggttctctgcagagaggcctaagggatctttctccaccttggagatccagcgcacagagcagggggactcggccatgtatctctgtgccagcagcatgtacaatgagcagttcttcgggccagggacacggctcaccgtgctagAGGACCT(SEQ ID NO:16)

[0174] 9. PAP-TCR-175

[0175] A. Target peptide sequence: LLLARAASLSL (SEQ ID NO:59) ("PAP_A2_21").

[0176] B. VαCDR3 region polypeptide sequence: CAFEDSGYSTLTF (SEQ ID NO:85)

[0177] C. VβV region polypeptide sequence: CASGGLAGVDEQYF (SEQ ID NO:86)

[0178] D. α-chain V(D)J region polynucleotide sequence:

[0179] AtactgaacgtggaacaaagtcctcagtcactgcatgttcaggagggagacagcaccaatttcacctgcagcttcccttccagcaatttttatgccttacactggtacagatgggaaactgcaaaaagccccgaggccttgtttgtaatgactttaaatggggatgaaaagaagaaaggacgaataagtgccactcttaataccaaggagggttacagctatttgtacatcaaaggatcccagcctgaagactcagccacatacctctgtgcctttgaggattcaggatacagcaccctcacctttgggaaggggactatgcttctagtctctccagAT (SEQ ID NO:17)

[0180] E. β-chain V(D)J region polynucleotide sequence:

[0181] gatgctggaatcacccagagcccaagatacaagatcacagagacaggaaggcaggtGACCTtgatgtgtcaccagacttggagccacagctatatgttctggtatcgacaaGACCTgggacatgggctgaggctgatctattactcagcagctgctgatattacagataaaggagaagtccccgatggctatgttgtctccagatccaagacagagaatttccccctcactctggagtcagctacccgctcccagacatctgtgtatttctgcgccagcggaggactagcgggggtcgacgagcagtacttcgggccgggcaccaggctcacggtcacagAGGACCT (SEQ ID NO:18)

[0182] 10. PAP-TCR-178

[0183] A. Target peptide sequence: LLLARAASLSL (SEQ ID NO: 59) ("PAP_A2_21").

[0184] B. Vα CDR3 region polypeptide sequence: CAASVDEKLTF (SEQ ID NO: 70)

[0185] C. VβV region polypeptide sequence: CASSSYNEQFF (SEQ ID NO: 87)

[0186] D.α chain V(D)J region polynucleotide sequence:

[0187] Gaccagcaagttaagcaaaattcaccatccctgagcgtccaggaaggaagaatttctattctgaactgtgactatactaacagcatgtttgattatttcctatggtacaaaaaataccctgctgaaggtcctacattcctgatatctataagttccattaaggataaa aatgaagatggaagattcactgttttcttaaacaaaagtgccaagcacctctctctgcacattgtgccctcccagcctggagactctgcagtgtacttctgtgcagcaagcgtagatgagaaattaacctttgggactggaacaagactcaccatcatacccaAT(SEQ ID NO:19)

[0188] E.β chain V(D)J region polynucleotide sequence:

[0189] Gatactggagtctcccagaaccccagacacaagatcacaaagaggggacagaatgtaactttcaggtgtgatccaatttctgaacacaaccgcctttattggtaccgacagaccctggggcagggcccagagtttctgacttacttccagaatgaagctcaactagaaaaat caaggctgctcagtgatcggttctctgcagagaggcctaagggatctttctccaccttggagatccagcgcacagagcagggggactcggccatgtatctctgtgccagcagctcgtacaatgagcagttcttcgggccagggacacggctcaccgtgctagAGGACCT(SEQ ID NO:20)

[0190] 11.PAP-TCR-204

[0191] A. Target peptide sequence: ILLWQPIPV (SEQ ID NO: 47) ("PAP_A2_14").

[0192] B. Vα CDR3 region polypeptide sequence: CAVGAGDYKLSF (SEQ ID NO: 88)

[0193] C. VβV region polypeptide sequence: CASSQTTGQPQHF (SEQ ID NO: 89)

[0194] D.α chain V(D)J region polynucleotide sequence:

[0195] GcccagtcagtgacccagcctgacatccacatcactgtctctgaaggagcctcactggagttgagatgtaactattcctatggggcaacaccttatctcttctggtatgtccagtcccccggccaaggcctccagctgctcctgaagtacttttcaggagacactctggttcaaggcattaaaggctttgaggctgaatttaagaggagtcaatcttccttcaatctgaggaaaccctctgtgcattggagtgatgctgctgagtacttctgtgctgtgggtgccggcgactacaagctcagctttggagccggaaccacagtaactgtaagagcaaAT(SEQ ID NO:21)

[0196] E. β-chain V(D)J region polynucleotide sequence:

[0197] Gaaacgggagttacgcagacaccaagacacctggtcatgggaatgacaaataagaagtctttgaaatgtga acaacatctgggtcataacgctatgtattggtacaagcaaagtgctaagaagccactggagctcatgtttgtctacagtcttgaagaacgggttgaaaacaacagtgtgccaagtcgcttctcacctgaatgccccaacagctctcacttattccttcacctacacaccctgcagccagaagactcggccctgtatctctgcgccagcagccaaaccacagggcagccccagcattttggtgatgggactcgactctccatcctagAGGACCT(SEQ ID NO:22)

[0198] 12. PAP-TCR-213

[0199] A. Target peptide sequence: IMYSAHDTTV(SEQ ID NO:55)(“PAP_A2_25”).

[0200] B. VαCDR3 region polypeptide sequence: CAGAPETSGSRLTF(SEQ ID NO:90)

[0201] C.VβV region polypeptide sequence: CASSFGGGSSPLHF (SEQ ID NO:91)

[0202] D.α-chain V(D)J region polynucleotide sequence:

[0203] AcccagctgctggagcagagccctcagtttctaagcatccaagagggagaaaatctcactgtgtactgcaactcctcaagtgttttttccagcttacaatggtacagacaggagcctggggaaggtcctgtcctcctggtgacagtagttacgggtggagaagtgaagaagctgaagagactaacctttcagtttggtgatgcaagaaaggacagttctctccacatcactgcggcccagcctggtgatacaggcctctacctctgtgcaggagctcccgaaaccagtggctctaggttgacctttggggaaggaacacagctcacagtgaatcctgAT (SEQ ID NO:23)

[0204] E.β-chain V(D)J region polynucleotide sequence:

[0205] GgtgctggagtctcccagacccccagtaacaaggtcacagagaagggaaaatatgtagagctcaggtgtgatccaatttcaggtcatactgccctttactggtaccgacaaagcctggggcagggcccagagtttctaatttacttccaaggcacgggtgcggcagatgactcagggctgcccaacgatcggttctttgcagtcaggcctgagggatccgtctctactctgaagatccagcgcacagagcggggggactcagccgtgtatctctgtgccagcagcttcgggggcggaagttcacccctccactttgggaacgggaccaggctcactgtgacagAGGACCT (SEQ ID NO:24)

[0206] 13.PAP-TCR-215-1

[0207] A. Target peptide sequence: LLLARAASLSL (SEQ ID NO: 59) ("PAP_A2_21").

[0208] B. Vα CDR3 region polypeptide sequence: CAASADEKLTF (SEQ ID NO: 92)

[0209] C. VβV region polypeptide sequence: CASSQYNEQFF (SEQ ID NO: 93)

[0210] D.α chain V(D)J region polynucleotide sequence:

[0211] Gaccagcaagttaagcaaaattcaccatccctgagcgtccaggaaggaagaatttctattctgaactgtgactatactaacagcatgtttgattatttcctatggtacaaaaaataccctgctgaaggtcctacattcctgatatctataagttcc attaaggataaaaatgaagatggaagattcactgttttcttaaacaaaagtgccaagcacctctctctgcacattgtgccctcccagcctggagactctgcagtgtacttctgtgcagcaagcgcggatgagaaattaacctttgggactggaaca agactcaccatcatacccaAT(SEQ ID NO:25)

[0212] E.β chain V(D)J region polynucleotide sequence:

[0213] Gatactggagtctcccagaaccccagacacaagatcacaaagaggggacagaatgtaactttcaggtgtgatccaatttctgaacacaaccgcctttattggtaccgacagaccctggggcagggcccagagtttctgacttacttccagaatgaagctcaactagaaaaat caaggctgctcagtgatcggttctctgcagagaggcctaagggatctttctccaccttggagatccagcgcacagagcagggggactcggccatgtatctctgtgccagcagccaatacaatgagcagttcttcgggccagggacacggctcaccgtgctagAGGACCT(SEQ ID NO:26)

[0214] 14.PAP-TCR-218

[0215] A. Target peptide sequence: LLLARAASLSL (SEQ ID NO: 59) ("PAP_A2_21").

[0216] B. Vα CDR3 region polypeptide sequence: CAASVDEKLTF (SEQ ID NO: 70)

[0217] C. VβV region polypeptide sequence: CASSLYNEQFF (SEQ ID NO: 94)

[0218] D.α chain V(D)J region polynucleotide sequence:

[0219] GaccagcaagttaagcaaaattcaccatccctgagcgtccaggaaggaagaatttctattctgaactgtgactatactaacagcatgtttgattatttcctatggtacaaaaaataccctgctgaaggtcctacattcctgatatctataagttccattaaggataaaaatgaagatggaagattcactgttttcttaaacaaaagtgccaagcacctctctctgcacattgtgccctcccagcctggagactctgcagtgtacttctgtgcagcaagcgttgatgagaaattaacctttgggactggaacaagactcaccatcatacccaAT(SEQ ID NO:27)

[0220] E. β-chain V(D)J region polynucleotide sequence:

[0221] GatactggagtctcccagaaccccagacacaagatcacaaagaggggacagaatgtaactttcaggtgtgatccaatttctgaacacaaccgcctttattggtaccgacagaccctggggcagggcccagagtttctgacttacttccagaatgaagctcaactagaaaaatcaaggctgctcagtgatcggttctctgcagagaggcctaagggatctttctccaccttggagatccagcgcacagagcagggggactcggccatgtatctctgtgccagcagcttatacaatgagcagttcttcgggccagggacacggctcaccgtgctagAGGACCT(SEQ ID NO:28)

[0222] 15. PAP-TCR-219

[0223] A. Target peptide sequence: LLLARAASLSL(SEQ ID NO:59)(“PAP_A2_21”).

[0224] B. VαCDR3 region polypeptide sequence: CAASADEKLTF(SEQ ID NO:92)

[0225] C.VβV region polypeptide sequence: CASSQYNEQFF (SEQ ID NO:93)

[0226] D.α-chain V(D)J region polynucleotide sequence:

[0227] Gaccagcaagttaagcaaaattcaccatccctgagcgtccaggaaggaagaatttctattctgaactgtgact atactaacagcatgtttgattatttcctatggtacaaaaaataccctgctgaaggtcctacattcctgatatctataagttccattaaggataaaaatgaagatggaagattcactgttttcttaaacaaaagtgccaagcacctctctctgcacattgtgccctcccagcctggagactctgcagtgtacttctgtgcagcaagcgcggatgagaaattaacctttgggactggaacaagactcaccatcatacccaAT (SEQ ID NO:29)

[0228] E.β-chain V(D)J region polynucleotide sequence:

[0229] GatactggagtctcccagaaccccagacacaagatcacaaagaggggacagaatgtaactttcaggtgtgatccaatttctgaacacaaccgcctttattggtaccgacagaccctggggcagggcccagagtttctgacttacttccagaatgaagctcaactagaaaaatcaaggctgctcagtgatcggttctctgcagagaggcctaagggatctttctccaccttggagatccagcgcacagagcagggggactcggccatgtatctctgtgccagcagccaatacaatgagcagttcttcgggccagggacacggctcaccgtgctagAGGACCT (SEQ ID NO:30)

[0230] 16.PAP-TCR-220

[0231] A. Target peptide sequence: ILLWQPIPV (SEQ ID NO:47) ("PAP_A2_14").

[0232] B. Vα CDR3 region polypeptide sequence: CAGRDNYGQNFVF (SEQ ID NO: 95)

[0233] C. Vβ V region polypeptide sequence: CASSQVAGGTYEQYF (SEQ ID NO: 96)

[0234] D. α-chain V(D)J region polynucleotide sequence:

[0235] GgtcaacagctgaatcagagtcctcaatctatgtttatccaggaaggagaagatgtctccatgaactgcacttcttcaagcatatttaacacctggctatggtacaagcaggaccctggggaaggtcctgtcctcttgatagccttatataaggctggtgaattgacctcaaatggaagactgactgctcagtttggtataaccagaaaggacagcttcctgaatatctcagcatccatacctagtgatgtaggcatctacttctgtgctgggcgggataactatggtcagaattttgtctttggtcccggaaccagattgtccgtgctgccctAT (SEQ ID NO: 31)

[0236] E. β-chain V(D)J region polynucleotide sequence:

[0237] GaaacgggagttacgcagacaccaagacacctggtcatgggaatgacaaataagaagtctttgaaatgtgaacaacatctggggcataacgctatgtattggtacaagcaaagtgctaagaagccactggagctcatgtttgtctacaactttaaagaacagactgaaaacaacagtgtgccaagtcgcttctcacctgaatgccccaacagctctcacttattccttcacctacacaccctgcagccagaagactcggccctgtatctctgtgccagcagccaagtggcggggggaacctacgagcagtacttcgggccgggcaccaggctcacggtcacagAGGACCT (SEQ ID NO: 32)

[0238] 17.PAP-TCR-223

[0239] A. Target peptide sequence: KVYDPLYCESV (SEQ ID NO: 58) ("PAP_A2_20").

[0240] B. Vα CDR3 region polypeptide sequence: CAVYGQNFVF (SEQ ID NO: 97)

[0241] C. VβV region polypeptide sequence: CASSPIGLQETQYF (SEQ ID NO: 98)

[0242] D.α chain V(D)J region polynucleotide sequence:

[0243] Cagaaggaggtggagcagaattctggacccctcagtgttccagaggggagccattgcctctctcaactgcacttacagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgac aaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtttatggtcagaattttgtctttggtcccggaaccagattgtccgtgctgccctAT(SEQ ID NO:33)

[0244] E.β chain V(D)J region polynucleotide sequence:

[0245] Gatgctggagttatccagtcaccccggcacgaggtgacagagatgggacaagaagtgactctgagatgtaaaccaatttcaggacacgactaccttttctggtacagacagaccatgatgcggggactggagttgctcatttactttaacaacaacgttccgatagatgattcaggg atgcccgaggatcgattctcagctaagatgcctaatgcattctccactctgaagatccagccctcagaacccagggactcagctgtgtacttctgtgccagcagcccaatagggctccaagagacccagtacttcgggccaggcacgcggctcctggtgctcgAGGACCT(SEQ ID NO:34)

[0246] 18.PAP-TCR-224

[0247] A. Target peptide sequence: LLLARAASLSL (SEQ ID NO: 59) ("PAP_A2_21").

[0248] B. Vα CDR3 region polypeptide sequence: CAASEDEKLTF (SEQ ID NO: 99)

[0249] C. VβV region polypeptide sequence: CASSLMAEQYF (SEQ ID NO: 100)

[0250] D.α chain V(D)J region polynucleotide sequence:

[0251] GaccagcaagttaagcaaaattcaccatccctgagcgtccaggaaggaagaatttctattctgaactgtgactatactaacagcatgtttgattatttcctatggtacaaaaaataccctgctgaaggtcctacattcctgatatctataagttccattaaggataaaaatgaagatggaagattcactgttttcttaaacaaaagtgccaagcacctctctctgcacattgtgccctcccagcctggagactctgcagtgtacttctgtgcagcaagcgaggatgagaaattaacctttgggactggaacaagactcaccatcatacccaAT(SEQ ID NO:35)

[0252] E. β-chain V(D)J region polynucleotide sequence:

[0253] GatactggagtctcccagaaccccagacacaagatcacaaagaggggacagaatgtaactttcaggtgtgatccaatttctgaacacaaccgcctttattggtaccgacagaccctggggcagggcccagagtttctgacttacttccagaatgaagctcaactagaaaaatcaaggctgctcagtgatcggttctctgcagagaggcctaagggatctttctccaccttggagatccagcgcacagagcagggggactcggccatgtatctctgtgccagcagcttgatggcagagcagtacttcgggccgggcaccaggctcacggtcacagAGGACCT(SEQ ID NO:36)

[0254] 19. PAP-TCR-225

[0255] A. Target peptide sequence: LLLARAASLSL (SEQ ID NO:59) ("PAP_A2_21").

[0256] B. VαCDR3 region polypeptide sequence: CAASVDEKLTF (SEQ ID NO:70)

[0257] C.VβV region polypeptide sequence: CASSLQVEQFF (SEQ ID NO: 101)

[0258] D. α-chain V(D)J region polynucleotide sequence:

[0259] GaccagcaagttaagcaaaattcaccatccctgagcgtccaggaaggaagaatttctattctgaactgtgactatactaacagcatgtttgattatttcctatggtacaaaaaataccctgctgaaggtcctacattcctgatatctataagttccattaaggataaaaatgaagatggaagattcactgttttcttaaacaaaagtgccaagcacctctctctgcacattgtgccctcccagcctggagactctgcagtgtacttctgtgcagcaagcgtcgatgagaaattaacctttgggactggaacaagactcaccatcatacccaAT (SEQ ID NO: 37)

[0260] E. β-chain V(D)J region polynucleotide sequence:

[0261] GatactggagtctcccagaaccccagacacaagatcacaaagaggggacagaatgtaactttcaggtgtgatccaatttctgaacacaaccgcctttattggtaccgacagaccctggggcagggcccagagtttctgacttacttccagaatgaagctcaactagaaaaatcaaggctgctcagtgatcggttctctgcagagaggcctaagggatctttctccaccttggagatccagcgcacagagcagggggactcggccatgtatctctgtgccagcagcttacaggttgagcagttcttcgggccagggacacggctcaccgtgctagAGGACCT (SEQ ID NO: 38)

[0262] 20. PAP-TCR-226

[0263] A. Target peptide sequence: LLLARAASLSL (SEQ ID NO: 59) ("PAP_A2_21").

[0264] B. Vα CDR3 region polypeptide sequence: CAASADEKLTF (SEQ ID NO: 92)

[0265] C. VβV region polypeptide sequence: CASSLFEEQYF (SEQ ID NO: 102)

[0266] D.α chain V(D)J region polynucleotide sequence:

[0267] Gaccagcaagttaagcaaaattcaccatccctgagcgtccaggaaggaagaatttctattctgaactgtgactatactaacagcatgtttgattatttcctatggtacaaaaaataccctgctgaaggtcctacattcctgatatctataagttccattaaggataaa aatgaagatggaagattcactgttttcttaaacaaaagtgccaagcacctctctctgcacattgtgccctcccagcctggagactctgcagtgtacttctgtgcagcaagcgcagacgagaaattaacctttgggactggaacaagactcaccatcatacccaAT(SEQ ID NO:39)

[0268] E.β chain V(D)J region polynucleotide sequence:

[0269] Gatactggagtctcccagaaccccagacacaagatcacaaagaggggacagaatgtaactttcaggtgtgatccaatttctgaacacaaccgcctttattggtaccgacagac cctggggcagggcccagtttctgacttacttccagaatgaagctcaactagaaaaatcaaggctgctcagtgatcggttctctgcagagaggcctaagggatctttctccac cttggagatccagcgcacagagcagggggactcggccatgtatctctgtgccagcagcttatttgaggagcagtacttcgggccgggcaccaggctcacggtcacagAGGACCT (SEQ ID NO: 40)

[0270] 21.PAP-TCR-228

[0271] A. Target peptide sequence: KVYDPLYCESV (SEQ ID NO: 58) ("PAP_A2_20").

[0272] B. Vα CDR3 region polypeptide sequence: CAGHLNARLMF (SEQ ID NO: 103)

[0273] C. VβV region polypeptide sequence: CSAPRDGVYTF (SEQ ID NO: 104)

[0274] D.α chain V(D)J region polynucleotide sequence:

[0275] Gctcagtcagtggctcagccggaagatcaggtcaacgttgctgaagggaatcctctgactgtgaaatgcacctattcagtctctggaaacccttatctttttggtatgttcaataccccaaccgaggcctccagttccttctgaaatacatcacaggggataacctggt taaaggcagctatggctttgaagctgaatttaacaagagccaaacctccttccacctgaagaaaccatctgcccttgtgagcgactccgctttgtacttctgtgctggacatctgaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaAT(SEQ ID NO:41)

[0276] E.β chain V(D)J region polynucleotide sequence:

[0277] Ggtgctgtcgtctctcaacatccgagcagggttatctgtaagagtggaacctctgtgaagatcgagtgccgttccctggactttcaggccacaactatgtttggtatcgtcagttcccgaaacagagtctcatgctgatggcaacttccaatgagggctccaaggccacatacg agcaaggcgtcgagaaggacaagtttctcatcaaccatgcaagcctgaccttgtccactctgacagtgaccagtgcccatcctgaagacagcagcttctacatctgcagtgctccccgggatggcgtatacaccttcggttcggggaccaggttaaccgttgtagAGGACCT(SEQ ID NO:42)

[0278] Table B: Exemplary mutant TCR embodiments of the invention

[0279] Illustrative examples of PAP-TCR-156 mutants are provided below. As described above in Table A, these TCR embodiments of the invention target a PAP peptide having the following sequence: TLMSAMTNL (SEQ ID NO: 48).

[0280] 1.PAP-TCR-156-4(PAP-TCR-156-aCDR3-R7A)

[0281] A. αCDR1 polypeptide sequence: DRGSQS (SEQ ID NO: 105)

[0282] B. αCDR2 polypeptide sequence: IYSNGD (SEQ ID NO: 106)

[0283] C. αCDR3 polypeptide sequence: CAVNNAALMF (SEQ ID NO: 107)

[0284] D. βCDR1 polypeptide sequence: SGDLS (SEQ ID NO: 108)

[0285] E.βCDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0286] F.βCDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0287] G. TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagagggagccattgcctctctcaactgcactta cagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccGCCctcatgtttggagatggaactcagctggtggtgaagcccaat(SEQ ID NO:115)

[0288] H. TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT(SEQ IDNO:116)

[0289] 2. PAP-TCR-156-29 (PAP-TCR-156-aCDR1-S4E)

[0290] A. αCDR1 polypeptide sequence: DRGEQS(SEQ ID NO:139)

[0291] B. αCDR2 polypeptide sequence: IYSNGD(SEQ ID NO:106)

[0292] C. αCDR3 polypeptide sequence: CAVNNAALMF(SEQ ID NO:107)

[0293] D. β CDR1 polypeptide sequence: SGDLS (SEQ ID NO: 108)

[0294] E. β CDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0295] F. β CDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0296] G. TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagagggagccattgcctctctcaactgcactta cagtgaccgaggtGAAcagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat (SEQ ID NO: 117)

[0297] H. TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaacta aacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT (SEQ IDNO: 118)

[0298] 3.PAP-TCR-156-30(PAP-TCR-156-aCDR1-S6E)

[0299] A. αCDR1 polypeptide sequence: DRGSQE (SEQ ID NO: 140)

[0300] B. αCDR2 polypeptide sequence: IYSNGD (SEQ ID NO: 106)

[0301] C. αCDR3 polypeptide sequence: CAVNNAALMF (SEQ ID NO: 107)

[0302] D. βCDR1 polypeptide sequence: SGDLS (SEQ ID NO: 108)

[0303] E.βCDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0304] F.βCDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0305] G.TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagaggggagccattgcctctctcaactgcactta cagtgaccgaggttcccagGAAttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaag ccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat(SEQ ID NO:119)

[0306] H.TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttcct gacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT(SEQ IDNO:120)

[0307] 4.PAP-TCR-156-31(PAP-TCR-156-aCDR1-S6H)

[0308] A. αCDR1 polypeptide sequence: DRGSQH (SEQ ID NO: 141)

[0309] B. αCDR2 polypeptide sequence: IYSNGD (SEQ ID NO: 106)

[0310] C. αCDR3 polypeptide sequence: CAVNNAALMF (SEQ ID NO: 107)

[0311] D. βCDR1 polypeptide sequence: SGDLS (SEQ ID NO: 108)

[0312] E.βCDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0313] F.βCDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0314] G. TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagagggagccattgcctctctcaactgcactta cagtgaccgaggttcccagCACttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat(SEQ ID NO:121)

[0315] H. TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT(SEQ IDNO:122)

[0316] 5. PAP-TCR-156-32 (PAP-TCR-156-aCDR1-S6N)

[0317] A. αCDR1 polypeptide sequence: DRGSQN(SEQ ID NO:142)

[0318] B. αCDR2 polypeptide sequence: IYSNGD(SEQ ID NO:106)

[0319] C. αCDR3 polypeptide sequence: CAVNNAALMF(SEQ ID NO:107)

[0320] D. β CDR1 polypeptide sequence: SGDLS (SEQ ID NO: 108)

[0321] E. β CDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0322] F. β CDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0323] G. TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagagggagccattgcctctctcaactgcactta cagtgaccgaggttcccagAATttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat (SEQ ID NO: 123)

[0324] H. TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT (SEQ IDNO: 124)

[0325] 6.PAP-TCR-156-33(PAP-TCR-156-aCDR2-N4H)

[0326] A. αCDR1 polypeptide sequence: DRGSQS (SEQ ID NO: 105)

[0327] B. αCDR2 polypeptide sequence: IYSHGD (SEQ ID NO: 143)

[0328] C. αCDR3 polypeptide sequence: CAVNNAALMF (SEQ ID NO: 107)

[0329] D. βCDR1 polypeptide sequence: SGDLS (SEQ ID NO: 108)

[0330] E.βCDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0331] F.βCDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0332] G.TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagaggggagccattgcctctctcaactgcactta cagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccCACggtgacaaagaagatggaaggtttacagcacagctcaataaag ccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat(SEQ ID NO:125)

[0333] H.TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttcct gacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT(SEQ IDNO:126)

[0334] 7.PAP-TCR-156-34(PAP-TCR-156-aCDR2-D6N)

[0335] A. αCDR1 polypeptide sequence: DRGSQS (SEQ ID NO: 105)

[0336] B. αCDR2 polypeptide sequence: IYSNGN (SEQ ID NO: 106)

[0337] C. αCDR3 polypeptide sequence: CAVNNAALMF (SEQ ID NO: 107)

[0338] D. βCDR1 polypeptide sequence: SGDLS (SEQ ID NO: 108)

[0339] E.βCDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0340] F.βCDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0341] G. TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagagggagccattgcctctctcaactgcactta cagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatact ccaatggtAATaaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat(SEQ ID NO:127)

[0342] H. TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT(SEQ IDNO:128)

[0343] 8. PAP - TCR - 156 - 35 (PAP - TCR - 156 - bCDR1 - S1H)

[0344] A. αCDR1 polypeptide sequence: DRGSQS(SEQ ID NO:105)

[0345] B. αCDR2 polypeptide sequence: IYSNGD(SEQ ID NO:106)

[0346] C. αCDR3 polypeptide sequence: CAVNNAALMF(SEQ ID NO:107)

[0347] D. β CDR1 polypeptide sequence: HGDLS (SEQ ID NO: 110)

[0348] E. β CDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0349] F. β CDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0350] G. TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagagggagccattgcctctctcaactgcactta cagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat (SEQ ID NO: 129)

[0351] H. TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggCATggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT (SEQ IDNO: 130)

[0352] 9.PAP-TCR-156-36(PAP-TCR-156-bCDR1-S1N)

[0353] A. αCDR1 polypeptide sequence: DRGSQS (SEQ ID NO: 105)

[0354] B. αCDR2 polypeptide sequence: IYSNGD (SEQ ID NO: 106)

[0355] C. αCDR3 polypeptide sequence: CAVNNAALMF (SEQ ID NO: 107)

[0356] D.βCDR1 polypeptide sequence: NGDLS (SEQ ID NO: 111)

[0357] E.βCDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0358] F.βCDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0359] G.TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagaggggagccattgcctctctcaactgcactta cagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaag ccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat(SEQ ID NO:131)

[0360] H.TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggAATggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttcct gacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT(SEQ IDNO:132)

[0361] 10.PAP-TCR-156-37(PAP-TCR-156-bCDR2-Y1H)

[0362] A. αCDR1 polypeptide sequence: DRGSQS (SEQ ID NO: 105)

[0363] B. αCDR2 polypeptide sequence: IYSNGD (SEQ ID NO: 106)

[0364] C. αCDR3 polypeptide sequence: CAVNNAALMF (SEQ ID NO: 107)

[0365] D. βCDR1 polypeptide sequence: SGDLS (SEQ ID NO: 108)

[0366] E.βCDR2 polypeptide sequence: HYNGEE (SEQ ID NO: 112)

[0367] F.βCDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO: 81)

[0368] G. TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagagggagccattgcctctctcaactgcactta cagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactca gctggtggtgaagcccaat (SEQ ID NO:133)

[0369] H. TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagCATtataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT (SEQ ID NO:134)

[0370] 11. PAP-TCR-156-38 (PAP-TCR-156-bCDR2-N3H)

[0371] A. αCDR1 polypeptide sequence: DRGSQS (SEQ ID NO:105)

[0372] B. αCDR2 polypeptide sequence: IYSNGD (SEQ ID NO:106)

[0373] C. α CDR3 polypeptide sequence: CAVNNAALMF (SEQ ID NO:107)

[0374] D. β CDR1 polypeptide sequence: SGDLS (SEQ ID NO:108)

[0375] E. β CDR2 polypeptide sequence: YYHGEE (SEQ ID NO:113)

[0376] F. β CDR3 polypeptide sequence: CASSVAGSPEAFF (SEQ ID NO:81)

[0377] G. TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagagggagccattgcctctctcaactgcactta cagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaagccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat(SEQ ID NO:135)

[0378] H. TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattatCATggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctgaagctttctttggacaaggcaccagactcacagttgtagagGACCT(SEQ IDNO:136)

[0379] 12.PAP-TCR-156-39(PAP-TCR-156-bCDR3-E10H)

[0380] A. αCDR1 polypeptide sequence: DRGSQS (SEQ ID NO: 105)

[0381] B. αCDR2 polypeptide sequence: IYSNGD (SEQ ID NO: 106)

[0382] C. αCDR3 polypeptide sequence: CAVNNAALMF (SEQ ID NO: 107)

[0383] D. βCDR1 polypeptide sequence: SGDLS (SEQ ID NO: 108)

[0384] E.βCDR2 polypeptide sequence: YYNGEE (SEQ ID NO: 109)

[0385] F.βCDR3 polypeptide sequence: CASSVAGSPHAFF (SEQ ID NO: 114)

[0386] G.TCRα polynucleotide sequence: cagaaggaggtggagcagaattctggacccctcagtgttccagaggggagccattgcctctctcaactgcactta cagtgaccgaggttcccagtccttcttctggtacagacaatattctgggaaaagccctgagttgataatgttcatatactccaatggtgacaaagaagatggaaggtttacagcacagctcaataaag ccagccagtatgtttctctgctcatcagagactcccagcccagtgattcagccacctacctctgtgccgtgaacaatgccagactcatgtttggagatggaactcagctggtggtgaagcccaat(SEQ ID NO:137)

[0387] H.TCRβ polynucleotide sequence: gattctggagtcacacaaaccccaaagcacctgatcacagcaactggacagcgagtgacgctgagatgctcc cctaggtctggagacctctctgtgtactggtaccaacagagcctggaccagggcctccagttcctcattcagtattataatggagaagagagagcaaaaggaaacattcttgaacgattctccgcacaacagttccctgacttgcactctgaactaaacctgagctctctggagctgggggactcagctttgtatttctgtgccagcagcgttgcagggtcccctCATgctttctttggacaaggcaccagactcacagttgtagagGACCT(SEQ IDNO:138)

[0388] Cited references:

[0389] 1. S.A. Rosenberg, A new era for cancer immunotherapy based on the genes that encode cancer antigens. Immunity 10, 281 - 287 (1999).

[0390] 2. R. Srinivasan, J.D. Wolchok, Tumor antigens for cancer immunotherapy: therapeutic potential of xenogeneic DNA vaccines. J Transl Med 2, 12 (2004).

[0391] 3. C.S. Hinrichs, N.P. Restifo, Reassessing target antigens for adoptive T - cell therapy. Nat Biotechnol 31, 999 - 1008 (2013).

[0392] 4. L.A. Johnson, C.H. June, Driving gene - engineered T cell immunotherapy of cancer.

[0393] Cell Res 27,38-58(2017).

[0394] 5.R.A.Morgan et al.,Cancer regression in patients after transfer ofgenetically engineered lymphocytes.Science 314,126-129(2006).

[0395] 6.T.Chodon et al.,Adoptive transfer of MART-1T-cell receptortransgenic lymphocytes and dendritic cell vaccination in patients withmetastatic melanoma.Clin Cancer Res 20,

[0396] 2457-2465(2014).

[0397] 7.P.F.Robbins et al.,Single and dual amino acid substitutions in TCRCDRs can enhance antigen-specific T cell functions.J Immunol 180,6116-6131(2008).

[0398] 8.A.G.Chapuis et al.,T cell receptor gene therapy targeting WT1prevents acute myeloid leukemia relapse post-transplant.Nat Med 25,1064-1072(2019).

[0399] 9.L.A.Johnson et al.,Gene therapy with human and mouse T-cellreceptors mediates cancer regression and targets normal tissues expressingcognate antigen.Blood 114,535-546(2009).

[0400] 10.M.R.Parkhurst et al.,T cells targeting carcinoembryonic antigencan mediate regression of metastatic colorectal cancer but induce severetransient colitis.Mol Ther 19,620-626 (2011).

[0402] 11.R.J.Rebello et al.,Prostate cancer.Nat Rev Dis Primers 7,9(2021).

[0403] 12.G.T.Consortium,The GTEx Consortium atlas of genetic regulatoryeffects across human tissues.Science 369,1318-1330(2020).

[0404] 13.A.C.Jobsis,G.P.De Vries,A.E.Meijer,J.S.Ploem,Theimmunohistochemical detection of prostatic acid phosphatase:its possibilitiesand limitations in tumour histochemistry.Histochem J 13,961-973(1981).

[0405] 14.B.Seamonds et al.,Evaluation of prostate-specific antigen andprostatic acid phosphatase as prostate cancer markers.Urology 28,472-479(1986).

[0406] 15.P.W.Kantoff et al.,Sipuleucel-T immunotherapy for castration-resistant prostate cancer.

[0407] N Engl J Med 363,411-422(2010).

[0408] 16.A.S.Kibel et al.,Videos of Sipuleucel-T Programmed T Cells LysingCells That Express Prostate Cancer Target Antigens.J Natl Cancer Inst10.1093 / jnci / djab025(2021).

[0409] 17.I.Hoof et al.,NetMHCpan,a method for MHC class I bindingprediction beyond humans.

[0410] Immunogenetics 61,1-13(2009).

[0411] 18.V.Jurtz et al.,NetMHCpan-4.0:Improved Peptide-MHC Class IInteraction Predictions Integrating Eluted Ligand and Peptide BindingAffinity Data.J Immunol 199,3360-3368 (2017).

[0413] 19.T.J.O'Donnell et al.,MHCflurry:Open-Source Class I MHC BindingAffinity Prediction.Cell Syst 7,129-132 e124(2018).

[0414] 20.L.Fong et al.,Dendritic cell-based xenoantigen vaccination forprostate cancer immunotherapy.J Immunol 167,7150-7156(2001).

[0415] 21.J.T.Becker et al.,DNA vaccine encoding prostatic acid phosphatase(PAP)elicits long-

[0416] term T-cell responses in patients with recurrent prostate cancer.JImmunother 33,639-647(2010).

[0417] 22.D.K.Wells et al.,Key Parameters of Tumor Epitope ImmunogenicityRevealed Through a Consortium Approach Improve Neoantigen Prediction.Cell183,818-834 e813(2020).23.W.J.Storkus,R.D.Salter,P.Cresswell,J.R.Dawson,Peptide-induced modulation of target cell sensitivity to natural killing.JImmunol 149,1185-1190(1992).

[0418] 24.D.F.Hunt et al.,Characterization of peptides bound to the class IMHC molecule HLA-

[0419] A2.1 by mass spectrometry.Science 255,1261-1263(1992).

[0420] 25.V.H.Engelhard,Structure of peptides associated with MHC class Imolecules.Curr Opin Immunol 6,13-23(1994).

[0421] 26.M.Bassani-Sternberg et al.,Soluble plasma HLA peptidome as apotential source for cancer biomarkers.Proc Natl Acad Sci U S A 107,18769-18776(2010).

[0422] 27.K.A.K.Finton et al.,ARTEMIS:A Novel Mass-Spec Platform for HLA-Restricted Self and Disease-Associated Peptide Discovery.Front Immunol 12,658372(2021).

[0423] 28.K.Cao et al.,Analysis of the frequencies of HLA-A,B,and C allelesand haplotypes in the five major ethnic groups of the United States revealshigh levels of diversity in these loci and contrasting distribution patternsin these populations.Hum Immunol 62,1009-1030(2001).

[0424] 29.R.Vita et al.,The Immune Epitope Database(IEDB):2018update.Nucleic Acids Res

[0425] 47,D339-D343(2019).

[0426] 30.P.A.Nesterenko et al.,Droplet-based mRNA sequencing of fixed andpermeabilized cells by CLInt-seq allows for antigen-specific TCR cloning.ProcNatl Acad Sci U S A 118(2021).

[0428] 31.G.X.Zheng et al.,Massively parallel digital transcriptionalprofiling of single cells.Nat Commun 8,14049(2017).

[0429] 32.C.M.Britten et al.,The use of HLA-A*0201-transfected K562 asstandard antigen-

[0430] presenting cells for CD8(+)T lymphocytes in IFN-gamma ELISPOTassays.J Immunol Methods 259,95-110(2002).

[0431] 33.A.W.Purcell,S.H.Ramarathinam,N.Ternette,Mass spectrometry-basedidentification of MHC-bound peptides for immunopeptidomics.Nat Protoc 14,1687-1707(2019).34.T.L.Madden,R.L.Tatusov,J.Zhang,Applications of networkBLAST server.Methods Enzymol 266,131-141(1996).

[0432] 35.R.A.Henderson et al.,HLA-A2.1-associated peptides from a mutantcell line:a second pathway of antigen presentation.Science 255,1264-1266(1992).

[0433] 36.W.Chour et al.,Shared Antigen-specific CD8 + T cellResponses Against the SARS-COV-2 Spike Protein in HLA-A*02:01 COVID-19Participants.medRxiv

[0434] 10.1101 / 2020.05.04.20085779,2020.2005.2004.20085779(2020).

[0435] 37.P.G.Maslak et al.,Vaccination with synthetic analog peptidesderived from WT1

[0436] oncoprotein induces T-cell responses in patients with completeremission from acute myeloid leukemia.Blood 116,171-179(2010).

[0437] 38.T.Dao et al.,Targeting the intracellular WT1 oncogene product witha therapeutic human antibody.Sci Transl Med 5,176ra133(2013).

[0438] 39.C.G.Jakob,K.Lewinski,R.Kuciel,W.Ostrowski,L.Lebioda,Crystalstructure of human prostatic acid phosphatase.Prostate 42,211-218(2000).

[0439] 40.F.Maley,R.B.Trimble,A.L.Tarentino,T.H.Plummer,Jr.,Characterizationof glycoproteins and their associated oligosaccharides through the use ofendoglycosidases.

[0440] Anal Biochem 180,195-204(1989).

[0441] 41.J.C.Skipper et al.,An HLA-A2-restricted tyrosinase antigen onmelanoma cells results from posttranslational modification and suggests anovel pathway for processing of membrane proteins.J Exp Med 183,527-534(1996).

[0442] 42.K.K.Yu et al.,Use of mutated self-cleaving 2A peptides as amolecular rheostat to direct simultaneous formation of membrane and secretedanti-HIV immunoglobulins.PLoS One 7,e50438(2012).

[0443] 43.P.Batard et al.,Dextramers:new generation of fluorescent MHC classI / peptide multimers for visualization of antigen-specific CD8+T cells.JImmunol Methods 310,

[0444] 136-148(2006).

[0445] 44.S.S.Pinho,C.A.Reis,Glycosylation in cancer:mechanisms and clinicalimplications.

[0446] Nat Rev Cancer 15,540-555(2015).

[0447] 45.S.Mereiter,M.Balmana,D.Campos,J.Gomes,C.A.Reis,Glycosylation inthe Era of Cancer-Targeted Therapy:Where Are We Heading?Cancer Cell 36,6-16(2019).

[0448] 46.D.H.Busch,E.G.Pamer,T cell affinity maturation by selectiveexpansion during infection.J Exp Med 189,701-710(1999).

[0449] 47.S.Thomas et al.,Human T cells expressing affinity-matured TCRdisplay accelerated responses but fail to recognize low density of MHC-peptide antigen.Blood 118,319-329 (2011).

[0451] 48.Y.Zhao et al.,High-affinity TCRs generated by phage displayprovide CD4+T cells with the ability to recognize and kill tumor cell lines.JImmunol 179,5845-5854(2007).49.P.D.Holler et al.,In vitro evolution of a Tcell receptor with high affinity for peptide / MHC.Proc Natl Acad Sci U S A 97,5387-5392(2000).

[0452] 50.L.Klein,B.Kyewski,P.M.Allen,K.A.Hogquist,Positive and negativeselection of the T cell repertoire:what thymocytes see(and don't see).Nat RevImmunol 14,377-391 (2014).

[0454] 51.C.S.Seet et al.,Generation of mature T cells from humanhematopoietic stem and progenitor cells in artificial thymic organoids.NatMethods 14,521-530(2017).

[0455] 52.S.Shukla et al.,Progenitor T-cell differentiation fromhematopoietic stem cells using Delta-like-4 and VCAM-1.Nat Methods 14,531-538(2017).

[0456] 53.J.Lanoix et al.,Comparison of the MHC I Immunopeptidome Repertoireof B-Cell Lymphoblasts Using Two Isolation Methods.Proteomics 18,e1700251(2018).

[0457] 54.M.Bassani-Sternberg et al.,Direct identification of clinicallyrelevant neoepitopes presented on native human melanoma tissue by massspectrometry.Nat Commun 7, 13404(2016).

[0459] 55.J.G.Abelin et al.,Mass Spectrometry Profiling of HLA-AssociatedPeptidomes in Mono-allelic Cells Enables More Accurate EpitopePrediction.Immunity 46,315-326 (2017).

[0461] 56.P.A.Nesterenko et al.,HLA-A*02:01 restricted T cell receptorsagainst the highly conserved SARS-CoV-2 polymerase cross-react with humancoronaviruses.Cell Rep 37, 110167(2021).

[0463] 57.B.Rodenko et al.,Generation of peptide-MHC class I complexesthrough UV-mediated ligand exchange.Nat Protoc 1,1120-1132(2006).

Claims

1. A composition of matter comprising a polynucleotide encoding a T cell receptor (TCR) α chain polypeptide and / or a TCR β chain polypeptide; wherein the polynucleotide is placed in a vector, and when the vector is transduced into a CD8 + When the TCRα chain polypeptide and / or the TCRβ chain polypeptide encoded by the polynucleotide is expressed in the CD8 + T cell receptors are formed on T cells, and the T cell receptors recognize polypeptide epitopes of human prostatic acid phosphatase (PAP).

2. The composition according to claim 1, wherein: The T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase in combination with human leukocyte antigen HLA-A*02:01; and / or The T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase selected from the following: ILLWQPIPV (SEQ ID NO: 47), TLMSAMTNL (SEQ ID NO: 48), IRSTDVDRTL (SEQ ID NO: 52), IMYSAHDTTV (SEQ ID NO: 55), KVYDPLYCESV (SEQ ID NO: 58), LLLARAASLSL (SEQ ID NO: 59) and LLFFWLDRSVLA (SEQ ID NO: 62).

3. A composition according to claim 1, wherein the polynucleotide encodes the amino acids of the TCR variable region, and the vector comprises a vector polynucleotide encoding a TCR constant region fused in frame with the TCR variable region.

4. The composition of claim 3, wherein the polynucleotide is placed in a cell.

5. The composition according to claim 4, wherein the cells are human CD8 + T cells.

6. The composition according to claim 5, wherein the CD8 + T cells are obtained from an individual diagnosed with a cancer expressing human prostatic acid phosphatase antigen; and the CD8 + T cells are transduced with a vector comprising a polynucleotide encoding a TCR Vα polypeptide in combination with a polynucleotide encoding a TCR Vβ polypeptide, such that the heterologous TCR is expressed in the CD8 + The heterologous TCR recognizes a human prostatic acid phosphatase peptide associated with a human leukocyte antigen expressed on the surface of the cancer cell.

7. The composition of claim 6, wherein the cancer is prostate cancer.

8. The composition according to claim 1, wherein: The polynucleotide encodes a segment of at least 100 amino acids having at least 98% sequence identity to the amino acids encoded by SEQ ID NO: 1-SEQ ID NO:

42.

9. The composition of claim 8, wherein the T cell receptor (TCR) α chain polypeptide and / or the TCR β chain polypeptide encoded by the polynucleotide comprises an amino acid substitution mutation.

10. The composition of claim 8, wherein the polynucleotide encodes a segment of at least 10 amino acids encoded by SEQ ID NO: 115-SEQ ID NO:

138.

11. A method for inhibiting the growth of prostate cancer cells, comprising: The prostate cancer cells are transduced with a CD8 T cell receptor (TCR) α chain polypeptide and a TCR β chain polypeptide. + T cell combination; wherein when transduced into the CD8 + T cells and in the CD8 + When expressed in T cells, the α chain polypeptide and the TCR β chain polypeptide can form a T cell receptor, and the T cell receptor recognizes a polypeptide epitope on human prostatic acid phosphatase (PAP) expressed on the prostate cancer cells, thereby inhibiting the growth of the prostate cancer cells.

12. The method according to claim 11, wherein: The T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase in combination with human leukocyte antigen HLA-A*02:01; and / or The T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase selected from the following: ILLWQPIPV (SEQ ID NO: 47), TLMSAMTNL (SEQ ID NO: 48), IRSTDVDRTL (SEQ ID NO: 52), IMYSAHDTTV (SEQ ID NO: 55), KVYDPLYCESV (SEQ ID NO: 58), LLLARAASLSL (SEQ ID NO: 59) and LLFFWLDRSVLA (SEQ ID NO: 62).

13. The method according to claim 12, wherein the T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase in combination with human leukocyte antigen HLA-A*02:

01.

14. The method of claim 13, wherein the T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase selected from the group consisting of ILLWQPIPV (SEQ ID NO: 47), TLMSAMTNL (SEQ ID NO: 48), IRSTDVDRTL (SEQ ID NO: 52), IMYSAHDTTV (SEQ ID NO: 55), KVYDPLYCESV (SEQ ID NO: 58), LLLARAASLSL (SEQ ID NO: 59) and LLFFWLDRSVLA (SEQ ID NO: 62).

15. The method according to claim 14, wherein the T cell receptor recognizes a polypeptide epitope of human prostatic acid phosphatase comprising TLMSAMTNL (SEQ ID NO: 48).

16. The method according to claim 11, wherein CD8 + T cells are combined in vivo to treat individuals with prostate cancer.

17. The method of claim 12, wherein the polynucleotide encodes a segment of at least 100 amino acids having at least 98% sequence identity to the amino acids encoded by SEQ ID NO: 1-SEQ ID NO:

42.

18. The method of claim 17, wherein the T cell expresses a T cell receptor comprising a segment of at least 10 amino acids encoded by SEQ ID NO: 115-SEQ ID NO:

138.

19. A method of evaluating a patient's immune response to prostate cancer or prostate cancer vaccination, the method comprising observing the induction or activation of T cells obtained from a patient having prostate cancer or having prostate cancer vaccination, wherein: The induction or activation of the T cells is observed in response to exposure of the T cells to a polypeptide epitope present on human prostatic acid phosphatase (PAP); and The observed induction or activation of T cells provides evidence of an immune response in the patient to prostate cancer or prostate cancer vaccination.

20. The method of claim 19, wherein the T cells express a T cell receptor that recognizes a polypeptide epitope of human prostatic acid phosphatase, the polypeptide epitope being selected from the group consisting of ILLWQPIPV (SEQ ID NO: 47), TLMSAMTNL (SEQ ID NO: 48), IRSTDVDRTL (SEQ ID NO: 52), IMYSAHDTTV (SEQ ID NO. 55), KVYDPLYCESV (SEQ ID NO: 58), LLLARAASLSL (SEQ ID NO: 59) and LLFFWLDRSVLA (SEQ ID NO: 62).

Images