One-tube method detection system based on Cas protein modification and application thereof
By inserting antigenic epitope GCN4 into the Cas protein and introducing scFv-Rad51 protein, the problem of RPA amplification is solved, the sensitivity and reliability of the detection are improved, and a simplified operating process and applicable POCT application are achieved.
Patent Information
- Application Number
- CN202510316812.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-18
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-03-18
AI Technical Summary
In the existing one-tube detection system, the competitive problem between RPA amplification and Cas12a cutting leads to extremely poor detection capabilities, and the traditional two-step detection method is complex in operation and not widely applicable.
By inserting antigen epitope GCN4 into the Cas protein, its cis cleavage activity is weakened, the accumulation of RPA amplification products is achieved, and the trans cleavage ability of Cas12a is enhanced by introducing the scFv-Rad51 protein, forming the Cas12a-GCN4-scFv-Rad51 complex, improving detection sensitivity.
The compatibility of RPA amplification and Cas12a cleavage is achieved, which improves detection sensitivity and reliability, simplifies the operation process, and is suitable for POCT applications.
Smart Images

Figure CN120098966A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of biological detection technology, and in particular to a one-tube detection system based on Cas protein modification and its application. Background Art
[0002] In recent decades, viruses such as SARS-CoV-2, HIV, and HPV have caused large-scale epidemic outbreaks. The world is facing a severe crisis of viral infection and economic losses. Therefore, there is an urgent need to develop a rapid, sensitive, and accurate detection method to promptly respond to early detection of viral infection and reduce the risk of disease transmission. At present, most people still use fluorescent quantitative PCR detection and tissue / cell microscopy for early diagnosis, but these methods are usually time-consuming and labor-intensive, and require reliance on professional operators and laboratory equipment. For some special scenarios where professional instruments are not available, such as mountainous areas with scarce resources, traditional detection methods are not suitable for the screening needs of POCT (point-of-care testing).
[0003] Recombinase polymerase amplification (RPA) technology can achieve efficient amplification of nucleic acids under isothermal conditions of 37-42°C by using enzymes with different characteristics and specific primers. It is easy to operate and combined with fluorescent probes or lateral flow assays (LFA). Compared with traditional fluorescent quantitative PCR detection technology, it is more suitable for POCT detection. However, both the probe method and the test strip method require the use of expensive specific probes, and the detection cost is high. In addition, the specificity of RPA amplification is not high, false positives are prone to occur, and the test results are unstable.
[0004] CRISPR (Clustered regularly interspaced palindromic repeat) is an acquired immune system in bacteria and archaea. The system can specifically target complementary nucleotide sequences under the guidance of guide RNA. After the CRISPR-Cas12a protein specifically binds and cuts the target DNA, its nonspecific trans-cutting activity is activated, allowing it to cut the surrounding ssDNA. Taking advantage of this property of the Cas12a protein, RPA isothermal amplification and Cas12a cutting are combined. The advantages of this detection method are reflected in: on the one hand, the specific recognition and cutting of the RPA amplification product and Cas12a increase the specificity of the detection; on the other hand, the trans-cutting activity of CRISPR-Cas12a can trans-cut a large number of ssDNA probes in a short time to achieve the purpose of amplifying the signal and improve the sensitivity of the detection. Based on this principle, the DETECTR detection method has been developed, and the technology has been successfully applied to the detection of various viruses.
[0005] However, the DETECTR detection method is a two-step reaction method that first performs RPA pre-amplification and then CRISPR cutting. This method requires setting the initial RPA amplification time, which results in a longer overall detection time. Secondly, it involves the transfer of RPA amplification products, and the opening of the lid in the middle will greatly increase the possibility of contamination and false positives. Later, scientists also developed a method to add the RPA amplification system to the bottom of the tube and the CRISPR cutting system to the tube cap. Although this method can avoid the risk of contamination to a certain extent, it is still a traditional two-step detection method, and it has relatively high operational requirements for technicians and is not universal.
[0006] To solve this problem, scientists are committed to developing a "one-tube" detection method, which means that DNA amplification and CRISPR-mediated cleavage are performed simultaneously in a single reaction tube. This integrated method aims to simplify the workflow and make the diagnostic procedure more suitable for POCT applications. However, the development process faces great challenges because the highly sensitive Cas12a can quickly cut dsDNA substrates and single-stranded ssDNA primers, and RPA amplification and Cas12a cleavage are competitive, so that the accumulation of RPA products and Cas12a cleavage cannot reach a balance. The accumulation of RPA products in the one-tube reaction is too little, and the detection ability is extremely poor (Lin, M., 2022). Current reports have developed a one-tube detection system using suboptimal protospacer adjacent motifs (subPAMs), which reduces Cas12a binding affinity and minimizes cis cleavage through subPAM (Lu, S., 2022). However, there are many types of subPAMs, which require a lot of screening, and this method is not suitable for other Cas variants, such as Cas12b. Other scientists have developed a PAM-less strategy to attenuate Cas12a cis-cutting using no PAM restriction (Ding, X., 2020), but this approach also faces challenges in scalability and adaptability in other CRISPR detection systems.
[0007] Therefore, the development of a universal and universally applicable one-tube detection system that can be adapted to different Cas systems is crucial for advancing CRISPR-Cas12a-based diagnostics. Summary of the invention
[0008] The purpose of this application is to overcome the incompatibility problem of RPA amplification and Cas12a cutting faced by the above-mentioned one-tube method, and to provide a one-tube method detection system based on Cas protein modification and its application. This application innovatively starts with Cas protein, transforms Cas protein through protein engineering strategy, successfully overcomes the competitive problem between RPA amplification and Cas protein cutting, and this application names the one-tube method detection system based on Cas protein modification ECOT (Engineered Cas12afor One-pot Test), which has the characteristics of rapid response, high sensitivity, high reliability and easy operation, and has important practical significance for the detection, prevention and treatment of early infection.
[0009] To achieve the above purpose, the technical solution adopted by this application is:
[0010] The present application provides a Cas protein, wherein an antigenic epitope is inserted into the Cas protein to weaken the cis-cleavage activity of the Cas protein.
[0011] In the present application, an antigen epitope is inserted into the Cas protein. After the Cas protein is modified, the Cas protein exhibits a weakened cis-cutting activity, which allows the RPA amplification product to accumulate, thereby continuously activating the side-cutting activity of the Cas protein.
[0012] As a preferred embodiment of the Cas protein described in the present application, the Cas protein is:
[0013] An antigen epitope is inserted after the active center of the RuvC protein of the Cas protein to weaken the cis-cutting activity of the Cas protein.
[0014] Inserting an antigen epitope after the active center of the RuvC protein of the above-mentioned Cas protein can better weaken the cis-cutting activity of the Cas protein.
[0015] As a preferred embodiment of the Cas protein described in the present application, an antigenic epitope is inserted after the active center position of the RuvC protein of an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, so that the cis-cutting activity of the Cas protein is weakened.
[0016] As a preferred embodiment of the Cas protein described in the present application, the antigenic epitope includes GCN4.
[0017] The present application is based on LtCas12a or LbCas12a protein (amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2), or a protein having at least 80% homology with LtCas12a or LbCas12a protein (including FnCas12a, AsCas12a, LbCas12a and its various variants) to modify the protein: the antigen epitope GCN4 is inserted after the active center of RuvC protein to obtain the Cas protein of the present application, and the insertion of GCN4 will affect the cis-cleavage of the Cas protein as a whole; secondly, the insertion of GCN4 gives the Cas protein antigen recognition ability, and the Cas protein has dual regulation of protein cis- and trans-cutting functions, which can overcome the incompatibility between RPA amplification and Cas protein cutting, and is conducive to RPA-Cas12a rapid detection.
[0018] Among them, this application uses LtCas12a with independent intellectual property rights as a CRISPR cutting tool. It has been tested that the editing efficiency of LtCas12a is comparable to that of the commonly used LbCas12a. It also has non-specific ssDNA trans-cutting ability and recognizes PAM as TTNA. Compared with TTTV recognized by LbCas12a, the targeting range is wider. Therefore, the Cas protein of this application can be used as a potential underlying tool for the development of one-tube HPV detection, providing a new detection tool for the subsequent development of HPV in vitro diagnostic reagents.
[0019] As a preferred embodiment of the Cas protein described in the present application, the Cas protein is (a) or (b):
[0020] (a): The antigen epitope GCN4 is inserted after the 372nd glycine and the 1183rd threonine positions in an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced protein cis-cleavage activity;
[0021] (b): The antigen epitope GCN4 is inserted after the 1119th serine, 371st leucine, 965th cysteine and 825th asparagine positions in an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 2 to constitute a protein with weakened protein cis-cleavage activity.
[0022] In the technical scheme of the present application, the present application screens multiple sites of the Cas protein, for example, inserting the antigen epitope GCN4 after the 372nd glycine and 1183rd threonine positions on the basis of the LtCas12a protein, or a protein having at least 80% homology with the LtCas12a protein;
[0023] Alternatively, the Cas protein of the present application is obtained by inserting the antigen epitope GCN4 after the 1119th serine, the 371st leucine, the 965th cysteine and the 825th asparagine position on the LbCas12a protein, or a protein having at least 80% homology with the LbCas12a protein, and inserting the antigen epitope GCN4 into the Cas protein, giving the Cas protein antigen recognition ability, so that it can specifically bind to the scFv antibody through GCN4, and introducing the Rad51 protein into the one-tube method system to enhance its trans-cutting ability. Therefore, this transformation strategy of inserting the antigen epitope GCN4 inside the Cas protein realizes the dual regulation of the cis- and trans-cutting functions of the protein, and the obtained Cas protein can overcome the incompatibility between RPA amplification and Cas protein cutting, which is conducive to RPA-Cas12a rapid detection.
[0024] As a preferred embodiment of the Cas protein described in the present application, the Cas protein is (a) or (b):
[0025] (a): The antigen epitope GCN4 is inserted after the glycine at position 372 and the threonine at position 1183 in an amino acid sequence having at least 90% homology to the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced protein cis-cleavage activity;
[0026] (b): The antigen epitope GCN4 is inserted after the 1119th serine, the 371st leucine, the 965th cysteine and the 825th asparagine in an amino acid sequence having at least 90% homology with the amino acid sequence shown in SEQ ID NO: 2 to constitute a protein with weakened protein cis-cleavage activity.
[0027] In some specific embodiments, the Cas protein is (a) or (b):
[0028] (a) wherein the antigen epitope GCN4 is inserted after the glycine at position 372 and the threonine at position 1183 in an amino acid sequence having at least 80% or 82% or 85% or 88% or 89% or 90% or 91% or 92% or 93% or 94% or 95% or 96% or 97% or 98% or 99% homology to the amino acid sequence shown in SEQ ID NO: 1 to constitute a protein having reduced protein cis-cleavage activity;
[0029] (b) A protein having reduced protein cis-cleavage activity is prepared by inserting the antigenic epitope GCN4 after the serine at position 1119, the leucine at position 371, the cysteine at position 965 and the asparagine at position 825 in an amino acid sequence having at least 80% or 82% or 85% or 88% or 89% or 90% or 91% or 92% or 93% or 94% or 95% or 96% or 97% or 98% or 99% homology to the amino acid sequence shown in SEQ ID NO: 2.
[0030] As a preferred embodiment of the Cas protein described in the present application, the Cas protein is (1) or (2):
[0031] (1) a protein with an amino acid sequence as shown in SEQ ID NOs: 1 to 8;
[0032] (2) A protein derived from (a) in which the amino acid sequence in (a) is substituted, deleted or added with at least one amino acid and has a weakened protein cis-cleavage activity.
[0033] The present application preferably prefers that the above-mentioned Cas protein has weakened cis-cleavage ability, which overcomes the incompatibility problem between RPA amplification and CRISPR cleavage in the one-tube method.
[0034] Among them, the antigen epitope GCN4 was inserted after the 372th glycine position in the amino acid sequence shown in SEQ ID NO: 1 to obtain Lt-G372-GCN4 (amino acid sequence such as SEQ ID NO: 3); the antigen epitope GCN4 was inserted after the 1183rd glycine position in the amino acid sequence shown in SEQ ID NO: 1 to obtain Lt-T1183-GCN4 (amino acid sequence such as SEQ ID NO: 4).
[0035] According to the experiments, the cis-cutting ability of the modified Cas proteins (such as Lt-G372-GCN4 and Lt-T1183-GCN4) showed significant increases and decreases, indicating that protein modification at different amino acid sites will change the performance of the entire Cas protein. In terms of trans-cutting ability, after the antigen epitope GCN4 was enriched with Rad51 through antibody scFv, the trans-cutting ability of the two protein variants Lt-G372-GCN4 and Lt-T1183-GCN4 was significantly improved; based on the results of cis-cutting and trans-cutting, the modified Lt-T1183-GCN4 not only reduced the cis-cutting ability, but also improved the trans-cutting ability.
[0036] Among them, the antigen epitope GCN4 is inserted after the 1119th serine position in the amino acid sequence shown in SEQ ID NO: 2 to obtain Lb-S1119-GCN4 (amino acid sequence such as SEQ ID NO: 5); the antigen epitope GCN4 is inserted after the 371st leucine position in the amino acid sequence shown in SEQ ID NO: 2 to obtain Lb-L371-GCN4 (amino acid sequence such as SEQ ID NO: 6); the antigen epitope GCN4 is inserted after the 965th cysteine position in the amino acid sequence shown in SEQ ID NO: 2 to obtain Lb-C965-GCN4 (amino acid sequence such as SEQ ID NO: 7); the antigen epitope GCN4 is inserted after the 825th asparagine position in the amino acid sequence shown in SEQ ID NO: 2 to obtain Lb-N825-GCN4 (amino acid sequence such as SEQ ID NO: 8).
[0037] The modifications at positions L371, C965 and N825 in the amino acid sequence shown in SEQ ID NO: 2 successfully reduced the cis-cleavage activity of the Cas protein, while the insertion at S1119 increased the cis-cleavage activity of the Cas protein.
[0038] The present application also provides a nucleic acid molecule, which encodes the Cas protein.
[0039] The present application also provides an expression vector, which carries the nucleic acid molecule.
[0040] The present application also provides a host cell, which contains the Cas protein, the nucleic acid molecule or the expression vector.
[0041] The present application also provides a one-tube detection system based on Cas protein modification, wherein the one-tube detection system comprises the Cas protein and a single-chain antibody as described;
[0042] The antigenic epitope in the Cas protein binds to the single-chain antibody.
[0043] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in the present application, the one-tube detection system includes an RPA amplification mixture and a CRISPR-Cas12a mixture, and the CRISPR-Cas12a mixture includes the Cas protein, crRNA, ssDNA and scFv-Rad51 protein;
[0044] The ssDNA is a single-stranded DNA with a fluorescent group and a quenching group modified at both ends respectively; the crRNA is a specific guide RNA sequence that guides the Cas protein to target and recognize the target product;
[0045] The antigen epitope GCN4 in the Cas12a protein is enriched with Rad51 protein through single-chain antibody scFv.
[0046] This application is based on the concept of antigen-antibody specific binding. The scFv-Rad51 protein is introduced in a one-tube method system. The introduction of scFv-Rad51 protein enhances the side cutting ability of Cas12a protein. GCN4 enriches scFv-Rad51 by specific binding with scFv to form a Cas12a-GCN4-scFv-Rad51 complex. In this detection system, Rad51 plays a dual role: first, it binds to the melted target DNA to maintain the target DNA in a single-stranded state. The single-stranded target DNA continuously activates the trans-cutting activity of Cas12a, enhances the cutting of the reporter and the release of the fluorescent signal; secondly, Rad51 is combined with a single-stranded fluorescent probe, and the fluorescent probe is enriched near the cutting site of Cas12a through the interaction of GCN4-scFv-Rad51-probe. This local enrichment effectively enhances the fluorescent signal, thereby significantly improving the detection sensitivity.
[0047] The results showed that scFv-Rad51 can enhance the side-cutting ability. In summary, in the one-tube system, on the one hand, protein modification reduced cis-cutting; the introduction of scFv-Rad51 protein further enhanced trans-cutting, and the dual optimization greatly improved the detection sensitivity of the one-tube detection system.
[0048] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in the present application, the amino acid sequence of the scFv-Rad51 protein is shown in SEQ ID NO:9.
[0049] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in the present application, the RPA amplification mixture includes an upstream primer RPA-F and a downstream primer RPA-R for amplifying the RPA product.
[0050] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in the present application, the detection target includes nucleic acid molecules, and the nucleic acid molecules include HPV.
[0051] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in the present application, the HPV is HPV18, the nucleotide sequence of the upstream primer RPA-F is shown in SEQ ID NO: 10, and the nucleotide sequence of the downstream primer RPA-R is shown in SEQ ID NO: 11;
[0052] Alternatively, the HPV is HPV16, the nucleotide sequence of the upstream primer RPA-F is shown in SEQ ID NO: 12, and the nucleotide sequence of the downstream primer RPA-R is shown in SEQ ID NO: 13.
[0053] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in the present application, the nucleotide sequence of the ssDNA is 5'FAM-TTATT-BHQ 3';
[0054] And / or, the amino acid sequence of the crRNA includes the amino acid sequence shown in SEQ ID NO: 14 or SEQ ID NO: 15.
[0055] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in the present application, the RPA mixture also includes buffer and enzyme-free water.
[0056] Based on the above-mentioned Cas protein, this application has developed a highly sensitive and specific one-tube detection system (ECOT-LtCas12a and ECOT-LbCas12a one-tube detection system): ECOT-LtCas12a one-tube detection system based on Lt-G372-GCN4 and Lt-T1183-GCN4 and ECOT-LbCas12a one-tube detection system based on Lb-S1119-GCN4, Lb-L371-GCN4, Lb-C965-GCN4 and Lb-N825-GCN4.
[0057] It can be seen from experiments that the one-tube detection system of the present application is constructed based on Lt-T1183-GCN4. In the early stage of the one-tube reaction, Lt-T1183-GCN4 has a weaker CRISPR cis-cutting ability, so that RPA can be further amplified and the amplified product can be effectively accumulated. In the later stage of the reaction, the amplified product accumulated by RPA continuously activates the trans-cutting activity of Lt-T1183-GCN. In the Lt-WT one-tube system, due to the presence of strong CRISPR-Cas12a substrate cleavage activity, it is impossible to provide an amplification template for RPA, so that there is no accumulation of amplified products, and further, the trans-cutting activity of CRISPR-Cas12a cannot be continuously activated.
[0058] This application obtains the ECOT-LtCas12a system through protein engineering, so that canonical PAM crRNAs can be used to obtain significantly increased detection sensitivity without any modification of crRNA. Compared with previous methods that require fine design and modification of crRNA, the protein engineering strategy provides a more efficient and easy-to-implement solution. Through this protein engineering optimization, the detection process not only becomes simpler, but also significantly improves the flexibility and applicability of the system, and has greater application potential.
[0059] Compared with the traditional two-step detection, the ECOT one-tube detection system innovatively developed by this application places RPA amplification and CRISPR cutting in the same tube for simultaneous reaction, which not only shortens the detection time, but also simplifies the operation and avoids the possible contamination caused by opening the lid. Compared with the other two reported one-tube detection systems, ECOT focuses on modifying the Cas protein, significantly improving the detection ability of the one-tube method by changing the cis and trans cutting properties of the Cas protein itself. SubPAM crRNAs and PAM-less crRNAs are based on the performance of PAMs that are bound to Cas proteins. These two methods have strong limitations and have not been tested to be applicable to LtCas12a or other CRISPR proteins. The ECOT protein modification strategy of this application shows significantly enhanced detection effects not only on LtCas12a protein, but also on LbCas12a protein.
[0060] The present application also provides the application of the above-mentioned one-tube detection system based on Cas protein modification in detecting nucleic acids.
[0061] The present application also provides the application of the above-mentioned one-tube detection system based on Cas protein modification in the preparation and detection of nucleic acid products.
[0062] The ECOT one-tube detection system has high sensitivity and instantaneity. The ECOT-LtCas12a and ECOT-LbCas12a one-tube detection methods proposed in this application have been verified to be successfully used for instant detection of high-risk HPV. The ECOT-LtCas12a system can detect 5×10 2 HPV16 detected by copies / μL, 1.3×10 1 HPV18 was detected at 3 copies / μL. ECOT-LbCas12a detected HPV16 and HPV18 as low as 3 copies / μL within 30 minutes, far exceeding traditional detection methods, and can accurately identify samples as low as a single copy level. This application can provide two one-tube in vitro nucleic acid diagnostic methods that are easy to operate, rapid screening, and can be directly tested on site, reducing time consumption and operational complexity in the laboratory environment. In addition, the detection method shows high specificity and stability, and can provide reliable test results in a variety of practical application scenarios. It is an innovative tool that is very suitable for preclinical screening and instant testing.
[0063] Compared with the prior art, this application has the following beneficial effects:
[0064] The present application provides a one-tube detection system based on Cas protein modification and its application. Inserting GCN4 into the Cas protein gives the Cas protein antigen recognition ability. The Cas protein has dual regulation of protein cis and trans cleavage functions, which can overcome the incompatibility between RPA amplification and Cas protein cleavage, and is beneficial to RPA-Cas12a rapid detection; and, based on the above-mentioned Cas protein modification, the ECOT-LtCas12a and ECOT-LbCas12a one-tube detection systems of the present application have the characteristics of rapid response, high sensitivity, high reliability and easy operation; and, the scFv-Rad51 protein is introduced into the one-tube detection system to form a Cas12a-GCN4-scFv-Rad51 complex. In the one-tube system, on the one hand, protein modification reduces cis cleavage; and the introduction of scFv-Rad51 further enhances trans cleavage, and the dual optimization greatly improves the detection sensitivity of the one-tube detection system. BRIEF DESCRIPTION OF THE DRAWINGS
[0065] Figure 1 This is a detection principle diagram of the one-tube detection system based on Cas protein modification in this application;
[0066] Figure 2 Schematic diagram of LtCas12 protein modification;
[0067] Figure 3 A comparison of the cis-cleavage and trans-cleavage abilities of LtCas12;
[0068] Figure 4 This is the fluorescence value of LtCas12 one-tube method and the accumulation diagram of RPA products;
[0069] Figure 5 A comparison chart of the ECOT-LtCas12a one-tube system and other methods;
[0070] Figure 6 This is the sensitivity detection diagram of the ECOT-LtCas12a one-tube method system;
[0071] Figure 7 This is a specific detection diagram of the ECOT-LtCas12a one-tube system;
[0072] Figure 8 To establish the one-tube system of ECOT-LbCas12a;
[0073] Fig. 9 This is the sensitivity detection diagram of the ECOT-LbCas12a one-tube system. DETAILED DESCRIPTION
[0074] In order to better illustrate the purpose, technical solutions and advantages of the present application, the present application will be further described below in conjunction with the accompanying drawings and specific embodiments.
[0075] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified, and the components and raw materials used in each parallel experiment are of the same type.
[0076] The following reagents and instruments are used in the examples and comparative examples used in this application:
[0077] The RPA constant temperature rapid amplification kit (basic type) was purchased from Amp Future Biotechnology, with the catalog number: WLB8201KIT (which includes buffer A and buffer B); the primers used in this application were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.; the crRNA used in this application was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.; the ssDNA probes used in this application (including fluorescent probes and biotin test strip probes) were synthesized by Sangon Biotechnology Co., Ltd.; the test strips used in this application were all from Beijing Baoying Tonghui Biotechnology Co., Ltd.; the fluorescence value detector used in this application is the Bio-Rad CFX96 real-time fluorescence detection system.
[0078] LtCas12a is a new type of Cas12a protein independently developed by the applicant in the early stage (see Chinese invention patent CN202110325073.8), and its amino acid sequence is SEQ ID NO: 1.
[0079] The amino acid sequence of LbCas12a (PDB: 5xus) protein is SEQ ID NO: 2.
[0080] The present application provides a Cas protein, wherein the Cas protein is:
[0081] The antigen epitope GCN4 is inserted after the active center of the RuvC protein of an amino acid sequence having at least 80% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 to form a protein with weakened protein cis-cleavage activity.
[0082] In some specific embodiments, the Cas protein is (a) or (b):
[0083] (a): The antigen epitope GCN4 is inserted after the 372nd glycine and the 1183rd threonine positions in an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced protein cis-cleavage activity;
[0084] (b): The antigen epitope GCN4 is inserted after the 1119th serine, 371st leucine, 965th cysteine and 825th asparagine positions in an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 2 to constitute a protein with weakened protein cis-cleavage activity.
[0085] More preferably, the Cas protein is (a) or (b):
[0086] (a): The antigen epitope GCN4 is inserted after the glycine at position 372 and the threonine at position 1183 in an amino acid sequence having at least 90% homology to the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced protein cis-cleavage activity;
[0087] (b): The antigen epitope GCN4 is inserted after the 1119th serine, the 371st leucine, the 965th cysteine and the 825th asparagine in an amino acid sequence having at least 90% homology with the amino acid sequence shown in SEQ ID NO: 2 to constitute a protein with weakened protein cis-cleavage activity.
[0088] In some specific embodiments, the Cas protein is (a) or (b):
[0089] (a) wherein the antigen epitope GCN4 is inserted after the glycine at position 372 and the threonine at position 1183 in an amino acid sequence having at least 80% or 82% or 85% or 88% or 89% or 90% or 91% or 92% or 93% or 94% or 95% or 96% or 97% or 98% or 99% homology to the amino acid sequence shown in SEQ ID NO: 1 to constitute a protein having reduced protein cis-cleavage activity;
[0090] (b) A protein having reduced protein cis-cleavage activity is prepared by inserting the antigenic epitope GCN4 after the serine at position 1119, the leucine at position 371, the cysteine at position 965 and the asparagine at position 825 in an amino acid sequence having at least 80% or 82% or 85% or 88% or 89% or 90% or 91% or 92% or 93% or 94% or 95% or 96% or 97% or 98% or 99% homology to the amino acid sequence shown in SEQ ID NO: 2.
[0091] In some specific embodiments, the Cas protein is (1) or (2):
[0092] (1) a protein with an amino acid sequence as shown in SEQ ID NOs: 3 to 8;
[0093] (2) A protein derived from (a) in which the amino acid sequence in (a) is substituted, deleted or added with at least one amino acid and has a weakened protein cis-cleavage activity.
[0094] The present application also provides a one-tube detection system based on Cas protein modification (abbreviated as ECOT one-tube method), the one-tube detection system includes the Cas protein and a single-chain antibody; the antigen epitope in the Cas protein is combined with the single-chain antibody.
[0095] Preferably, the one-tube detection system comprises an RPA amplification mixture and a CRISPR-Cas mixture, wherein the CRISPR-Cas mixture comprises the Cas protein, crRNA, ssDNA and scFv-Rad51 protein;
[0096] The ssDNA is a single-stranded DNA with a fluorescent group and a quenching group modified at both ends respectively; the crRNA is a specific guide RNA sequence that guides the Cas protein to target and recognize the target product;
[0097] The antigen epitope GCN4 in the Cas protein is enriched with Rad51 protein through a single-chain antibody scFv.
[0098] The amino acid sequence of the scFv-Rad51 protein is shown in SEQ ID NO:9.
[0099] The RPA amplification mixture includes an upstream primer RPA-F and a downstream primer RPA-R for amplifying the RPA product. The RPA amplification mixture also includes a buffer and enzyme-free water.
[0100] The detection principle of the above ECOT one-tube method is as follows Figure 1 shown.
[0101] In the following examples, high-risk HPV (HPV16, HPV18) associated with cervical cancer were selected as detection objects.
[0102] Example 1: A Cas protein and its construction method
[0103] In this application, the protein structure of LtCas12a is predicted by AlphaFold 3, and two amino acid sites close to the active center of RuvC protein: G372 and T1183 are selected for protein modification. The antigen epitope GCN4 is inserted after the G372 and T1183 sites, respectively, and modified into Lt-G372-GCN4 (the amino acid sequence is shown in SEQ ID NO: 3) and Lt-T1183-GCN4 (the amino acid sequence is shown in SEQ ID NO: 4).
[0104] In the present application, the antigen epitope GCN4 is inserted after S1119, L371, C965 and N825 in the four amino acid sites of the active center of the RuvC protein on the protein structure of LbCas12a (PDB: 5xus) with a clear analytical structure, and transformed into Lb-S1119-GCN4 (the amino acid sequence is shown in SEQ ID NO: 5), Lb-L371-GCN4 (the amino acid sequence is shown in SEQ ID NO: 6), Lb-C965-GCN4 (the amino acid sequence is shown in SEQ ID NO: 7) and Lb-N825-GCN4 (the amino acid sequence is shown in SEQ ID NO: 8). The unmodified Cas12a is called Cas12a-WT (i.e., Lt-WT or wild-type LtCas12a, the amino acid sequence is shown in SEQ ID NO: 1).
[0105] Example 2: Comparison of the cis-cleavage ability, trans-cleavage ability and one-tube detection ability of Lt-G372-GCN4 and Lt-T1183-GCN4
[0106] The purpose of this example is to compare the cis-cutting ability, trans-cutting ability and one-tube detection ability of Lt-G372-GCN4, Lt-T1183-GCN4 and Cas12a-WT modified at the two sites of G372 and T1183. The primer sequences used in this example are as described in Table 1. This example uses HPV16 and HPV18 as the detection objects.
[0107] (1) LtCas12a protein structure prediction:
[0108] like Figure 2 , this application predicts the various functional domains of LtCas12a protein by sequence alignment and distinguishes them ( Figure 2 -A). The protein structure after inserting the antigen epitope GCN4 after G372 and T1183 was predicted by AlphaFold 3 ( Figure 2 -B. Figure 2 -C).
[0109] (2) Expression and purification of LtCas12a protein and scFv-Rad51 protein:
[0110] The nucleotide sequences encoding Lt-WT, Lt-G372-GCN4, Lt-T1183-GCN4 and scFv-Rad51 proteins were cloned into the psumo prokaryotic protein expression vector to construct a recombinant plasmid capable of expressing proteins, and then transformed into DE3-codon competent cells. After Kana resistance screening, single colonies were picked and cultured in Kana resistance medium. When the bacterial solution OD 600 reached between 0.6 and 0.8, IPTG was added to a final concentration of 0.1 mM, and the induction culture was continued for 18-20 hours. The bacterial precipitate was collected by centrifugation, and then resuspended with a lysis buffer, centrifuged after high-pressure lysis and ultrasonic crushing, and purified by Ni column affinity chromatography and molecular sieve purification in turn. Finally, the target protein was eluted with 250 mM imidazole, identified by SDS-PAGE electrophoresis, and the final protein concentration was determined, and then quickly frozen in liquid nitrogen and stored at -80 degrees for use.
[0111] (3) HPV16 and HPV18 target preparation:
[0112] This embodiment uses the L1 region of high-risk HPV16 and HPV18 as the targeting region. The HPV16-L1 and HPV18-L1 regions were cloned into the PXZ vector by the Gibson method, and the cloning was confirmed to be correct by Sanger sequencing to obtain PXZ-HPV16-L1 and PXZ-HPV18-L1 plasmids, which were used as the HPV16 and HPV18 targeting substrates of this application, respectively. Quantification and copy number calculation were performed by Qubit.
[0113] (4) Comparison of cis-cleavage ability of Lt-WT, Lt-G372-GCN4, and Lt-T1183-GCN4:
[0114] In this example, human codon optimization was performed on the three proteins Lt-WT, Lt-G372-GCN4, and Lt-T1183-GCN4, and the corresponding nucleotide sequences were cloned into the PX330 eukaryotic expression vector to obtain the PX330-LtCas12a eukaryotic expression plasmid. The three endogenous CDKN2A, DYRK1A, and RUNX1 gene targets were targeted respectively to construct crRNA plasmids. At the same time, the PX330-LtCas12a plasmid and the crRNA plasmid were co-transfected into HEK293T cells with good growth status, and the cells were harvested and DNA was extracted after 72 hours. Primers were designed upstream and downstream of the target, respectively, and high-throughput sequencing was performed. The cis-cleavage ability was detected by amplicon detection (such as Figure 3 , Figure 3 -A). The target sequences of the three endogenous genes are shown in Table 1.
[0115] Table 1 Endogenous gene target sequences
[0116] CDKN2A gccccaataatccccacatgtca DYRK1A gaagcacatcaaggacattctaa RUNX1 ttctcccctctgctggatacctc
[0117] (5) Comparison of trans-cleavage ability of Lt-WT, Lt-G372-GCN4, and Lt-T1183-GCN4:
[0118] The trans-cutting ability of Cas12a will non-specifically cut ssDNA. In this example, an ssDNA reporter molecule modified with a fluorescent group and a quenching group: 5'FAM-TTATT-BHQ 3' is used as a fluorescent probe. The fluorescent signal is collected on a Bio-Rad fluorescent quantitative instrument. The trans-cutting ability of Lt-WT, Lt-G372-GCN4 and Lt-T1183-GCN4 is compared by the strength of the fluorescent signal. The stronger the fluorescent signal, the stronger the trans-cutting ability.
[0119] The following reaction operation was performed: 500 nM Cas12a protein (one of Lt-WT, Lt-G372-GCN4, Lt-T1183-GCN4), 1000 nM Lt-HPV16-crRNA1 (sequence as shown in Table 3) or 1000 nM Lt-HPV18-crRNA1 (sequence as shown in Table 3), 2 μL 10x buffer 3.1, 500 nM scFv-Rad51 protein (amino acid sequence as shown in SEQ ID NO: 9) were incubated at room temperature for 10 min to form an RNP complex (Cas12a-GCN4-scFv-Rad51 complex, Figure 3 -B), then add 1000nM ssDNA fluorescent probe and enzyme-free water, and finally add 5×10 10 The total volume was 20 μL, and after centrifugation, the cells were quickly placed on a Bio-Rad fluorescence quantification instrument and the fluorescence value was collected every 3 min at 480 nm for 90 min. Figure 3 -C).
[0120] (6) Comparison of one-tube detection capabilities of Lt-WT, Lt-G372-GCN4, and Lt-T1183-GCN4:
[0121] The one-tube method is to perform RPA amplification and LtCas12a cleavage in the same tube. The reaction system and procedure of the one-tube method used in this application are: buffer A29.4μL, buffer B 2μL, upstream primer 2μL, downstream primer 2μL, enzyme-free water 7μL. In order to save reagents, this application divides 1 RPA amplification system into 4 parts, that is, 4 10μL reaction systems, and then sequentially with the RNP complex with the same final concentration as above, 5x10 5copies / μL HPV16 or HPV18 template, and finally add the fluorescent probe, add enzyme-free water to the total volume to 20μL, and quickly place it on the Bio-Rad fluorescence quantitative instrument to read the fluorescence value ( Figure 4 -A). The primer sequences used in this example are shown in Table 2.
[0122] Table 2 Primer sequences used in this example
[0123]
[0124] Table 3 crRNA sequences used in this example
[0125]
[0126] (7) One-tube amplification product accumulation detection:
[0127] As mentioned above, in the one-tube reaction system, RPA amplification and LtCas12a cleavage compete with each other. Ultimately, the detection ability of the one-tube method depends on whether the system can accumulate enough amplification products as LtCas12a cleavage substrates.
[0128] This example detects the accumulation of amplified products in the one-tube method system of L-WT and Lt-T1183-GCN4 at different time points. Specifically, in this example, 3 volumes of phenol chloroform were added to the one-tube reaction system after 15 minutes, 18 minutes, 21 minutes, 24 minutes, 27 minutes, and 30 minutes of reaction, respectively, and DNA was extracted. After centrifugation at 5000 rpm for 5 minutes, 10 μL of supernatant was taken, and 2 μL of 6x DNA Loading was added. The accumulation of amplified products was detected by agarose gel ( Figure 4 -B, such as Figure 4 shown).
[0129] Result analysis:
[0130] This example illustrates the advantages of the one-tube detection system based on Cas protein modification of the present application. Experiments are set up from three dimensions: cis-cleavage ability, single trans-cleavage ability, and one-tube ability to compare the detection capabilities.
[0131] In terms of cis-cleavage ability, compared with Lt-WT, the modified Lt-G372-GCN4 and Lt-T1183-GCN4 showed significant increases and decreases, respectively, indicating that protein modification at different amino acid sites will change the performance of the entire protein ( Figure 3-A). In terms of trans-cleavage ability, after the antigen epitope GCN4 was enriched with Rad51 through antibody scFv, the trans-cleavage ability of the two protein variants Lt-G372-GCN4 and Lt-T1183-GCN4 was significantly improved ( Figure 3 -C).
[0132] Based on the results of cis-cleavage and trans-cleavage, the modified Lt-T1183-GCN4 not only reduced the cis-cleavage ability, but also improved the trans-cleavage ability. Therefore, the present application speculates that Lt-T1183-GCN4 is more suitable for one-tube detection. Figure 4 -A, the fluorescence value results show that the Lt-T1183-GCN4 one-tube system is indeed significantly better than the Lt-WT one-tube system, and obvious fluorescence value accumulation can be observed over time.
[0133] In order to further illustrate the detection principle of the one-tube detection system using Lt-T1183-GCN4, this example detects the accumulation changes of amplification products at different time points in a one-tube reaction.
[0134] like Figure 4 -B, the one-tube detection system using Lt-T1183-GCN4 began to accumulate amplified products from 18min, while Lt-WT still did not observe obvious amplified product accumulation at 30min. Therefore, the present application believes that it is precisely because Lt-T1183-GCN4 has a weaker CRISPR cis-cutting ability in the early stage of the one-tube detection system reaction, so that RPA is further amplified and the amplified products are effectively accumulated. In the later stage of the reaction, the amplified products accumulated by RPA continuously activate the trans-cutting activity of Lt-T1183-GCN. In the one-tube detection system using Lt-WT, due to the presence of a strong CRISPR-Cas12a substrate cleavage activity, it is impossible to provide an amplification template for RPA, so that there is no amplified product accumulation, and further, the trans-cutting activity of CRISPR-Cas12a cannot be continuously activated. Therefore, the unmodified LtCas12a is not suitable for one-tube detection. This application names the one-tube detection system mediated by Engineered-Lt-T1183-GCN4 as the ECOT-LtCas12a system (abbreviated as ECOT-Lt).
[0135] Example 3, fluorescence value detection of ECOT-LtCas12a system
[0136] Previous studies have shown that the use of subPAM crRNAs or PAM-less crRNAs in the one-tube system of Cas12a can improve the sensitivity of one-tube detection. To this end, this application compares the performance of the one-tube system mediated by ECOT-LtCas12a system with subPAM crRNAs and PAM-less crRNAs.
[0137] like Figure 5 As shown, in this embodiment, three canonical PAM crRNAs, five subPAM crRNAs and three PAM-less crRNAs were designed for the HPV18-L1 region. Figure 5 -A), using ECOT-Lt and Lt-WT for one-tube fluorescence value detection.
[0138] The crRNA sequences used in this example are shown in Table 4.
[0139] Table 4 crRNAs sequences used in this example
[0140]
[0141] This example compares the performance of ECOT-Lt and Lt-WT systems with canonical PAMcrRNAs, subPAM crRNAs, and PAM less crRNAs targeting the HPV18-L1 region. First, the fluorescence values of Lt-T1183-GCN4 and Lt-WT systems combined with subPAM crRNAs and PAM less crRNAs are very low ( Figure 5 -B to 5-E), indicating that the one-tube detection method for subPAMcrRNAs and PAM less crRNAs is not suitable for LtCas12a.
[0142] Secondly, the fluorescence value of the Lt-T1183-GCN4-mediated ECOT-Lt system combined with canonical PAM crRNAs was significantly higher than that of subPAM crRNAs and PAM less crRNAs. This shows that in the protein-engineered ECOT-Lt system, high detection sensitivity can be obtained by using canonical PAM crRNAs without any modification of crRNAs. This finding highlights the advantages of protein engineering strategies in improving sensitivity and avoiding the complexity of modifying crRNA, thereby simplifying the detection process and ensuring high sensitivity and repeatability, further emphasizing the application potential of protein engineering methods in one-tube detection.
[0143] Example 4: Detection sensitivity and specificity of the ECOT-Lt one-tube system
[0144] Early detection of HPV infection is extremely important for the prevention and treatment of cervical cancer. Based on the ECOT-Lt one-tube method system established in Example 2, by detecting serially diluted HPV18 and HPV16 at 1×10 0 copies / μL-1×10 5 The sensitivity of the method was evaluated by using 5 concentration gradient plasmids of 1000 copies / μL as templates. The plasmid dilution method was as described in Example 2. The crRNA sequences used in this example are as described in Table 3.
[0145] (1) Detection of the sensitivity of the ECOT-Lt one-tube method system by fluorescence value:
[0146] The fluorescence value detection method was as described in Example 2 (6), using gradient diluted HPV18 and HPV16 plasmids as templates, and setting up two groups, ECOT-Lt and Lt-WT, for comparison.
[0147] Result analysis:
[0148] like Figure 6 As shown, in the HPV16 detection, ECOT-Lt group had 2 copies / μL, 5×10 3 copies / μL, 5×10 4 Obvious fluorescence accumulation was detected in the Lt-WT group at 5×10 copies / μL template concentration; 3 copies / μL, 5x10 4 The fluorescence value was detected in the template concentration of copies / μL, and the fluorescence intensity was much lower than that of the ECOT-Lt group ( Figure 6 -A). This indicates that ECOT-Lt can detect fluorescence accumulation at a relatively low HPV copy number compared with Lt-WT. In HPV18 detection, ECOT-Lt group had a fluorescence accumulation of 1.3×10 1 The obvious fluorescence accumulation was detected at the template concentration of 100 copies / μL; however, no fluorescence was detected in the Lt-WT group in the five gradient concentrations ( Figure 6 -C).
[0149] (2) Sensitivity of ECOT-Lt one-tube system tested by LFA:
[0150] This example establishes the sensitivity of the ECOT-Lt system through LFA visualization detection. The principle of this experiment is: colloidal gold particles labeled with anti-FAM antibody are coated on the conjugate pad. LFA has a lower quality control line (C line) and an upper detection line (T line) ( Figure 6 -B), the C line is coated with streptavidin that can bind to biotin, and the T line is coated with goat anti-mouse secondary antibody. The ssDNA reporter molecule used in this system is 5'FAM-TTTTTTTATTTTTTT-biotin 3'. When the CRISPR system is not cut, the ssDNA reporter molecule remains intact and can capture all the colloidal gold on the C line; when the ssDNA reporter molecule is cut by CRISPR, the colloidal gold cannot be intercepted by the C line because there is no biotin, so it can flow to the T line and bind to the anti-FAM secondary antibody coated on the T line to develop color. Therefore, the presence or absence of the T line can be used to determine whether there is a cut, and the strength of the T line can be used to determine the detection sensitivity of the one-tube method.
[0151] Result analysis:
[0152] In the detection of HPV16 and HPV18, Lt-WT did not detect T lines in the above five concentration gradients, while the ECOT-Lt system detected 100 T lines in 5×10 2 HPV16 detected by copies / μL, 1.3×10 1 Combined with the fluorescence value experiment in this example, it can be seen that the sensitivity of the ECOT-Lt system is much higher than that of the Lt-WT system, and the minimum detection limit for HPV16 is 5×10 2 copies / μL( Figure 6 -B), the minimum detection limit of HPV18 is 1.3×10 1 copies / μL( Figure 6 -D).
[0153] (3) Specificity of ECOT-Lt one-tube system:
[0154] According to the method of Example 4, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, and HPV68 plasmid templates were diluted to 5×10 5 The specificity of the ECOT-Lt one-tube method was tested by fluorescence value and LFA test strips according to the method of Example 4.
[0155] The results show:
[0156] like Figure 7As shown in the fluorescence value experiment, the ECOT-Lt one-tube method system can only detect HPV16 and HPV18 in the system containing HPV18 and HPV16 respectively. Figure 7 -B); only HPV16 and HPV18 T lines can be detected in LFA ( Figure 7 -A); Both tests were unable to detect other similar HPV typing, indicating that the ECOT-Lt one-tube system of the present application has good specificity.
[0157] Example 5: Cis-cleavage ability of Lb-S1119-GCN4, Lb-L371-GCN4, Lb-C965-GCN4 and Lb-N825-GCN4 and one-tube detection ability
[0158] Example 1 Four LbCas12a variants (Lb-S1119-GCN4, Lb-L371-GCN4, Lb-C965-GCN4 and Lb-N825-GCN4) were designed, as Figure 8 -A.
[0159] The purpose of this example is to compare the cis-cleavage ability and one-tube detection ability of four LbCas12a variants. In this example, three canonical PAM crRNAs and four subPAM crRNAs were designed for the HPV18-L1 region. The crRNA sequences used in this example are shown in Table 5. The results are shown in Figure 8 shown.
[0160] (1) Comparison of cis-cleavage ability of LbCas12a:
[0161] The cis-cleavage ability of Lb-WT (unmodified wild-type LbCas12a) and protein-modified Lb-S1119-GCN4, Lb-L371-GCN4, Lb-C965-GCN4 and Lb-N825-GCN4 was evaluated according to the high-throughput amplicon sequencing method of Example 2 (4). The target sequences of the three endogenous genes used in this example are shown in Table 1.
[0162] The results showed that the modification at L371, C965 and N825 successfully reduced the cis-cleavage activity, while the insertion at S1119 increased the cis-cleavage activity ( Figure 8 -B). These findings provide promising directions for engineering the LbCas12a protein, especially for the Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4 variants, where attenuated cis-cleavage may improve its detection ability in the one-tube assay, which is a key attribute for sensitive detection in the one-tube assay.
[0163] (2) Comparison of one-tube detection capabilities of LbCas12a:
[0164] To determine the one-tube detection capabilities of these engineered LbCas12a variants compared to Lb WT, this example used canonical PAM crRNAs to detect HPV18. The results showed that the fluorescence signals generated by Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4 were significantly higher than those of Lb-WT, indicating that the one-tube detection performance of these three engineered variants was significantly improved ( Figure 8 This enhancement is consistent with observations from the ECOT Lt system and further demonstrates the general applicability of the ECOT strategy to improve CRISPR-based diagnostics.
[0165] Subsequently, this example explored the synergistic effect of combining these engineered LbCas12a variants with subPAM crRNAs, a strategy that previous studies have shown can improve the sensitivity of LbCas12a one-pot assays. Compared with canonical PAM crRNAs, Lb-WT, Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4 variants showed higher fluorescence intensity when paired with subPAM crRNAs ( Figure 8 -C). In contrast, Lb-S1119-GCN4 performed poorly regardless of the crRNA type used, likely due to its high cis-cleavage activity, which prevented sufficient amplification product from being obtained in a single tube reaction. Importantly, the Lb-C965-GCN4 variant reached maximum fluorescence in just 30 min, with subPAM-2crRNA fluorescence 5.2- and 8.3-fold higher, respectively, than Lb-WT ( Figure 8 -C). This application names this combination of Lb-C965-GCN4 variant combined with subPAM crRNAs as ECOT-LbCas12a one-tube detection system. The crRNA sequences used in this embodiment are shown in Table 5.
[0166] Table 5 crRNA sequences used in this example
[0167]
[0168] Example 6, sensitivity detection of ECOT-LbCas12a one-tube detection system
[0169] Referring to Example 4, this application uses LFA visualization to detect the detection sensitivity of the ECOT-LbCas12a one-tube detection system. It also uses continuously diluted HPV16 and HPV18 plasmids as detection templates, and judges the detection limit of ECOT-LbCas12a based on whether the T line on the test strip is colored. The reaction system used in this example is: the RPA amplification system is as shown in Example 2 (6), and the CRISPR system is 500nM Lb-C965-GCN4 protein, 1000nM HPV16 or HPV18 crRNA, 2μL10x buffer 3.1, and 50nM scFv-Rad51 protein. Incubate at room temperature for 10min to form an RNP complex ( Figure 3 -B), then add 1000nM ssDNA fluorescent probe and enzyme-free water in sequence, and finally add gradient diluted HPV16 and HPV18 plasmids to make a total volume of 20μL. After instantaneous centrifugation, quickly place in a PCR instrument at 37 degrees for 30min. Take 10μL of the reaction solution and add 90μL of water to dilute it, and use a test strip to develop color and observe. The crRNAs sequences used in this example are as described in Table 6.
[0170] Table 6 crRNA sequences used in this example
[0171]
[0172] The results are as follows Fig. 9 As shown in the figure, the EECOT-LbCas12a one-tube detection system can detect 3×10 0 copies / μL of HPV16 ( Fig. 9 -A) and HPV18( Fig. 9 -B).
[0173] The results show that, first, the engineered ECOT-LbCas12a one-tube detection system shows higher sensitivity, and the ECOT protein modification strategy can be applied to a variety of CRISPR systems and has wide applicability. Second, the ECOT-LbCas12a one-tube detection system has a faster response speed, and in vitro detection can be completed in 30 minutes, which is very suitable for POCT and home self-testing.
[0174] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present application rather than to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, ordinary technicians in this field should understand that the technical solution of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present application.
Claims
1. A Cas protein, characterized in that The Cas protein is inserted with an antigen epitope, which weakens the cis-cutting activity of the Cas protein.
2. The Cas protein according to claim 1, characterized in that The Cas protein is: Inserting an antigen epitope after the active center of the RuvC protein of the Cas protein weakens the cis-cleavage activity of the Cas protein.
3. The Cas protein according to claim 2, characterized in that The Cas protein is: An antigen epitope is inserted after the active center position of the RuvC protein of an amino acid sequence having at least 80% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, so that the cis-cutting activity of the Cas protein is weakened.
4. The Cas protein according to any one of claims 1 to 3, characterized in that The antigenic epitope includes the antigenic epitope GCN4.
5. The Cas protein according to claim 3, characterized in that The Cas protein is (a) or (b): (a): The antigen epitope GCN4 is inserted after the 372nd glycine and the 1183rd threonine positions in an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced protein cis-cleavage activity; (b): The antigen epitope GCN4 is inserted after the 1119th serine, 371st leucine, 965th cysteine and 825th asparagine positions in an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 2 to constitute a protein with weakened protein cis-cleavage activity.
6. The Cas protein according to claim 5, characterized in that The Cas protein is (a) or (b): (a): The antigen epitope GCN4 is inserted after the glycine at position 372 and the threonine at position 1183 in an amino acid sequence having at least 90% homology to the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced protein cis-cleavage activity; (b): The antigen epitope GCN4 is inserted after the 1119th serine, the 371st leucine, the 965th cysteine and the 825th asparagine in an amino acid sequence having at least 90% homology with the amino acid sequence shown in SEQ ID NO: 2 to constitute a protein with weakened protein cis-cleavage activity.
7. The Cas protein according to claim 1, characterized in that The Cas protein is (1) or (2): (1) a protein with an amino acid sequence as shown in SEQ ID NOs: 1 to 8; (2) A protein derived from (1) in which the amino acid sequence in (1) is substituted, deleted or added with at least one amino acid and has a weakened protein cis-cleavage activity.
8. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the Cas protein according to any one of claims 1 to 7.
9. A one-tube detection system based on Cas protein modification, characterized in that: The one-tube detection system comprises the Cas protein and the single-chain antibody as described in any one of claims 1 to 7; The antigenic epitope in the Cas protein binds to the single-chain antibody.
10. The one-tube detection system based on Cas protein modification according to claim 9, characterized in that: The one-tube detection system comprises an RPA amplification mixture and a CRISPR-Cas mixture, wherein the CRISPR-Cas mixture comprises the Cas protein, crRNA, ssDNA and scFv-Rad51 protein according to any one of claims 1 to 7; The ssDNA is a single-stranded DNA with a fluorescent group and a quenching group modified at both ends respectively; the crRNA is a specific guide RNA sequence that guides the Cas protein to target and recognize the target product; The antigen epitope GCN4 in the Cas12a protein is enriched with Rad51 protein through single-chain antibody scFv.
11. The one-tube detection system based on Cas protein modification according to claim 10, characterized in that: The detection target includes nucleic acid molecules, and the nucleic acid molecules include HPV.
12. The one-tube detection system based on Cas protein modification according to claim 11, characterized in that: The RPA amplification mixture includes an upstream primer RPA-F and a downstream primer RPA-R for amplifying the RPA product; The HPV is HPV18, the nucleotide sequence of the upstream primer RPA-F is shown in SEQ ID NO: 10, and the nucleotide sequence of the downstream primer RPA-R is shown in SEQ ID NO: 11; Alternatively, the HPV is HPV16, the nucleotide sequence of the upstream primer RPA-F is shown in SEQ ID NO: 12, and the nucleotide sequence of the downstream primer RPA-R is shown in SEQ ID NO:
13.
13. The one-tube detection system based on Cas protein modification according to claim 10, characterized in that: The nucleotide sequence of the ssDNA is 5'FAM-TTATT-BHQ 3'; And / or, the amino acid sequence of the crRNA includes the amino acid sequence shown in SEQ ID NO: 14 or SEQ ID NO:
15.
14. Use of the one-tube detection system based on Cas protein modification as described in any one of claims 9 to 13 in the preparation of nucleic acid detection products.
Citation Information
Patent Citations
A Cpf1 protein and gene editing system
CN113234701B
Base editing tool and construction method thereof
CN113637672A
Portable device for menstrual blood sample collection and HPV rapid detection system
CN115998341A
Escherichia coli detection kit based on RPA-CRISPR / Cas12a
CN117535432A
RNA-guided kilobase-scale genome recombination engineering
CN118234855A
Cited By
Protein tag system and application thereof
CN120349427A