Antibody aiming at human S100A7 protein, antibody pair, kit and application thereof

Abstract

The invention belongs to the technical field of antibody preparation, and particularly relates to an antibody aiming at human S100A7 protein, an antibody pair, a kit and application thereof. The antibody is a first antibody or a second antibody, amino acid sequences of light chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.3-5, and amino acid sequences of heavy chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.8-10; the amino acid sequences of light chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.13-15, and the amino acid sequences of heavy chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.18-20. The invention provides a pair of anti-human S100A7 protein antibodies with strong specificity and high affinity. When being used for detecting human S100A7, a double-antibody sandwich enzyme-linked immunosorbent assay system developed on the basis of the antibodies has the advantages of strong specificity, wide linear range, high sensitivity, good accuracy and credibility and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of antibody preparation, and in particular to antibodies, antibody pairs and kits targeting human S100A7 protein and uses thereof. Background Art

[0002] S100A7 (S100 calcium binding protein A7) belongs to the calcium ion binding protein S100 superfamily. It was originally isolated from abnormally proliferating keratinocytes in psoriasis, so it is also called Psoriasin, or psoriasin S100A7. The molecular weight is about 11kDa and contains two EF-hand domains. These domains are responsible for binding calcium ions, thereby affecting the conformation and function of the protein, and then participating in a variety of important life activities inside and outside the cell. Studies have shown that S100A7 protein plays an important role in skin barrier function and immune defense, especially in the differentiation and maturation of the epidermis; it helps maintain the integrity and barrier function of the skin by regulating the proliferation and differentiation of keratinocytes. In addition, S100A7 also has antibacterial activity, which can inhibit the growth of certain bacteria and protect the skin from infection; this antibacterial effect makes it of great significance in the innate immune defense of the skin. In addition, S100A7 protein is also involved in the occurrence and development of tumors. Its expression level is significantly increased in many cancers and is closely related to the proliferation, migration and invasion of cancer cells. For example, upregulated expression of S100A7 has been observed in psoriasis, in situ and invasive breast cancer, head and neck squamous cell carcinoma, bladder squamous cell carcinoma, and lung cancer; the secretion and expression characteristics of S100A7 are considered to be one of the biomarkers of psoriasis and a candidate marker for certain malignant tumors for early diagnosis and prognosis of the disease.

[0003] In order to study the role of S100A7 in physiological and pathological processes, a variety of detection methods have been widely used. Among them, enzyme-linked immunosorbent assay (ELISA) is a commonly used method for quantitative detection of S100A7, which is suitable for cell culture supernatant, serum or tissue extracts. In order to improve the specificity and sensitivity of the ELISA detection method, it is necessary to develop high-performance anti-human S100A7 monoclonal antibodies. However, the anti-human S100A7 ELISA detection kits currently available on the market all use mouse anti-human S100A7 monoclonal antibodies, which have low affinity and specificity, poor detection sensitivity, and are prone to false positive or false negative results, resulting in the need to improve the credibility of the test results. In addition, the mouse monoclonal antibodies used rely on the traditional hybridoma method for development and production. The preparation process is more complicated than that of recombinant monoclonal antibodies, and there are also large batch differences. Therefore, the ELISA detection kits developed using mouse monoclonal antibodies have challenges such as poor stability, low sensitivity, and low credibility of results. Summary of the invention

[0004] In view of the above problems existing in the prior art, the present invention provides two monoclonal antibodies against human S100A7 protein and an antibody pair composed thereof, as well as a kit containing the above antibodies or antibody pair and its use. The antibodies provided by the present invention have strong specificity and high affinity for human S100A7 protein, and are used to develop a double antibody sandwich enzyme-linked immunosorbent assay system for detecting human S100A7 protein, which has the advantages of strong specificity, wide linear range, high sensitivity, good accuracy and reliability, etc.

[0005] To achieve the above object, the present invention is specifically implemented through the following technical solutions:

[0006] In a first aspect, the present invention provides an antibody against human S100A7 protein, which is a first antibody or a second antibody, wherein: the amino acid sequences of the complementary determining regions CDR1-3 on the light chain variable region of the first antibody are shown as SEQ ID NOs.3-5, respectively, and the amino acid sequences of the complementary determining regions CDR1-3 on the heavy chain variable region are shown as SEQ ID NOs.8-10, respectively; the amino acid sequences of the complementary determining regions CDR1-3 on the light chain variable region of the second antibody are shown as SEQ ID NOs.13-15, respectively, and the amino acid sequences of the complementary determining regions CDR1-3 on the heavy chain variable region are shown as SEQ ID NOs.18-20, respectively.

[0007] Furthermore, the amino acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.7; the amino acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.17.

[0008] Furthermore, the amino acid sequence of the light chain of the first antibody is shown as SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown as SEQ ID NO.6; the amino acid sequence of the light chain of the second antibody is shown as SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown as SEQ ID NO.16.

[0009] Furthermore, the first antibody or the second antibody is a full-length antibody or an antigen-binding region of the full-length antibody; the antigen-binding region is selected from a Fab fragment, a F(ab) 2 Fragment, Fv fragment, (Fv) 2 Fragments, scFv fragments and sc(Fv) 2 At least one of the fragments.

[0010] The second aspect of the present invention provides a nucleic acid molecule encoding the first antibody or the second antibody as described above.

[0011] Further, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.24 or a sequence complementary thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.28 or a sequence complementary thereto.

[0012] Further, the nucleic acid sequence of the light chain of the first antibody is shown as SEQ ID NO.21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.23 or a sequence complementary thereto. The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO.25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.27 or a sequence complementary thereto.

[0013] The third aspect of the present invention provides an antibody pair against human S100A7 protein, which consists of the first antibody and the second antibody as described above.

[0014] In a fourth aspect, the present invention provides a kit for detecting human S100A7 protein, wherein the kit comprises the antibody against human S100A7 protein as described above or the antibody pair against human S100A7 protein as described above.

[0015] Furthermore, the kit is a double antibody sandwich ELISA kit, which includes a first antibody and a second antibody, wherein the first antibody serves as a capture antibody, the second antibody serves as a detection antibody, and the second antibody is coupled with a detection label.

[0016] The advantages and positive effects of the present invention are as follows: the present invention provides a pair of anti-human S100A7 protein monoclonal antibodies with strong specificity and high affinity, the affinity constant is at the nM level, and the two monoclonal antibodies bind to different antigenic epitopes of the human S100A7 protein, so a double antibody sandwich enzyme-linked immunosorbent assay system for the human S100A7 protein is further developed based on the above antibodies. When used for detecting the human S100A7 protein, it has the advantages of strong specificity, wide linear range, high sensitivity, good accuracy and reliability, and the detection limit is as low as 162.44 pg / mL. It has good application prospects in the field of efficient detection of S100A7 protein in biological samples such as human serum, urine, cells, and tissues. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0018] Figure 1 The vector map used to construct the rabbit monoclonal antibody expression vector in Example 1 of the present invention, from left to right are the pRB322 vector maps carrying the light chain constant region and the heavy chain constant region;

[0019] Figure 2 This is an affinity curve diagram of the binding of monoclonal antibody A to human S100A7 protein in Example 1 of the present invention;

[0020] Figure 3 This is an affinity curve diagram of the binding of monoclonal antibody B to human S100A7 protein in Example 1 of the present invention;

[0021] Figure 4 This is a graph showing the antigen epitope of human S100A7 protein recognized by monoclonal antibodies A and B in Example 1 of the present invention;

[0022] Figure 5 This is the standard curve of the human S100A7 protein double antibody sandwich ELISA system established based on monoclonal antibodies A and B in Example 2 of the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0024] Based on the information contained in the present invention, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for the purpose of illustrating specific aspects of the present invention. In fact, various changes that a person skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.

[0025] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers and other numerical values ​​used in the present invention to express the amount, percentage, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained according to the reported significant figures and by conventional rounding methods.

[0026] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, the scientific and technical terms used should have the meanings commonly understood by those of ordinary skill in the art.

[0027] The terms "include", "comprising", "containing", "having" and the like are not limiting in meaning, that is, other steps and other components that do not affect the results may be added.

[0028] The term "and / or" should be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is regarded as including the following situations: (i) A, (ii) B, and (iii) A and B.

[0029] The terms "first", "second", etc. are used to distinguish similar objects and are not necessarily used to describe a particular order or sequence, and it should be understood that such usage can be interchangeable under appropriate circumstances.

[0030] The terms "rabbit monoclonal antibody", "rabbit antibody" and "rabbit monoclonal antibody" and other similar terms have the same meanings. Unless otherwise specified, they all refer to rabbit antibodies that specifically bind to human S100A7 protein. The modifier "rabbit" indicates that the complementarity determining region (CDR) of the antibody is derived from a rabbit immunoglobulin sequence. The terms "human S100A7", "Human S100A7", "Human Psoriasin" and other similar terms have the same meanings and can be used interchangeably.

[0031] An antibody is an immunoglobulin molecule that is able to specifically bind to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" should be interpreted in the broadest sense and includes different antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, as long as they exhibit the desired antigen-binding activity. An antibody fragment can be one or more parts or fragments of a full-length antibody that retain the ability of the antibody to specifically bind to a target antigen.

[0032] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be divided into two types, namely κ chain and λ chain; heavy chains can be classified into five types, namely μ, δ, γ, α and ε chains, and antibodies are defined as IgM, IgD, IgG, IgA and IgE, respectively. The amino acid sequences near the N-terminus of the heavy and light chains vary greatly, while the amino acid sequences of other parts are relatively constant. The regions near the N-terminus of the light and heavy chains where the amino acid sequences vary greatly are called variable regions (V), and the regions near the C-terminus where the amino acid sequences are relatively stable are called constant regions (C). The heavy chain variable region (VH) and the light chain variable region (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable regions are also called complementarity determining regions (CDRs), which are ring-shaped structures. The heavy chain CDR and the light chain CDR are closely together and cooperate with each other through the FR region, forming a surface that can complement the three-dimensional structure of the target antigen or epitope, determining the specificity of the antibody and being the site where the antibody recognizes and binds to the antigen. The FR region is the more conservative part of VH and VL. They are generally in a β-folded configuration and are connected by three CDRs that form a connecting loop. Each VH and VL is usually composed of three CDRs and four FRs, arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0033] CDRs and FRs can be identified according to the Kabat definition, the Chothia definition, the accumulation of both the Kabat definition and the Chothia definition, the AbM definition, the contact definition, the IMGT unique numbering definition and / or the conformational definition, or any CDR determination method known in the art. As used herein, the Kabat numbering system is used to define.

[0034] The light chain constant region (CL) and the heavy chain constant region (CH) are not directly involved in the binding of antibodies to antigens, but they exhibit different effector functions, such as participating in antibody-dependent cytotoxicity of antibodies. The length of CL of different types of Ig (κ or λ) is basically the same, but the length of CH of different classes of Ig is different, such as IgG, IgA and IgD include CH1, CH2 and CH3, while IgM and IgE include CH1, CH2, CH3 and CH4. The amino acid sequences of the heavy chain and light chain constant regions of antibodies are well known in the art and can be obtained by querying the IMGT database.

[0035] A full-length antibody is the most complete antibody molecular structure and has a typical Y-shaped molecular structure. Therefore, in the context of the present invention, "full-length antibody", "complete antibody" and "Y-shaped antibody" have the same meaning and can be used interchangeably.

[0036] Antibody fragments are one or more parts or fragments of a full-length antibody, which essentially retain the same biological function or activity as the full-length form. Specifically, antibody fragments at least include the same CDR region as the full-length antibody, and more preferably have the same variable region, thereby retaining complete antigen recognition and binding sites, and can bind to the same antigen as the full-length antibody, especially to the same epitope. In typical examples, antibody fragments include: Fab, F(ab) 2 , Fab', F(ab') 2 、Fv、(Fv) 2 , scFv, sc(Fv) 2 These antibody fragments can be obtained by conventional techniques in the art.

[0037] (i) Fab: Antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable region and constant region) and a portion of the heavy chain (variable region and first constant region). Fab and F(ab') can be obtained by proteolytic cleavage of the full-length antibody. 2 , Fab' and other fragments. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab') 2 fragment and a pFc' fragment. F(ab') 2 The fragment is further reduced to form two Fab' fragments. Since Fab has an antigen binding region and a partial constant region, it not only has the same antibody-antigen affinity and excellent tissue penetration as scFv, but also has a more stable structure.

[0038] (ii) F(ab) 2 : A bivalent fragment consisting of two Fabs connected by a disulfide bridge in the hinge region.

[0039] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment, contains only the variable region, and is composed of the variable regions of a light chain and a heavy chain. It is a dimer of VH and VL non-covalently bound (VH-VL dimer). The three CDRs of each variable region interact with each other to form an antigen binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind to antigens, although the affinity is lower than that of the intact antibody.

[0040] (iv)(Fv) 2: Consists of two Fv fragments covalently linked together.

[0041] (v) scFv: Single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, which is composed of a heavy chain variable region (VH) and a light chain variable region (VL) connected by a flexible linker (generally composed of 10-25 amino acids), which retains the binding specificity of the original antibody to the antigen. The linker in the present invention is not particularly limited as long as it does not hinder the expression of the antibody variable regions connected to its two ends. Compared with full-length antibodies, scFv has the characteristics of small molecular weight, so it has higher penetration and lower immune side effects.

[0042] (vi)sc(Fv) 2 The fragment is composed of two heavy chain variable regions and two light chain variable regions connected by a linker or the like.

[0043] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include a complementary determining region (CDR) and a framework region (FR) from a rabbit immunoglobulin sequence. In other embodiments, the antibody may include amino acid residues encoded by non-rabbit immunoglobulin sequences, for example, humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection reaction while maintaining the required specificity and affinity. The term "chimeric antibody" refers to a portion of an antibody derived from a specific source or species, while the rest is derived from a different source or species. The term "humanized antibody" is a chimeric antibody of a non-human antibody such as a rabbit antibody's CDR region and a human FR region. In some cases, the variable region of a non-human antibody is combined with a constant region of a human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR region of a non-human antibody is combined with a FR region and a constant region derived from a human antibody sequence, that is, the CDR region of a non-human antibody is grafted onto a human antibody framework (FR) sequence, and this framework sequence is derived from a single or multiple FR sequences of other human antibody variable regions. In the present invention, the CDR region in the chimeric antibody or humanized antibody is derived from a rabbit-derived CDR region.

[0044] The terms "monoclonal antibody" or "single antibody" and the like are used interchangeably and refer to a homogeneous antibody population, i.e., the individual antibodies constituting the population are identical except for a small amount of mutations and / or post-translational modifications (e.g., isomerization, amidation) that may occur naturally. "Monoclonal antibodies" are highly specific and exhibit a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody population and should not be construed as limiting the source or preparation method of the antibody. The antibody can be prepared by a variety of methods, including but not limited to hybridoma methods, phage display methods, yeast display methods, recombinant DNA methods, single cell screening, or single cell sequencing methods.

[0045] The term "specific binding" is a well-known term in the art, and a molecule exhibits "specific binding" if it reacts with a specific target antigen or epitope more frequently, more rapidly, longer lastingly, and / or with greater affinity than with other target antigens or epitopes. "Specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding.

[0046] In order to make the above-mentioned objects and advantages of the present invention more obvious and understandable, the specific implementation methods of the present invention are described in detail below.

[0047] The embodiment of the present invention provides an antibody against human S100A7 protein, wherein the antibody is a first antibody or a second antibody, and the antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region both comprise three complementary determining regions (CDRs), which are named CDR1, CDR2 and CDR3, respectively; wherein: the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the first antibody are shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively; the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown as SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO. NO.18, SEQ ID NO.19 and SEQ ID NO.20.

[0048] The present invention uses human S100A7 protein as an immunogen (from ABclonal, item number RP01795), and directly enriches and separates B lymphocytes that can recognize human S100A7 protein from the spleen of immunized rabbits through B cell labeling and sorting technology, greatly improving the efficiency of antigen-specific B cell screening. In addition, the separated B lymphocytes are cultured in the form of single cells, and monoclonal antibodies are directly obtained, eliminating the cumbersome steps of multiple subcloning in hybridoma technology. A large number of monoclonal antibody strains are then expressed through recombinant technology, which has the advantages of simple production process and good product batch stability.

[0049] In terms of antigen recognition, the two monoclonal antibodies provided by the present invention can recognize and bind to human S100A7 protein, and have the advantages of strong specificity and high affinity. Among them, the affinity constant K of the first antibody and the second antibody is D The concentrations of 247 amino acids in the human S100A7 protein were 0.518 nM and 3.03 nM, respectively, which are suitable for the requirements of immunodiagnostic reagents for high sensitivity and high specificity antibody raw materials. Moreover, the two antibodies of the present invention bind to different antigenic epitopes of the human S100A7 protein. The double antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system developed using the antibodies has the advantages of strong specificity, wide linear range, high sensitivity, good accuracy and credibility, etc. The first antibody is used as the capture antibody and the second antibody labeled with biotin is used as the detection antibody to quantitatively detect the human S100A7 protein, with a detection limit as low as 162.44 pg / mL. The established method can be used for the efficient detection of low-concentration human S100A7 protein, and has good application prospects in the detection of S100A7 protein in biological samples such as human serum, urine, cells, and tissues.

[0050] Optionally, the light chain variable region and the heavy chain variable region each include 4 framework regions (FRs), and the 4 FRs and 3 CDRs are arranged alternately in sequence to form a variable region. The amino acid sequence of the light chain variable region (VL) of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.7. The amino acid sequence of the light chain variable region (VL) of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.17.

[0051] Optionally, the rabbit monoclonal antibody of the present invention further comprises a light chain constant region and a heavy chain constant region, CL and VL constitute the light chain, and CH and VH constitute the heavy chain. The constant region of the antibody is usually obtained by querying the IMGT online database.

[0052] Specifically, the amino acid sequence of the light chain (FL) of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.6. The amino acid sequence of the light chain (FL) of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.16. The light chain constant regions of the first antibody and the second antibody are both κ chains, and the heavy chain constant regions are both IgG type.

[0053] It should be noted that the monoclonal antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or its antigen binding region; the antigen binding region refers to a polypeptide that substantially maintains the same biological function or activity as the full-length antibody. Specifically, the antigen binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining a complete antigen recognition and binding site, and being able to bind to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen binding region is selected from Fab, F(ab) 2 , Fab', F(ab') 2 、Fv、(Fv) 2 , scFv and sc(Fv) 2 These antigen-binding regions can be obtained by conventional techniques in the art.

[0054] Yet another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector comprising the aforementioned nucleic acid molecule, or a host cell comprising the aforementioned nucleic acid molecule, wherein the nucleic acid molecule encodes the first antibody and / or the second antibody as described above.

[0055] Nucleic acid molecules can be in the form of DNA (such as cDNA or genomic DNA or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can also be a coding strand or a non-coding strand.

[0056] The sequence of the nucleic acid molecule can be obtained by deducing the antibody AA sequence through conventional means such as codon coding rules. The full-length sequence of the nucleic acid molecule or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis.

[0057] Illustratively, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.24 or a sequence complementary thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.28 or a sequence complementary thereto.

[0058] Illustratively, the nucleic acid sequence of the light chain of the first antibody is as shown in SEQ ID NO.21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or a sequence complementary thereto. The nucleic acid sequence of the light chain of the second antibody is as shown in SEQ ID NO.25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.27 or a sequence complementary thereto.

[0059] The original vector for constructing the recombinant vector is any conventional vector in the art, as long as it can carry the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, bacteriophages (such as λgt4λB, λ-Charon, λΔz1 and M13), cosmids and mini-chromosomes. The vector can be a cloning vector (i.e., used to transfer nucleic acid molecules to a host and multiply in a host cell) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecules inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule, which is then introduced into a host cell and cultured under specific conditions to express the antibody. This is a well-known technique in the art and will not be described in detail herein.

[0060] The nucleic acid molecules encoding the antibodies FL and FH of the present invention can be inserted into two vectors, respectively, which can be introduced into the same or different host cells. When the heavy chain and the light chain are expressed in different host cells, each chain can be separated from the host cell expressing it, and the separated heavy chain and light chain are mixed and incubated under suitable conditions to form antibodies. In other embodiments, the nucleic acid molecules of antibodies FL and FH can also be cloned into a vector, and each nucleic acid sequence is connected to a suitable promoter downstream; for example, each nucleic acid sequence encoding the heavy chain and the light chain can be operably connected to different promoters, or the nucleic acid sequence encoding the heavy chain and the light chain can be operably connected to a single promoter, so that both the heavy chain and the light chain can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibody.

[0061] The recombinant vector is transfected or transformed into the host cell using conventional techniques. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA are harvested after the exponential growth phase and treated with CaCl 2 MgCl 2 treatment; it can also be carried out by microinjection, electroporation or liposome packaging, etc. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging or particle bombardment to achieve gene introduction.

[0062] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in the present invention include, but are not limited to, Escherichia coli (e.g., DH5α, JM109, BL21, W3110), Bacillus (e.g., Bacillus subtilis, Bacillus thuringiensis), and Enterobacteriaceae strains (e.g., Salmonella typhimurium, Serratia marcescens), and Pseudomonas. Examples of eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining a host cell transfected or transformed with a recombinant vector as described above, the antibody can be expressed by culturing under suitable conditions, and then separated to obtain a purified antibody.

[0063] In the present invention, the recombinant vector is transfected or transformed into the host cell using conventional techniques. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with CaCl 2 MgCl 2 If necessary, microinjection, electroporation or liposome packaging can also be used. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation method, as well as microinjection, electroporation, liposome packaging, etc.

[0064] Preferably, the recombinant vector is the expression vector pBR322, and the host cell is a human kidney epithelial (293F) cell.

[0065] Another embodiment of the present invention provides an antibody pair against human S100A7 protein, which consists of the first antibody and the second antibody as described above.

[0066] The first antibody and the second antibody provided by the present invention recognize and bind to different epitopes of human S100A7, can be used for pairing antibodies to develop a double antibody sandwich ELISA system or kit, and have the advantages of high specificity, low detection limit, wide linear range, etc. when detecting human S100A7.

[0067] Another embodiment of the present invention provides the use of the above-mentioned antibody or antibody pair against human S100A7 protein in the preparation of a kit for detecting human S100A7 protein.

[0068] The advantages of using the antibody or antibody pair against human S100A7 protein in preparing a kit for detecting human S100A7 protein are the same as the advantages of the antibody against human S100A7 protein over the prior art as described above, and will not be elaborated here.

[0069] Based on the same inventive concept as above, an embodiment of the present invention further provides a kit for detecting human S100A7 protein, wherein the kit comprises the first antibody and / or the second antibody as described above.

[0070] It should be emphasized that the first antibody and the second antibody can be used separately, together, or in pairs. When detecting, if used separately or together, the first antibody and / or the second antibody is used as a primary antibody or a capture antibody, the sample to be tested is contacted with the capture antibody, and then the antibody is detected. In some embodiments, the capture antibody can be coupled (covalently or non-covalently) to a detection label, and the qualitative or quantitative detection of the S100A7 protein is achieved by analyzing the change in the identifiable signal generated by the detection label. In other embodiments, the primary antibody against human S100A7 protein is not labeled, but the detection label is coupled to a secondary antibody (as a detection antibody) or other molecules that can bind to the capture antibody. For example, if the anti-human S100A7 protein antibody is a rabbit IgG antibody, the secondary antibody can be an anti-rabbit IgG antibody, thereby generating a change in the identifiable signal by coupling the secondary antibody with the detection label. If used in pairs, one of the first antibody and the second antibody is used as a primary antibody or a capture antibody, and the other is used as a secondary antibody or a detection antibody.

[0071] The above-mentioned detection method adopts common immunological methods, including but not limited to: enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence (IF), immunoblotting (WB), flow cytometry (FC), etc. The detection object includes recombinantly expressed human S100A7 protein, human S100A7 protein naturally secreted or expressed by cells or tissues. The detection samples include but are not limited to serum, plasma, urine, cells or cell culture fluid, tissues or tissue homogenates, etc.

[0072] Preferably, the detection kit is a double antibody sandwich enzyme-linked immunosorbent assay kit, comprising a first antibody and a second antibody, wherein the first antibody serves as a capture antibody (or primary antibody), the second antibody serves as a detection antibody (or secondary antibody), and the second antibody is coupled with a detection label.

[0073] The above-mentioned detection labels for generating identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0074] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Guide (Fourth Edition) published by Cold Spring Harbor Laboratory, or usually under the conditions recommended by the manufacturer.

[0075] Example 1 Screening and preparation of rabbit monoclonal antibodies A and B that recognize human S100A7 protein

[0076] This embodiment is based on B cell labeling and sorting technology, directly enriches and separates B lymphocytes that can recognize human S100A7 protein from the spleen of New Zealand white rabbits immunized with antigen protein S100A7, greatly improving the efficiency of antigen-specific B lymphocyte screening, and then cultured B lymphocytes in the form of single cells to directly obtain monoclonal antibodies, eliminating the cumbersome steps of multiple subcloning in hybridoma technology. Finally, large-scale production of rabbit monoclonal antibodies is achieved through genetic engineering recombinant expression technology. Specifically, naturally paired antibody heavy chain variable region (VH) and light chain variable region (VL) genes are obtained from antigen-specific B lymphocytes by PCR amplification, and the aforementioned genes are loaded onto expression vectors containing heavy and light chain constant regions, the vectors are transfected into host cells and cultured, and the target antibodies A and B obtained are separated and purified from the cell culture supernatant. Antibody sequencing work was completed by Jin Kairui Biotechnology Co., Ltd., and its amino acid (AA) sequence and gene (DNA) sequence are shown in Table 1-2 respectively. For convenience of description, the light chain complementary determining regions 1-3 are represented by LCDR1, LCDR2 and LCDR3, respectively, and the heavy chain complementary determining regions 1-3 are represented by HCDR1, HCDR2 and HCDR3, respectively.

[0077] Table 1 Sequence information of monoclonal antibody A in this example

[0078]

[0079] Table 2 Sequence information of monoclonal antibody B in this example

[0080]

[0081] The preparation method of rabbit monoclonal antibodies A and B specifically includes the following steps:

[0082] 1. Animal immunization: Human S100A7 protein (from ABclonal, catalog number RP01795) was used as an immunogen to immunize New Zealand white rabbits. Each white rabbit was immunized with 200 μg. Before the first immunization, the immunogen was mixed with an equal amount of complete Freund's adjuvant to make an emulsifier, and injected subcutaneously at multiple points on the rabbit's abdomen and back. After an interval of 3 weeks, 100 μg of the immunogen was mixed with an equal amount of incomplete Freund's adjuvant to make an emulsifier, and injected subcutaneously at multiple points on the rabbit's abdomen and back for two booster immunizations. After three immunizations, rabbit serum samples were collected, and the titer against Human S100A7 was determined by ELISA after dilution. Rabbits with high serum titers were selected and boosted with 200 μg of the immunogen for multiple subcutaneous injections. The animals were sacrificed three days later and the spleen was taken.

[0083] 2. Isolate B lymphocytes from the spleen and sort B lymphocytes: Use conventional methods to isolate B lymphocytes from the spleen, and sort out antigen-specific B lymphocytes. For related methods, please refer to the patents "Method for efficiently separating single antigen-specific B lymphocytes from spleen cells (publication number: CN110016462A, publication date: 2019-07-16)" and "A B lymphocyte in vitro culture system and application (publication number: CN111518765A, publication date: 2020-08-11)".

[0084] 3. Cloning of the gene encoding rabbit monoclonal antibody: The supernatant of cultured B lymphocytes was used to identify positive clones by antigen-coated ELISA. The cells of the positive clones were collected and lysed and then analyzed by Quick-RNA TM RNA was extracted according to the instructions of the MicroPrep kit (purchased from ZYMO, product number R1051) and reverse transcribed into cDNA. Using cDNA as a template, the naturally paired rabbit monoclonal antibody light chain variable region (VL) and heavy chain variable region (VH) were amplified from the cDNA of the corresponding positive clone by PCR method; PCR reaction system: 4μL cDNA, 1μL forward primer (10mM), 1μL reverse primer (10mM), 12.5μL 2×Gloria HiFi (from ABclonal self-sold and produced, product number RK20717) and 6.5μL H 2 O; PCR amplification program: 98℃ pre-denaturation for 30s, followed by 40 cycles of 98℃ for 10s, 64℃ for 30s, and 72℃ for 30s, and finally kept at 72℃ for 5min. The resulting reaction solution was stored at 4℃. The primer sequences (5'-3') for amplifying VL and VH genes are as follows, where F and R represent forward and reverse primers, respectively:

[0085] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO. 29);

[0086] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 30);

[0087] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 31);

[0088] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 32).

[0089] The amplified products were sequenced to obtain the variable regions of the antibodies and their encoding gene sequences; the heavy chain constant region (CH) was obtained by searching for rabbit IgG gamma C reign in the IMGT online database (www.imgt.org), and the light chain constant region (CL) was obtained by searching for rabbit IgG Kappa C reign.

[0090] 4. Production and purification of rabbit monoclonal antibodies: In order to obtain multiple rabbit monoclonal antibodies that recognize recombinant Human S100A7 protein, the CL and CH genes were inserted into the mammalian expression vector pBR322. The resulting vector map is shown in Figure 1 , where pBR322 origin and f1origin are replication promoters, Ampcillin is a resistance gene, CMV promoter is a transcription promoter, SV40 PAterminator is a tailing signal, Light chain constant is the nucleic acid sequence of CL (left), and Heavy chain constant is the nucleic acid sequence of CH (right). Then, the amplified VL and VH genes were connected to the expression vector pBR322 carrying CL and CH genes linearized with XbaI and NheI restriction endonucleases respectively by homologous recombination to obtain complete light chain and heavy chain gene expression vectors, and the vector construction was successfully verified by sequencing.

[0091] In order to achieve secretory expression of antibodies, signal peptide sequences need to be added to the front end of their VL and VH genes. Signal peptides can use antibody expression signal peptides commonly used in the art, such as the patent "rabbit monoclonal antibody against human interferon α2 and its application (publication number: CN116063487A, publication date: 2023-05-05)" and the patent "high affinity human IL-5 rabbit monoclonal antibody and its application (publication number: CN115819578A, publication date: 2023-03-21)" VL upstream has a signal peptide "MDTRAPTQLLGLLLLWLPGATF" or "MDTRAPTQLLGLLLLWLPGARC", and VH upstream has a signal peptide "METGLRWLLLVAVLKGVQC". Of course, those skilled in the art can also replace other signal peptides for antibody expression after obtaining the antibody sequence of the present invention. Therefore, the signal peptide sequence is not reflected in the antibody sequence of Table 1-2 of this embodiment.

[0092] The encoding gene of the above-mentioned signal peptide "MDTRAPTQLLGLLLLWLPGATF" can be atggacacgagggcccccactcagctgctgggacttctgctgctttggctgcctggcgccacgttc; the encoding gene of the signal peptide "MDTRAPTQLLGLLLLWLPGARC" can be atggacacgagggcccccactcagctgctgggtctcctgctgctgtggttgcccggagcaagatgc; the encoding gene of the signal peptide "METGLRWLLLVAVLKGVQC" can be atggagactgggctgcgctggcttctcctggtagcggtgctgaag ggggttcaatgc or atggagactgggctgcgctggcttctcctggtggcagtactcaaaggtgttcagtgt.

[0093] The constructed expression vectors containing the light chain (FL) gene and the heavy chain (FH) gene were transfected into 293F cells together. After transfection, the cells were cultured for 72-96 hours to obtain the culture supernatant containing the recombinant rabbit monoclonal antibody that recognizes Human S100A7. The recombinant rabbit monoclonal antibody that recognizes Human S100A7 protein was purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA023100). The antibody purity was verified to be >95% using 12% SDS-PAGE gel electrophoresis. The purified antibody was aliquoted and stored at -20°C for later use.

[0094] 1.5. Antibody performance testing: After obtaining multiple recombinantly expressed antibodies, the antibodies were identified for affinity and antigen recognition epitopes to obtain the target antibody strains A and B of the present invention.

[0095] 1) Identification of antibody affinity: The antigen-antibody binding curve was determined using the Gator biomolecular interaction analyzer from Probe Life to identify antibody affinity. First, the antigen protein Human S100A7 was immobilized on the HFC (Anti-HIgG FC) probe (purchased from Gator Bio, catalog number 160003) at a solidification concentration of 3 μg / mL; the probe with the immobilized antigen was then placed in the antibody solution to test the antibody binding to the antigen. The concentration of antibody A was 3.3 μg / mL and the concentration of antibody B was 5.23 μg / mL. When the antigen-antibody binding reached saturation, the probe was transferred to the dissociation system to complete the dissociation process. The affinity curves of antibodies A and B are shown in Figure 1 and Figure 2, respectively. Figure 2-3 , where the ordinate represents the change in the thickness of the conjugate after the probe binds to the antibody and protein, the abscissa represents the binding time, the dark gray curve is the real-time binding value curve, and the light gray curve is the fitted average curve. The affinity constants calculated by curve fitting are shown in Table 3, where the dissociation coefficient K off The constant that characterizes the dissociation rate between antibody and antigen, the binding coefficient K on A constant that characterizes how quickly an antibody binds to its target, the affinity constant K D K off / K on The ratio of , characterizes the dissociation equilibrium constant between antibody and antigen.

[0096] Table 3 Affinity-related parameter determination results of monoclonal antibodies A and B

[0097] Monoclonal antibodies <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> A <![CDATA[1.14×10 -4 ]]> <![CDATA[2.20×10 5 ]]> <![CDATA[5.18×10 -10 ]]> B <![CDATA[8.19×10 -4 ]]> <![CDATA[2.70×10 5 ]]> <![CDATA[3.03×10 -9 ]]>

[0098] As shown in Table 3, the affinity constants K of antibody A and antibody B for human S100A7 are D The values ​​were 0.518 nM and 3.03 nM respectively, indicating that rabbit monoclonal antibodies A and B have high affinity to recombinant Human S100A7.

[0099] 2) Identification of antigen recognition epitopes: The obtained antibodies were paired using the Gator biomolecular interaction analyzer from Probe Life to test the antigen epitopes they recognized. First, the antigen protein was immobilized on the Human S100A7 protein on the HFC (Anti-HIgG FC) probe at a concentration of 3 μg / mL. Then, the probes with the immobilized antigen protein were placed in the solutions of antibodies A and B in turn, so that the antibody strains A and B were bound to the S100A7 protein to saturation. By analyzing the binding characteristics of different antibodies on the antigen, the recognition epitopes of the antibody strains A and B were analyzed. The results are shown in Figure 4 , where the ordinate represents the change in thickness of the complex after the probe binds to the antibody and protein, and the abscissa represents the binding time.

[0100] from Figure 4 It can be seen that the probe immobilized with Human S100A7 can obviously bind to antibody A as the second antibody after binding to B. At this time, the shift value is 0.203. It can be seen that the two antibodies bind to different epitopes on the Human S100A7 protein. Therefore, the two antibodies can be used as paired antibodies for double antibody sandwich ELISA detection.

[0101] Example 2 Establishment of a double antibody sandwich ELISA system based on antibodies A and B and its analytical sensitivity

[0102] Biotin labeling of antibody B: prepare antibody B into a 1 mg / mL solution, and use dimethyl sulfoxide (DMSO) to prepare NHS-LC-biotin (N-succinimidyl 6-biotin aminocaproic acid, purchased from Thermo Company) into a 60 mg / mL solution; take 200 μL of 1 mg / mL antibody B solution, add 10 μL of 60 mg / mL NHS-LC-biotin solution; after mixing, place at room temperature for 30 minutes, and then add 50 μg 500mM Tris-HCl (pH9.0) to terminate the reaction; finally, add a large amount of 1×PBS buffer (pH7.4), centrifuge with a centrifugal column with an exclusion limit of 30KDa to remove excess biotin molecules and balance the buffer system to obtain biotin-labeled antibody B (B-biotin).

[0103] Antibody A was used as the capture antibody and antibody B-biotin was used as the detection antibody to establish a double antibody sandwich enzyme-linked immunosorbent assay (ELISA) method, and the steps were as follows: 1) Coating capture antibody A: Antibody A was diluted to 4 μg / mL with 1×PBS, added to a 96-well microplate at 100 μL / well, covered with a cover film, and incubated at 4°C for 16-20 h; 2) Washing: After the incubation was completed, the liquid in the well was discarded, and the plate was washed once with 1×PBST, 300 μL of sample was added, and the liquid in the well was discarded after standing for 40 s; 3) Blocking: The blocking solution (1×PBS containing 2% BSA, 5% sucrose, 0.05% Tween 20 and 0.1% proclin 300, pH 5.0) was added to the plate. 7.2) Add 200 μL / well to the plate wells, cover with a cover film, and block at 37°C for 2 hours. After blocking, discard the blocking solution, pat the ELISA plate dry, place it in a 37°C oven to dry for 0.5-2 hours, and take it out for use; 4) Add antigen protein: Recombinant Human S100A7 protein (purchased from RD, product number 9085-SA) was diluted with diluent (1×PBS containing 2% BSA, 0.05% Tween 20 and 0.1% proclin300, pH 7.2) Dilute to the following concentrations: 6000, 3000, 1500, 550, 375, 187.5, 93.75, 0 pg / mL, then add to the ELISA plate at 100 μL / well, cover with a cover film, and incubate at 37°C for 2 h; 5) Wash the plate: Same as step 2); 6) Add detection antibody B: Dilute antibody B (B-biotin) labeled with biotin to 0.05 μg / mL, then add to the ELISA plate at 100 μL / well, cover with a cover film, and incubate at 37°C for 1 h; 7) Wash the plate: Same as step 2); 8) Add SA-HRP: Add 100×SA-HRP (horseradish peroxidase labeled streptavidin , purchased from Wuhan Sanying Biotechnology Co., Ltd., product number SA00001-0) The concentrate was diluted 100 times and added to the ELISA plate at 100 μL / well, covered with a cover film, and incubated at 37°C for 0.5h; 9) Washing: Same as step 2); 10) Add TMB colorimetric solution: 3,3',5,5'-tetramethylbenzidine (TMB) colorimetric solution (purchased from Tetramethylbenzidine, product number 4ATMB1000) was added to the ELISA plate at 100 μL / well, covered with a cover film, and incubated at 37°C for 15min; 11) Reading: After the incubation is completed, take out the ELISA plate, add 50 μL of stop solution (1 mol / L hydrochloric acid) to each well, and read the results immediately with an ELISA reader.

[0104] The concentration of Human S100A7 protein was used as the horizontal axis, and the correction value of the absorbance value was Y1 (Y1 = OD 450nm -OD 630nm ) as the ordinate, see Figure 5The results showed that antibody A was used as the capture antibody and antibody B was used as the detection antibody to perform ELISA on human S100A7, which showed good linearity and made the test results have good accuracy.

[0105] The average absorbance of 16 blank wells (dilution solution without standard protein) and the sum of 2 times the standard deviation are taken as the absorbance of sensitivity, and the concentration obtained by substituting it into the standard curve is the sensitivity of the detection system (see Table 4). The results show that the detection limit of the double antibody sandwich ELISA detection system of the present invention is as low as 162.44 pg / mL, which has a high sensitivity.

[0106] Table 4 Sensitivity of the double antibody sandwich ELISA method based on antibodies A and B

[0107]

[0108] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An antibody against human S100A7 protein, characterized in that: The antibody is a primary antibody or a secondary antibody, wherein: The amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NOs. 3-5, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NOs. 8-10, respectively; The amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NOs.13-15, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NOs.18-20, respectively.

2. The antibody against human S100A7 protein according to claim 1, characterized in that: The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7; The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17.

3. The antibody against human S100A7 protein according to claim 2, characterized in that: The amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16.

4. The antibody against human S100A7 protein according to claim 1, characterized in that: The first antibody or the second antibody is a full-length antibody or an antigen-binding region of the full-length antibody; The antigen binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the first antibody or the second antibody as described in any one of claims 1-4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleic acid sequence of the light chain variable region of the first antibody is as shown in SEQ ID NO.22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.24 or a sequence complementary thereto; The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.28 or a sequence complementary thereto.

7. The nucleic acid molecule according to claim 6, characterized in that The nucleic acid sequence of the light chain of the first antibody is as shown in SEQ ID NO.21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or a sequence complementary thereto; The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO.25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.27 or a sequence complementary thereto.

8. An antibody pair against human S100A7 protein, characterized in that: The method comprises the first antibody and the second antibody as described in any one of claims 1 to 4.

9. A kit for detecting human S100A7 protein, characterized in that: The kit comprises the antibody against human S100A7 protein according to any one of claims 1 to 4 or the antibody pair against human S100A7 protein according to claim 8 .

10. The kit for detecting human S100A7 protein according to claim 9, characterized in that: The kit is a double antibody sandwich ELISA kit, which comprises a first antibody and a second antibody, wherein the first antibody is a capture antibody, the second antibody is a detection antibody, and the second antibody is coupled with a detection label.

Images