Hyphantria cunea HcARNT and HcCncC gene dsRNA and application thereof in prevention and treatment of hyphantria cunea

Abstract

The invention provides dsRNA (double-stranded ribonucleic acid) of hyphantria cunea HcARNT and HcCncC genes, wherein the full-length cDNA of the HcARNT and the full-length cDNA of the HcCncC genes are respectively as shown in SEQ ID No. 1 and SEQ ID No. 2. The dsHcARNT or the dsHcCncC can silence the expression of the HcARNT or the HcCncC of the fall webworm respectively, interfere the HcARNT gene or the HcCncC gene of the fall webworm, and can enhance the insecticidal effect of tannic acid which is a plant secondary substance. The invention also provides application of the dsRNA in prevention and treatment of fall webworms, and the timely scheme provided by the invention can reduce the use of pesticides, and has the beneficial effects of greenness, environmental protection and the like.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to dsRNA of HcARNT and HcCncC genes of the cuneiform moth and their application in preventing and controlling the cuneiform moth. Background Art

[0002] Hyphantria cunea (Drury) is a plant-eating pest of the order Lepidoptera. It has a wide host range, a large food intake, and a long duration of damage. When the gypsy moth occurs on a large scale, it can eat up the leaves of most host plants in a very short time, posing a serious threat to the development of agriculture and forestry. In actual prevention and control, chemical prevention is still the main method, and the large-scale use of pesticides increases the resistance of pests and easily causes environmental pollution and human poisoning. Therefore, it is urgent to develop green and efficient integrated prevention and control methods to effectively control the damage of the gypsy moth.

[0003] Long-term studies on insects have shown that insects have feeding preferences and will determine host plants based on their own nutritional needs. When insects feed on host plants, plant secondary metabolites will enter the insects' bodies, resist insect feeding, and inhibit insect growth, development, and metabolism. Therefore, we can use this green and natural plant secondary metabolite for integrated pest control. Tannic acid is one of the phenolic compounds and the most abundant secondary metabolite produced by plants. It can protect plants from insect damage through inhibition or toxicity.

[0004] Tannic acid has a strong toxic effect on herbivorous insects. It changes the growth and development of insects by binding to proteins, reducing the ability to absorb nutrients and inducing midgut damage. When plant secondary metabolites such as tannic acid enter the insect body, they will induce the insect's own detoxification mechanism and enhance the insect's ability to metabolize plant secondary metabolites. One of the reasons for the enhanced metabolism of insects to exogenous toxic substances is the overexpression of detoxification enzyme genes in their bodies.

[0005] Transcription factors can regulate the expression of detoxification enzyme genes, and the functions of transcription factors ARNT and CncC in the resistance of the gypsy moth to foreign substances have not been reported. Therefore, the present invention searches through the obtained gypsy moth transcriptome data to obtain transcription factor sequences, obtains gypsy moth transcription factors HcARNT and HcCncC by cloning, studies their molecular characteristics, and studies the induction of tannic acid on the gypsy moth transcription factors HcARNT and HcCncC. In addition, after interfering with the HcARNT and HcCncC genes by RNAi technology, the larvae after the interference are treated with tannic acid to observe the changes in their sensitivity to the plant secondary metabolite tannic acid. Thus, a new green control technology for gypsy moths using plant secondary metabolites and dsRNA is obtained, providing new ideas and methods for the comprehensive management of gypsy moths. Summary of the invention

[0006] In order to overcome the defects and shortcomings of the existing gypsy moth control technology, the present invention provides dsRNA of the gypsy moth HcARNT and HcCncC genes and their application in controlling the gypsy moth, thereby achieving the purpose of green and efficient control of the gypsy moth.

[0007] The objective of the present invention is achieved through the following technical solutions:

[0008] The present invention provides dsRNAs of HcARNT and HcCncC genes of the cunea nymph. The full-length cDNAs of the HcARNT and HcCncC genes are shown as SEQ ID No.1 and SEQ ID No.2, respectively, and encode proteins with amino acid sequences shown as SEQ ID No.3 and SEQ ID No.4, respectively.

[0009] Furthermore, the primer sequence for synthesizing the dsRNA of the HcARNT gene of the American cunea is the upstream primer (5'-3')

[0010] CTAGCTAGCTTCCCACTATACTACAGAGAGTTACG, downstream primer (5'-3') CCGCTCGAGATTCAGCATATTGTTAACTGAGGC, the primer sequence for synthesizing the dsRNA of the HcCncC gene of the gypsy moth is the upstream primer (5'-3') CTAGCTAGCGTGATATGGATCTGTCTAGCGAC; downstream primer (5'-3') CCGCTCGAGTCCTCACTGCTCACCAGCTC.

[0011] The present invention also provides the use of the above dsRNA in controlling the gypsy moth.

[0012] Furthermore, the application is to treat the gypsy moth with the dsRNA of the HcARNT gene of the gypsy moth or the dsRNA of the HcCncC gene of the gypsy moth to achieve control of the gypsy moth.

[0013] Furthermore, the dsRNA of the HcARNT gene of the gypsy moth or the dsRNA of the HcCncC gene of the gypsy moth is used in combination with botanical insecticides to jointly control the gypsy moth.

[0014] Furthermore, the gypsy moth is first treated with dsRNA of the HcARNT gene of the gypsy moth or dsRNA of the HcCncC gene of the gypsy moth, and then the gypsy moth is treated with a botanical insecticide.

[0015] Furthermore, the gypsy moth was treated with 2.0 μg of dsRNA of the HcARNT gene of the gypsy moth for 48 hours or dsRNA of the HcCncC gene of the gypsy moth for 24 hours, and then treated with 1 mg / mL of tannic acid.

[0016] The present invention also provides a method for controlling the gypsy moth, which comprises first treating the gypsy moth with a solution containing any of the above HcARNT and HcCncC gene dsRNAs, and then treating the gypsy moth with a botanical insecticide solution.

[0017] Furthermore, the time for treating the gypsy moth with the HcARNT gene dsRNA is 48 hours; and the time for treating the gypsy moth with the solution of the HcCncC gene dsRNA is 24 hours.

[0018] Furthermore, the botanical pesticide solution is a tannic acid solution.

[0019] The beneficial effects of the present invention are:

[0020] (1) The gypsy moth may adapt to tannic acid stress by upregulating the expression of HcARNT or HcCncC, indicating that HcARNT or HcCncC is related to the detoxification metabolism of the gypsy moth.

[0021] (2) dsHcARNT or dsHcCncC can silence the expression of HcARNT or HcCncC in the gypsy moth, respectively. Interfering with the HcARNT gene or HcCncC gene in the gypsy moth can enhance the insecticidal effect of plant secondary metabolites such as tannic acid.

[0022] (3) After silencing the HcARNT and HcCncC genes of the gypsy moth using RNA interference technology, they were combined with tannic acid to study their effects on the toxicity of tannic acid. It was found that after treatment with dsHcARNT and dsHcCncC, the mortality rate of the gypsy moth treated with tannic acid increased, indicating that dsHcARNT or dsHcCncC can enhance the toxicity of tannic acid.

[0023] (4) The present invention provides a basis for the combined use of RNA biopesticides and plant secondary metabolites.

[0024] (5) The method for preventing and controlling the gypsy moth provided by the present invention is green and environmentally friendly. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a phylogenetic analysis of HcARNT in the gypsy moth and other insects;

[0026] Figure 2 This is a phylogenetic analysis diagram of HcCncC of the gypsy moth and other insects;

[0027] Figure 3 This is the result diagram of the response of HcARNT of the gypsy moth to tannic acid;

[0028] Figure 4 This is the result diagram of the effect of tannic acid on the expression of HcCncC;

[0029] Figure 5 This is the result diagram of the effect of dsHcARNT on the relative expression of HcARNT in the gypsy moth;

[0030] Figure 6 This is the result diagram of the effect of dsHcCncC on the relative expression level of HcCncC in the gypsy moth;

[0031] Figure 7 This is the result diagram of the effect of dsHcARNT treatment on the toxicity of tannic acid in the American white moth;

[0032] Note: Figure 7 A is the mortality rate of each group at 48 h; Figure 7 B is the mortality rate of each group at 72 h; Figure 7 C is the mortality rate of each group at 96 h; Figure 7 D is the mortality rate of each group at 120 h; Figure 7 E is the mortality rate of each group at 144 h; Figure 7 F is the survival rate of the gypsy moth in each treatment.

[0033] Figure 8 This is the result diagram of the effect of dsHcCncC on the toxicity of tannic acid after treating the American white moth;

[0034] Note: Figure 8 A is the mortality rate of each group at 48 h; Figure 8 B is the mortality rate of each group at 72 h; Figure 8 C is the mortality rate of each group at 96 h; Figure 8 D is the mortality rate of each group at 120 h; Figure 8 E is the survival rate of the gypsy moth in each treatment. DETAILED DESCRIPTION

[0035] The technical solution of the present invention is further described below in conjunction with the accompanying drawings, but is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention should be included in the protection scope of the present invention.

[0036] 1. Experimental Materials

[0037] 1Test insects

[0038] Test insects: American white moth was collected from Suining County, Xuzhou City, Jiangsu Province. Larvae were fed with fresh mulberry leaves, and adults were fed with sucrose water. Feeding conditions: temperature 25±1℃, humidity 55±5%, photoperiod L16:D8.

[0039] 2 Experimental reagents

[0040] Table 1 Main reagents

[0041]

[0042]

[0043] 3 Experimental instruments

[0044] Table 2 Experimental instruments

[0045]

[0046]

[0047] 4. Preparation of experimental reagents

[0048] (1) Preparation of 50×TAE electrophoresis buffer is shown in Table 3:

[0049] Table 3 Preparation of 50×TAE electrophoresis buffer

[0050]

[0051] (2) LB liquid culture medium preparation is shown in Table 4:

[0052] Table 4 Preparation of LB liquid culture medium

[0053]

[0054] (3) 1M NaOH preparation is shown in Table 5:

[0055] Table 5 Preparation of NaOH

[0056]

[0057]

[0058] (4) Ampicillin preparation is shown in Table 6

[0059] Table 6 Preparation of ampicillin

[0060]

[0061] After mixing, the mixture was filtered using a 0.22 μm filter membrane and stored at -20°C.

[0062] (5) Reagent preparation

[0063] IPTG solution: 240 mg IPTG + 10 mL ddH2O, filtered through a 0.22 μm filter membrane, divided into portions, and stored at -20°C.

[0064] Tetracycline solution: 250 mg tetracycline + 5 mL ddH2O + 45 mL anhydrous ethanol, mix well, divide into portions, and store at -20°C.

[0065] AMP solution: 1000 mg AMP + 10 mL ddH2O, filter with 0.22 μm filter membrane, divide into portions, and store at -20°C.

[0066] Example 1 Cloning and expression characteristics of HcARNT or HcCncC gene of Hyphantria cunea 1 Test insect treatment

[0067] Tannic acid (0.01 mg / mL, 0.1 mg / mL) was used to soak mulberry leaves and then dried to feed the 4th instar larvae of the American moth. ddH2O was used as the control group. All treatments were repeated three times, and the American moth larvae were collected at 12, 24, 48 and 72 hours after treatment and stored in a -80℃ ultra-low temperature refrigerator for later use.

[0068] 2 Extraction of total RNA from Hyphantria cunea

[0069] (1) Take a nymph from the insect box, put it into a sterilized 1.5 mL centrifuge tube, and freeze it quickly in a -80°C ultra-low temperature freezer.

[0070] (2) First add 400 μL of TRNzol to the centrifuge tube containing the gypsy moth, grind thoroughly with a grinding rod until there is no obvious tissue, then add 600 μL of TRNzol, mix thoroughly, and let stand at room temperature for 5 minutes.

[0071] (3) Add 200 μL of chloroform, mix well using a vortex shaker, and let stand at room temperature for 5 minutes.

[0072] (4) Precool the low-temperature high-speed refrigerated centrifuge to 4°C, centrifuge (12000 rpm for 15 min), take the supernatant to a new 1.5 mL centrifuge tube, add an equal amount of isopropanol, mix well, let stand at room temperature for 10 min, and centrifuge again at 12000 rpm for 10 min.

[0073] (5) Remove the supernatant from the centrifuge tube, add 1 mL of 75% ethanol to the bottom precipitate, centrifuge at 7500 rpm for 5 min at 4°C, remove the supernatant from the centrifuge tube, and retain the precipitate.

[0074] (6) Add a certain amount of RNA-free water to the precipitate and use a pipette to pipette until the precipitate is completely dissolved. Detect the RNA quality by gel electrophoresis and the concentration by UV spectrophotometer. Store the remaining RNA in a -80°C ultra-low temperature freezer.

[0075] 3. Synthesis of the first strand of template cDNA

[0076] TaKaRa's reverse transcription kit PremeScript TM 1st Strand Cdna Synthesis, reverse transcribe the total RNA of the American moth into cDNA, the specific operation is as follows. The first step reaction system and procedure:

[0077] 1μL oligo dT Primer

[0078] 1μL dNTP Mixture

[0079] 1μL total RNA from Hyphantria cunea

[0080] 7 μL RNase Free ddH2O

[0081] 65℃, 5min;

[0082] The first step reaction solution was taken out and quickly cooled on ice before the second step reaction was performed.

[0083] The second step reaction system and procedure:

[0084] The second step reaction is carried out on the basis of the first step reaction.

[0085] 4 μL 5× PrimerScript Buffer

[0086] 0.5μL RNase Inhibitor

[0087] 1 μL PrimeScript RTase

[0088] 4.5 μL RNase Free ddH2O

[0089] 42℃ for 60min, 95℃ for 5min.

[0090] After the procedure was completed, the reaction solution was taken out and stored in a -20°C refrigerator.

[0091] 4 Cloning of HcARNT or HcCncC gene

[0092] The second-generation transcriptome data of the cuneiform moth were searched to find the HcARNT gene sequence of the cuneiform moth. In the third-generation transcriptome data of the cuneiform moth, the HcCncC gene sequence of the cuneiform moth was found by searching. Primer premier 5.0 was used for primer design, and the ORF frame of HcARNT was analyzed by NCBI ORFfinder. The primer sequences are shown in the following table:

[0093] Table 7 Primers used for cloning HcARNT gene

[0094]

[0095] Table 4-1 Primer sequences for cloning HcCncC gene

[0096]

[0097] 5 PCR amplification of target gene

[0098] Take 1 μL of cDNA obtained after reverse transcription, 25 μL of Super mix, 1 μL of upstream primer and downstream primer, and 22 μL of ddH2O and add them to a PCR tube. Use a PCR instrument to react according to the following procedure:

[0099] 1. 95℃ for 3 min; 2. 95℃ for 15 s, 57℃ for 30 s, 72℃ for 1 min, cycle 30 times; 3. 72℃ for 5 min; 4℃∞.

[0100] All PCR products after the reaction were detected by 1% gel electrophoresis and photographed.

[0101] The Beijing Jinsha Biotechnology Company Gel Recovery Kit was used for the experimental operation. The specific steps are as follows:

[0102] (1) Turn on the light of the gel imager, place the gel under the light to find the target band, and quickly cut the gel containing the target gene fragment and place it in a 1.5 mL centrifuge tube.

[0103] (2) Add 500 μL of Buffer GL and place in a heating vessel at 65°C for 5 min, turning the vessel 2-3 times to allow the gel to completely dissolve.

[0104] (3) Add 250 μL of Buffer BL to the adsorption column and centrifuge (12000 rpm for 1 min) to activate the adsorption column.

[0105] (4) Add the gel solution dropwise to the adsorption column, centrifuge (12000 rpm for 1 min), and discard the waste liquid.

[0106] (5) Add 700 μL Buffer W2, centrifuge (12000 rpm for 1 min), and discard the waste liquid.

[0107] (6) Repeat (5).

[0108] (7) Centrifuge at 12000 rpm for 2 min.

[0109] (8) Prepare a new 1.5 mL centrifuge tube, place the centrifuged adsorption column EC in the centrifuge tube, let it stand for 5 min, and add 35 μL of 65°C preheated ddH2O.

[0110] (9) Let stand at room temperature for 2 min, centrifuge at 12000 rpm for 2 min, and obtain the gel recovery product.

[0111] (10) The product obtained by centrifugation was aspirated and added to the adsorption column EC again, and centrifuged at 12000 rpm for 2 min to increase the concentration of the recovered product;

[0112] (11) Detect the concentration of the recovered glue product.

[0113] 7. Ligation and transformation of HcARNT or HcCncC gene cloning vector

[0114] Connection system:

[0115]

[0116] Gently pipette to mix, and react at room temperature for 5 minutes. This will allow the target fragment to be connected to the cloning vector (pClone007).

[0117] (1) Mix the ligation product (5 μL) and DH5α competent cells (50 μL) and incubate on ice for 30 min.

[0118] (2) Place in a dry-wet heater at 42°C for 45 seconds. Remove and quickly place on ice for 2 minutes.

[0119] (3) Add 500 μL of LB liquid culture medium to the reaction solution and incubate at 180 rpm, 37°C, for 1 h.

[0120] (4) Melt the solid LB into liquid and place it on a clean bench. When the temperature drops to about 50°C, add Amp to a final concentration of 50 μg / mL and shake well. Pour the culture medium into a plastic culture dish and wait for it to completely cool and solidify. Pipet 100 μL of the bacterial solution that has been revived for 1 hour and spread it on the plate. Seal the plate, invert it, and culture it at 37°C overnight. Then pick a single white colony from the culture plate and add it to 50 mL of LB liquid culture medium. Shake it at 37°C, 180 rpm, for 24 hours, and sequence it.

[0121] 8 Construction of phylogenetic tree of HcARNT or HcCncC genes in Hyphantria cunea

[0122] The DNA sequence of the HcARNT or HcCncC gene of the American moth obtained by sequencing was searched using the online website (http: / / www.ncbi.nlm.nih.gov / orffinder) NCBI ORF Finder and translated into an amino acid sequence. The cloned ARNT or CncC gene sequence was compared using the online website NCBI Protein BLAST (http: / / www.ncbi.nlm.nih.gov / BLAST), and 15 other insect ARNT gene sequences with high homology and 25 other insect CncC gene sequences were screened out. The phylogenetic tree was constructed using the neighbor-joining method using MEGAX (New Zealand MegaLimited) software with a bootstrap value of 1000.

[0123] 9. Induction of expression of HcARNT or HcCncC gene in Hyphantria cunea by tannic acid

[0124] Healthy 4th instar larvae of the white moth were selected and placed in an insect box, and fed with mulberry leaves soaked with tannic acid (0.01 mg / mL, 0.1 mg / mL). ddH2O was used as the control group, and 3 replicates were set for each group. Rearing conditions: temperature 25±1℃, humidity 55±5%, photoperiod L16:D8. The larvae of the white moth were collected at 12, 24, 48 and 72 hours after treatment and stored in 1.5mL centrifuge tubes and stored in a -80℃ refrigerator for later use.

[0125] 10. Extraction and reverse transcription of total RNA from Hyphantria cunea

[0126] The RNA extraction method of the tannic acid-treated American white moth and its control was the same as the extraction method of the total RNA of the American white moth (step 2 in this Example 1). After the total RNA was extracted, the concentration was measured and the quality was checked by gel electrophoresis, and then stored in a -80°C refrigerator for use.

[0127] The total RNA reverse transcription kit for the American white moth is the Hiscript IIQ RT SuperMix for qPCR (+Gdna wiper) kit from Vazyme. The specific steps are as follows:

[0128] (1) First step reaction:

[0129] 4×gDNA wiper Mix 4μL,

[0130] Template RNA 500ng,

[0131] RNase-free ddH2O to 16μL,

[0132] Program: 42°C, 2 min.

[0133] (2) Based on the first step reaction

[0134] 5×HiScriptll qRT SuperMix II 4μL was added,

[0135] Program: 50℃15min, 85℃5sec.

[0136] After the procedure was completed, the reaction solution was taken out and stored in a -20°C refrigerator.

[0137] 11 Real-time fluorescence quantitative PCR detection

[0138] RPS16 and RPL13 were used as internal reference genes, and the primer sequences are shown in Table 10:

[0139] Table 10 Primer sequences for RT-qPCR

[0140]

[0141] The RT-qPCR reaction system is shown in Table 11:

[0142] Table 11 RT-qPCR reaction system

[0143]

[0144]

[0145] The fluorescence quantitative PCR program was set as follows: 95°C for 1 min; [95°C for 10 s, 60°C for 30 s] for 40 cycles; 95°C for 15 s, 60°C for 1 min, 95°C for 30 s.

[0146] The experiment was repeated 3 times. -ΔΔCt To calculate the relative expression level of HcARNT or HcCncC gene in the gypsy moth treated with tannic acid.

[0147] The experimental data were analyzed using GraphPad Instat 3.0 (GraphPadsoftware, USA). Two-tail P value test in unpaired t-test was used for comparison of two samples, and Turkey test in one-way ANOVA was used for analysis and comparison of three or more samples. P < 0.05 was considered statistically significant.

[0148] The results showed that the full-length cDNA sequence of HcARNT of the cunea was cloned, with an open reading frame of 2064 bp, encoding 687 amino acids. The full-length cDNA sequence of HcC ncC of the cunea was cloned, with an open reading frame of 3177 bp, encoding 1058 amino acids.

[0149] The cloned full-length sequences of HcARNT or HcCncC of Hyphanthus cunea were compared with those of other insects to construct a phylogenetic tree. Phylogenetic analysis showed that ARNT or CncC of different species could be divided into five orders, and HcARNT or HcCncC could be clearly classified into Lepidoptera, indicating that HcARNT or HcCncC had a high consistency with ARNT of other Lepidoptera insects (e.g. Figure 1 , Figure 2 As shown, the ARNT or CncC gene name is represented by the Latin initials of the species and ARNT or CncC, and HcARNT or HcCncC is marked in red bold. ARNT or CncC of Lepidoptera, Coleoptera, Hymenoptera, Diptera, and Hemiptera are marked with different background colors, and the branch color represents the bootstrap value).

[0150] When 4th instar larvae of the gypsy moth were fed with leaves soaked in 0.01 mg / mL tannic acid, the relative expression level of the HcARNT gene was the highest after 48 hours, which was 1.78 times that of the control group; the relative expression level of the HcCncC gene was the highest after 12 hours, which was 1.76 times that of the control group.

[0151] When 0.1 mg / mL tannic acid was used to soak leaves and feed the 4th instar larvae of the American moth, the relative expression levels of the HcARNT gene were upregulated after 12 and 24 hours, which were 2.11 and 2.87 times of the control group, respectively; the relative expression levels of the HcCncC gene were upregulated after 12, 24 and 48 hours, which were 1.66, 2.10 and 2.01 times of the control group, respectively [e.g. Figure 3 , Figure 4 The values ​​are shown as the mean ± SD of 3 replicate samples. The same letters on the error bars indicate no significant difference in expression (P>0.05). Example 2 Functions of HcARNT and HcCncC in Adapting to Tannic Acid Stress in the Hyphantria cunea 1 Preparation of dsHcARNT and dsHcCncC

[0152] 1.1 Extraction of HcARNT and HcCncC gene plasmids

[0153] The operation process is as follows:

[0154] (1) 4 mL of LB liquid culture medium was added with the corresponding antibiotics, and the bacterial solution containing the HcARNT or HcCncC gene and L4440 was added thereto, and the culture was shaken at 37°C and 180 rpm for 12-16 hours.

[0155] (2) Take 2 mL of the shaken bacterial solution, centrifuge at 12,000 rpm for 2 min, and discard the supernatant.

[0156] (3) Add 200 μL Buffer S1 and vortex.

[0157] (4) Add 200 μL of Buffer S2 and invert until the bacteria are lysed.

[0158] (5) Add 200 μL of Buffer S3, invert and mix until flocculent precipitation appears, and centrifuge at 12,000 rpm for 15 min.

[0159] (6) Add 250 μL Buffer BL and centrifuge at 12,000 rpm for 1 min to activate the silica membrane.

[0160] (7) Transfer the supernatant from (5) to the activated adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid.

[0161] (8) Add 700uL Buffer W2, centrifuge at 12000rpm for 1min, and discard the waste liquid.

[0162] (9) Repeat (8).

[0163] (10) Place the adsorption column back into the empty recovery tube and centrifuge at 12,000 rpm for 2 min.

[0164] (11) Place the adsorption column in a new 1.5 mL centrifuge tube and let it stand at room temperature for 2 min. Add 35 μL of 65 °C preheated ddH2O to the middle of the adsorption film and let it stand at room temperature for 5 min. Centrifuge at 12,000 rpm for 2 min.

[0165] (12) After checking the plasmid concentration, store it in a -80℃ refrigerator.

[0166] 1.2 dsRNA primer design

[0167] The possible RNA interference sites of the HcARNT or HcCncC gene sequence of the American moth were predicted using an online website (http: / / sidirect2.rnai.jp / ), and a pair of specific amplification primers containing restriction sites (in bold) were designed using an online website (https: / / www.ncbi.nlm.nih.gov / tools / primerblast / index.cgi?LINK_LOC=Blast%20Home). The primer sequences are as follows:

[0168] Table 12 Synthesized dsRNA primer sequences

[0169]

[0170] 1. Construction of 3dsRNA expression vector

[0171] The full-length plasmid of the HcARNT or HcCncC gene of the American termite was used as a template, and the primers in Table 12 were used. After the amplification product was successfully sequenced, the plasmid containing the HcARNT or HcCncC RNA interference fragment was extracted, and the plasmid and the vector L4440 plasmid were double-digested with restriction endonucleases NotI and Hind III, respectively. The plasmid containing green fluorescent protein (GFP) (as a control group) and the vector L4440 plasmid were double-digested with restriction endonucleases SacI and Hind III. The reaction system is shown in the following table:

[0172] Table 13 Double enzyme digestion reaction system

[0173]

[0174]

[0175] The double enzyme digestion system was incubated at 37°C for 4 hours, and the target fragment was recovered after detection by 1% agarose gel electrophoresis. T4 DNA ligase was used to connect the HcARNT or HcCncC gene RNAi fragment and GFP fragment to the vector L4440 overnight at 16°C, and the connection products were detected by 1% gel electrophoresis and sequencing to identify the correctness of the recombinant plasmid. The recombinant plasmid was transformed into Escherichia coli HT115, and after overnight culture at 37°C, the bacterial solution was stored at -80°C with glycerol in a ratio of 1:1.

[0176] 1.4 Expression and purification of dsHcARNT or dsHcCncC

[0177] Add HT115 bacterial solution (5 μl) to sterile LB culture medium (50 mL) containing double antibodies (AMP + tetracycline), and culture at 37°C 200 rpm for 12 h. Then add the culture medium back to sterile LB culture medium (50 mL) containing double antibodies (AMP + tetracycline), and culture at 37°C 200 rpm for 3-4 h until OD 600 When the pH is 0.4-0.6, add IPTG to make the final concentration 0.8 mM, and continue to culture at 37°C and 200 rpm for more than 4 hours to allow the dsRNA to be expressed in large quantities in the bacterial solution.

[0178] 1.5 Extraction of dsHcARNT or dsHcCncC

[0179] (1) Centrifuge the bacterial solution containing dsRNA at 8000g for 2 min at 4°C and discard the supernatant;

[0180] (2) To 1×10 5 ~2×107 Add 1 mL of RNAex to the cells;

[0181] (3) Pipette the liquid until it is clear and free of precipitation;

[0182] (4) Leave at room temperature for 5 minutes;

[0183] The remaining steps are the same as 2 (extraction of total RNA from the cunea gypsophila) in Example 1.

[0184] 1.6 RNA interference efficiency of dsHcARNT or dsHcCncC

[0185] Select the 4th instar larvae with the same development and inject dsRNA. The injection site is the intersegmental membrane of the second last segment of the abdomen of the nymph larva. Each larva was injected with 2.0 μg dsHcARNT or dsHcCncC, and the same amount of dsGFP and ddH2O were injected as controls. The injected larvae were placed in an insect box with fresh mulberry leaves, which were replaced every 24 hours. Ten nymphs were placed in each group, and each treatment group had 3 replicates. Samples were collected at 24, 48, 72, and 96 hours, respectively, and stored in a -80℃ ultra-low temperature refrigerator for later use. RT-qPCR was used to detect the interference efficiency of dsHcARNT or dsHcCncC.

[0186] 1.7 Real-time fluorescence quantitative PCR detection interference efficiency

[0187] RPS16 and RPL13 were used as internal reference genes, and the primers are shown in the following table:

[0188] Table 14 Primer sequences used for RT-qPCR

[0189]

[0190] The fluorescence quantitative PCR reaction system is shown in the table below:

[0191] Table 15 RT-qPCR reaction system

[0192]

[0193] The fluorescence quantitative PCR program was set as follows: 95°C for 1 min; [95°C for 10 s, 60°C for 30 s] for 40 cycles; 95°C for 15 s, 60°C for 1 min, 95°C for 30 s.

[0194] The experiment was repeated three times. -ΔΔCtThe relative expression of genes was calculated by the method. GraphPad Instat 3.0 was used to analyze the experimental data. Two samples were compared by the two-tail P value test in the unpaired t-test. For three or more samples, the Turkey test in the one-way ANOVA was used for analysis and comparison. P < 0.05 was considered statistically significant.

[0195] The results showed that after the injection of dsHcARNT into the nymph, the relative expression levels of HcARNT at 24, 48 and 72 hours were significantly lower than those in the control group (ddH2O group and dsGFP group). The relative expression level was the lowest at 48 hours after dsHcARNT treatment, which decreased by 55.4% [ Figure 5 , where the values ​​are the mean ± SD of 3 replicate samples. The same letters on the error bars indicate no significant difference in expression (P>0.05)].

[0196] After the injection of dsHcCncC into the nymph, the relative expression levels of HcCncC at 24, 48 and 72 hours were significantly lower than those in the control group (ddH2O group and dsGFP group). The relative expression level of HcCncC at 24 hours after dsHcCncC treatment was the lowest, decreasing by 66.6% [ Figure 6 , where the values ​​are the mean ± SD of 3 replicate samples. The same letters on the error bars indicate no significant difference in expression (P>0.05)].

[0197] 1.8 Effects of dsHcARNT or dsHcCncC treatment on tannic acid toxicity in Hyphantria cunea

[0198] 48h after the 4th instar larvae of the gypsy moth were injected with dsHcARNT, dsGFP and ddH2O, they were fed with mulberry leaves treated with tannic acid (1 mg / mL) and mulberry leaves treated with buffer solution as the control group, and the mortality rate was counted, and each treatment was repeated three times. 24h after the 4th instar larvae of the gypsy moth were injected with dsHcCncC, dsGFP and ddH2O, they were fed with mulberry leaves treated with tannic acid (1 mg / mL) and mulberry leaves treated with buffer solution as the control group, and the mortality rate was counted, and each treatment was repeated three times.

[0199] GraphPad Instat 3.0 was used to analyze the experimental data. Two-tail P value test in unpairedt-test was used for comparison of two samples. Turkey test in one-way ANOVA was used for analysis and comparison of three or more samples. P < 0.05 was considered statistically significant. For RNAi bioassay, LOG-RANK (Mantel-Cox) test (GraphPadPrism 8.0.2, GraphPadSoftware, SanDiego, CA, USA) was used for statistical analysis. The results showed:

[0200] After 48 hours of injection of dsHcARNT into the gypsy moth, the leaves were replaced with tannic acid-soaked mulberry leaves. The results showed that the survival rate of the gypsy moth after RNAi was significantly lower than that without RNAi ( Figure 7 BE), at 72, 120 and 144h, the mortality rate of the dsHcARNT group treated with tannic acid was 30%, 52.5% and 57.5%, respectively, which were significantly higher than those of the other groups. The survival curve showed that the survival rate of the dsHcARNT group treated with tannic acid was significantly lower than that of the control group (CK group and GFP group) ( Figure 7 F).

[0201] After 24 hours of injection of dsHcCncC into the gypsy moth, the leaves were replaced with tannic acid-soaked mulberry leaves. The results showed that the survival rate of the gypsy moth after RNAi was significantly lower than that without RNAi ( Figure 8 BD), at 72, 96 and 120h, the mortality rate of the dsHcCncC group treated with tannic acid was 40%, 46% and 66%, respectively, which were significantly higher than those of the other groups. It can be clearly seen from the survival curve that the survival rate of the dsHcCncC group treated with tannic acid was significantly lower than that of the control group (CK group and GFP group) ( Figure 8 E).

Claims

1. dsRNA of HcARNT and HcCncC genes of the nymphalidae, characterized in that: The full-length cDNAs of the HcARNT and HcCncC genes are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively, and encode proteins with amino acid sequences shown as SEQ ID No. 3 and SEQ ID No. 4, respectively.

2. The dsRNA according to claim 1, characterized in that The primer sequences for synthesizing the dsRNA of the HcARNT gene of the gypsy moth are the upstream primer (5'-3') CTAGCTAGCTTCCCACTATACTACAGAGAGTTACG, and the downstream primer (5'-3') CCGCTCGAGATTCAGCATATTGTTAACTGAGGC. The primer sequences for synthesizing the dsRNA of the HcCncC gene of the gypsy moth are the upstream primer (5'-3') CTAGCTAGCGTGATATGGATCTGTCTAGCGAC; and the downstream primer (5'-3') CCGCTCGAGTCCTCACTGCTCACCAGCTC.

3. Use of the dsRNA according to claims 1-2 in controlling the gypsy moth.

4. The use according to claim 3, characterized in that The dsRNA of the HcARNT gene of the cuneiform moth or the dsRNA of the HcCncC gene of the cuneiform moth is used to treat the cuneiform moth to achieve control of the cuneiform moth.

5. The use according to claim 4, characterized in that The dsRNA of the HcARNT gene of the gypsy moth or the dsRNA of the HcCncC gene of the gypsy moth is combined with a botanical insecticide to jointly control the gypsy moth.

6. The use according to claim 5, characterized in that The gypsy moth is first treated with dsRNA of the HcARNT gene of the gypsy moth or dsRNA of the HcCncC gene of the gypsy moth, and then treated with a botanical insecticide.

7. The use according to claim 6, characterized in that The gypsy moths were first treated with 2.0 μg of dsRNA of the HcARNT gene of the gypsy moth for 48 hours or dsRNA of the HcCncC gene of the gypsy moth for 24 hours, and then treated with 1 mg / mL of tannic acid.

8. A method for controlling the gypsy moth, characterized in that: The gypsy moth is first treated with a solution containing the dsRNA of the HcARNT or HcCncC gene according to any one of claims 1 to 7, and then treated with a botanical insecticide solution.

9. The method according to claim 8, characterized in that The time for treating the gypsy moth with the HcARNT gene dsRNA solution is 48 hours; the time for treating the gypsy moth with the HcCncC gene dsRNA solution is 24 hours.

10. The method according to any one of claims 8-9, characterized in that: The botanical pesticide solution is a tannic acid solution.

Images