An antisense nucleic acid targeting the KRAS gene and pharmaceutical preparations and uses thereof

By specifically modifying antisense nucleic acids and combining them with nucleoside and cationic lipids, a drug formulation is formed that targets the KRAS gene, solving the safety and efficacy issues of antisense nucleic acid drugs in KRAS gene therapy in existing technologies, and achieving effective inhibition of KRAS-mutant tumors.

CN119639745BActive Publication Date: 2025-11-25ZHINENG (BEIJING) BIOTECHNOLOGY CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411827647.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-12
Publication Date
2025-11-25
Estimated Expiration
2044-12-12

AI Technical Summary

Technical Problem

Existing antisense nucleic acid drugs have safety and in vivo efficacy issues in targeting the KRAS gene, especially the toxicity caused by high-dose naked administration, which has not been effectively resolved, making it difficult to achieve effective tumor treatment.

Method used

An antisense nucleic acid targeting the KRAS gene was designed. The drug formulation was prepared by modifying the nucleotide sequence with 2'-O-methyl, 2'-O-methoxyethyl, 5-methylcytosine, and phosphate thiocyanate, and then combining it with nucleoside DNCA and cationic DLD in an optimized ratio of 1:10–30:10–30. Surfactants such as DSPE-PEG2000 or DSPE-PEG2000-cRGD were added. The preparation method included ultrasonic mixing in anhydrous ethanol to form a drug formulation targeting the KRAS gene.

Benefits of technology

It achieved targeted delivery and significant inhibition of antisense nucleic acids in KRAS-mutant tumors, demonstrating a silencing effect on the KRAS gene, especially with the potential for effective treatment of KRAS-mutant tumors such as pancreatic cancer, colon cancer, endometrial cancer, and lung cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119639745B_ABST
    Figure CN119639745B_ABST
Patent Text Reader

Abstract

The application provides an antisense nucleic acid targeting a KRAS gene, a pharmaceutical preparation thereof and an application thereof, and belongs to the technical field of biological medicines.The nucleotide sequence of the antisense nucleic acid comprises at least one of SEQ ID NO:1 to SEQ ID NO:7; the nucleotide sequence of the antisense nucleic acid further comprises a modified nucleotide sequence of SEQ ID NO:1 and a modified nucleotide sequence of SEQ ID NO:8.The antisense nucleic acid can target the 3'-UTR region of mRNA of KRAS, down-regulate the corresponding mRNA and various mutants thereof, inhibit tumor cell growth, the pharmaceutical preparation thereof can deliver the target antisense nucleic acid to a tumor site and exert a significant inhibitory effect, and has great application potential in the field of tumor gene therapy of KRAS mutation.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to an antisense nucleic acid targeting KRAS gene and a pharmaceutical preparation and application thereof. BACKGROUND

[0002] Gene therapy, i.e. treatment of diseases through nucleic acid drugs, has attracted attention in recent years. Nucleic acid drugs mainly include double-stranded small interfering RNA (siRNA), antisense oligonucleotides (ASOs), CRISPR / Cas9 single-stranded RNA and mRNA, aptamers, etc. Antisense nucleic acid is generally an oligodeoxynucleotide of 13-30 nt, which can degrade target mRNA molecules through RNase mechanism and the like. It can be synthesized by chemical synthesis, and has great development prospects.

[0003] About 25% of human tumors have RAS mutations, among which KRAS mutations are the main mutation type. However, due to the high GTP binding activity of the GTP binding pocket of the KRAS protein, it is difficult to develop specific inhibitors based on the pocket, and in addition, the surface of the KRAS protein lacks other binding pockets, so the KRAS protein is also called an "undruggable" target.

[0004] AZD4785 is an antisense nucleic acid developed by AstraZeneca targeting KRAS mRNA 3'-UTR, which adopts a Gapmer modification strategy combining a PS backbone with 3 2', 4'-bridged ethyl (cEt) at each end, and reduces the immunogenicity of nucleic acids through 5mC modification. Thanks to the high chemical stability of cEt gapmer and the lipophilicity of PS, AZD4785 can be administered in vivo and in vitro without using a delivery carrier. However, in clinical phase 1 (NCT03101839), multiple adverse reactions related to intravenous injection of antisense nucleic acids occurred. Due to safety and in vivo efficacy problems, the research and development of AZD4785 has been suspended.

[0005] The toxicity problem caused by high-dose naked nucleic acid administration has not been solved, and how to achieve in vivo tumor treatment of antisense nucleic acids is a technical problem to be solved in the art. SUMMARY

[0006] In view of this, the purpose of the present application is to provide an antisense nucleic acid targeting KRAS gene, which has the effect of targeting KRAS gene.

[0007] Another purpose of the present application is to provide an antisense nucleic acid drug preparation targeting KRAS gene, which can silence KRAS gene and has a significant inhibitory effect on tumor cells.

[0008] To achieve the above-mentioned object, the present application provides the following technical solutions.

[0009] The present application provides an antisense nucleic acid targeting KRAS gene, wherein the nucleotide sequence of the antisense nucleic acid comprises at least one of SEQ ID NO: 1-7; the nucleotide sequence of the antisense nucleic acid further comprises a modified nucleotide sequence of SEQ ID NO: 1 and a modified nucleotide sequence of SEQ ID NO: 8; the modification comprises one or more of 2'-O-methyl modification, 2'-O-methoxyethyl modification, 5-methylcytosine modification and phosphorothioate modification.

[0010] The present application also provides an antisense nucleic acid drug preparation targeting KRAS gene, wherein the antisense nucleic acid drug preparation comprises the antisense nucleic acid, a nucleolipid material DNCA and a cationic lipid material CLD.

[0011] Preferably, the mass ratio of the antisense nucleic acid, the nucleolipid material DNCA and the cationic lipid material CLD is 1:10-30:10-30.

[0012] Preferably, the antisense nucleic acid drug preparation further comprises a surfactant.

[0013] More preferably, the surfactant comprises DSPE-PEG 2000 or DSPE-PEG 2000 -cRGD.

[0014] The present application also provides a preparation method of the antisense nucleic acid drug preparation, comprising the following steps: dissolving the nucleolipid material DNCA and the cationic lipid material CLD in anhydrous ethanol to obtain a nucleolipid material DNCA anhydrous ethanol mother liquor and a cationic lipid material CLD anhydrous ethanol mother liquor for standby, dissolving the antisense nucleic acid in enzyme-free water to obtain an antisense nucleic acid mother liquor for standby; adding the nucleolipid material DNCA anhydrous ethanol mother liquor and the cationic lipid material CLD anhydrous ethanol mother liquor into the antisense nucleic acid mother liquor, and placing in 40-60℃ water for ultrasonic treatment for 15-30 min.

[0015] Preferably, the concentration of the antisense nucleic acid mother liquor is 10 μM-10 mM.

[0016] The present application provides an application of the antisense nucleic acid or the antisense nucleic acid drug preparation in the preparation of a drug targeting KRAS gene.

[0017] The present application provides an application of the antisense nucleic acid or the antisense nucleic acid drug preparation in the preparation of a drug for preventing and / or treating tumors.

[0018] Preferably, the tumor is pancreatic cancer, colon cancer, endometrial cancer or lung cancer caused by KRAS gene mutation.

[0019] Compared with the prior art, the present application has the following beneficial effects:

[0020] The present application provides a group of antisense nucleic acids which can target the 3'-UTR region of the mRNA of KRAS and down-regulate the corresponding mRNA and its various mutants, inhibit tumor cell growth, and its pharmaceutical preparation can deliver the target antisense nucleic acid to the tumor site and play a significant inhibitory effect. It has great application potential in the field of KRAS mutant tumor gene therapy. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 DNCA / CLD encapsulated series of antisense nucleic acids in vitro proliferation inhibition activity;

[0022] Figure 2 KRAS gene silencing efficiency of DNCA / CLD encapsulated series of antisense nucleic acids;

[0023] Figure 3 Tumor growth curve of blank group, M4, D / C, D / C / M4 / 0.7%PEG, D / C / M4 / 1%cRGD mice in the axillary;

[0024] Figure 4 KRAS mRNA silencing in tumor site of blank group, M4, D / C, D / C / M4 / 0.7%PEG, D / C / M4 / 1%cRGD; G12D

[0025] Figure 5 Tumor image of blank group, M4, D / C, D / C / M4 / 0.7%PEG, D / C / M4 / 1%cRGD;

[0026] Figure 6 Tumor weight statistics of blank group, M4, D / C, D / C / M4 / 0.7%PEG, D / C / M4 / 1%cRGD;

[0027] Figure 7 Immunohistochemical section of blank group, M4, D / C, D / C / M4 / 0.7%PEG, D / C / M4 / 1%cRGD group. DETAILED DESCRIPTION

[0028] ​The application provides an antisense nucleic acid targeting a KRAS gene, a nucleotide sequence of the antisense nucleic acid comprising at least one of SEQ ID NO:1-7; the nucleotide sequence of the antisense nucleic acid further comprises a modified nucleotide sequence of SEQ ID NO:1 and a modified nucleotide sequence of SEQ ID NO:8; the modification comprises one or more of 2'-O-methyl modification (2'-OMe), 2'-O-methoxyethyl modification (2'-O-MOE), 5-methylcytosine modification (5'-MeC) and phosphorothioate modification. The specific information of the nucleotide sequence of the antisense nucleic acid is shown in Table 1, wherein the nucleotide sequences of the antisense nucleic acids with names O, S, M1, M2, M3, M4, M5, O1, O2, O3, O4 and O5 are modified based on the sequence GCTATTAGGAGTCTTT (SEQ ID NO:8); the nucleotide sequences of the antisense nucleic acids with names K1-4 are modified based on the sequence ACTGGGTCTGCCTTAA (SEQ ID NO:1). The nucleotide sequence of the sequence O is GmCTATTAGGAGTmCTTT, the fifth carbon element of the cytosine "C" at the 2nd and 13th positions in the sequence is methylated to form 5-methylcytosine; the nucleotide sequence of the sequence S is GsmCsTsAsTsTsAsGsGsAsGsTsmCsTsTsT, all the phosphates in the sequence are phosphorothioate modified, and the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine; the nucleotide sequence of the sequence M1 is G moe smCsTsAsTsTsAsGsGs AsGsTsmCsTsTsT moe , all the phosphates in the sequence are phosphorothioate modified, the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of the guanine "G" at the 1st position and the thymine "T" at the 16th position is replaced by methoxyethyl; the nucleotide sequence of the sequence M2 is G moe smC moe sTs AsTsTs AsGsGs AsGsTsmCsTsT moe sT moe , all the phosphates in the sequence are phosphorothioate modified, the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, and the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd position and the thymine "T" at the 15th and 16th positions is replaced by methoxyethyl; the nucleotide sequence of the sequence M3 is G moe smC moe sT moes AsTsTs AsGsGs AsGsTsmCsT moe sT moe sT moe , all phosphates of the sequence are all thio-modified, and the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd position, the thymine "T" at the 3rd, 14th, 15th and 16th positions is replaced by methoxyethyl; the nucleotide sequence of sequence M4 is G moe smC moe sT moe s A moe sTsTs AsGsGs AsGsTs mC moe sT moe sT moe sT moe , all phosphates of the sequence are all thio-modified, and the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd and 13th positions, the adenine "A" at the 4th position, the thymine "T" at the 3rd, 14th, 15th and 16th positions is replaced by methoxyethyl; the nucleotide sequence of sequence M5 is G moe smC moe sT moe sA moe sT moe sTs AsGsGs AsGsT moe s mC moe sT moe sT moe sT moe , all phosphates of the sequence are all thio-modified, and the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd and 13th positions, the adenine "A" at the 4th position, the thymine "T" at the 3rd, 5th, 12th, 14th, 15th and 16th positions is replaced by methoxyethyl; the nucleotide sequence of sequence O1 is G ome smCsTsAsTsTsAsGsGsAsGsTsmCsTsTsT ome , all phosphates of the sequence are all thio-modified, and the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the thymine "T" at the 16th position is replaced by methyl; the nucleotide sequence of sequence O2 is G ome smC omesTs AsTsTs AsGsGs AsGsTs mCsTsT ome sT ome , all phosphates of the sequence are thio-modified, and the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd position, the thymine "T" at the 15th and 16th positions is replaced with methyl; the nucleotide sequence of sequence O4 is G ome smC ome sT ome s AsTsTsAsGsGs AsGsTs mCsT ome sT ome sT ome , all phosphates of the sequence are thio-modified, and the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd position, the thymine "T" at the 3rd, 14th, 15th and 16th positions is replaced with methyl; the nucleotide sequence of sequence O4 is G ome smC ome sT ome s A ome sTsTs AsGsGs AsGsTs mC ome sT ome sT ome sT ome , all phosphates of the sequence are thio-modified, and the fifth carbon element of the cytosine "C" at the 2nd and 13th positions is methylated to form 5-methylcytosine, the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd and 13th positions, the adenine "A" at the 4th position, the thymine "T" at the 3rd, 14th, 15th and 16th positions is replaced with methyl; the nucleotide sequence of sequence O5 is G ome smC ome sT ome sA ome sT moe sTs AsGsGs AsGsT moe s mC moe sT moe sT moe sT moe, all phosphates of the sequence are thio-modified, and the fifth carbon element of the cytosine "C" at the 2nd position is methylated to form 5-methylcytosine, the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd and 13th positions, the adenine "A" at the 4th position, the thymine "T" at the 3rd, 5th, 12th, 14th, 15th and 16th positions is replaced with a methyl group; the nucleotide sequence of the sequence K1-4 is A moe smC moe sT moe s G moe sGsGsTsCsTs GsCsCs T moe sT moe sA moe sA moe , all phosphates of the sequence are thio-modified, and the fifth carbon element of the cytosine "C" at the 2nd position is methylated to form 5-methylcytosine, the hydrogen on the 2'-OH of the guanine "G" at the 1st position, the cytosine "C" at the 2nd and 13th positions, the adenine "A" at the 4th position, the thymine "T" at the 3rd, 5th, 12th, 14th, 15th and 16th positions is replaced with a methyl group; the nucleotide sequence of the sequence K1-4 is A

[0029] The present application also provides an antisense nucleic acid drug preparation targeting KRAS gene, which comprises the antisense nucleic acid, the nucleolipid material DNCA, and the cationic lipid material CLD.

[0030] The structure information of the nucleolipid material DNCA and the cationic lipid material CLD can be found in "Mol Pharm, 2014, 11(12): 4415-4424", "New J Chem, 2014, 38, 4952-4962", and "Biomaterials, 2018, 178: 147-157".

[0031] In the present application, the mass ratio of the antisense nucleic acid, the nucleolipid material DNCA, and the cationic lipid material CLD is preferably 1:10-30:10-30, and more preferably 1:20:20.

[0032] In the present application, the antisense nucleic acid drug preparation further comprises a surfactant. In the present application, the surfactant more preferably comprises DSPE-PEG 2000 or DSPE-PEG 2000-cRGD, which can be purchased from a conventional commercial product. In the present application, when a surfactant is included in the antisense nucleic acid pharmaceutical preparation, the mass ratio of the antisense nucleic acid, the nucleolipid material DNCA, the cationic lipid material CLD and the surfactant is 1:0.1-0.5:10-30:10-30, more preferably 1:0.2-0.4:20:20, and further preferably 1:0.28:20:20 or 1:0.4:20:20.

[0033] The present application also provides a preparation method of the antisense nucleic acid pharmaceutical preparation, comprising the following steps: dissolving the nucleolipid material DNCA and the cationic lipid material CLD in anhydrous ethanol to obtain nucleolipid material DNCA anhydrous ethanol mother liquor and cationic lipid material CLD anhydrous ethanol mother liquor for standby, dissolving the antisense nucleic acid in enzyme-free water to obtain antisense nucleic acid mother liquor for standby; adding the nucleolipid material DNCA anhydrous ethanol mother liquor and the cationic lipid material CLD anhydrous ethanol mother liquor into the antisense nucleic acid mother liquor, and placing in 40-60℃ water for ultrasonic treatment for 15-30 min. In the present application, the ultrasonic treatment condition is preferably placing in 50℃ water for ultrasonic treatment for 20 min. In the present application, the concentration of the nucleolipid material DNCA anhydrous ethanol mother liquor is preferably 5mM-15mM, more preferably 10mM or 8-12mM; the concentration of the cationic lipid material CLD anhydrous ethanol mother liquor is preferably 5mM-15mM, more preferably 10mM or 8-12mM; and the antisense nucleic acid mother liquor is preferably 10μM-10mM, more preferably 50μM or 2mM. In the present application, the nucleolipid material DNCA and the cationic lipid material CLD can be synthesized by a conventional method by those skilled in the art.

[0034] In the present application, the preparation method of the antisense nucleic acid pharmaceutical preparation is more preferably as follows: dissolving the nucleolipid material DNCA and the cationic lipid material CLD in anhydrous ethanol to obtain nucleolipid material DNCA anhydrous ethanol mother liquor and cationic lipid material CLD anhydrous ethanol mother liquor for standby, dissolving the antisense nucleic acid in enzyme-free water to obtain antisense nucleic acid mother liquor for standby; adding a certain volume of antisense nucleic acid mother liquor to the bottom of an EP tube, then adding half volume of GenOpti, and then adding the nucleolipid material DNCA anhydrous ethanol mother liquor and the cationic lipid material CLD anhydrous ethanol mother liquor, and adding GenOpti to make up the system, tightly covering the EP tube, and placing in 50℃ water for ultrasonic treatment for 20 min. In the present application, the GenOpti is a cell transfection optimization solution well known in the art, which can be purchased by a conventional channel.

[0035] The present application provides an application of the antisense nucleic acid or the antisense nucleic acid pharmaceutical preparation in preparing a KRAS gene-targeted drug.

[0036] The application provides application of the antisense nucleic acid or the antisense nucleic acid pharmaceutical preparation in preparation of a drug for preventing and / or treating tumors.

[0037] The technical solutions provided by the application are described in detail below in combination with examples, but they should not be understood as limitations to the protection scope of the application.

[0038] In the following examples, the experimental methods are all conventional methods unless otherwise specified. In the following examples, the test materials used are all commercially available products unless otherwise specified.

[0039] Example 1

[0040] A group of antisense nucleic acids targeting KRAS genes, the specific sequences of the antisense nucleic acids are shown in Table 1:

[0041] Table 1: Modified sequences of antisense nucleic acids

[0042]

[0043]

[0044] Example 2

[0045] A group of antisense nucleic acid pharmaceutical preparations targeting KRAS genes, the antisense nucleic acid pharmaceutical preparations comprise the antisense nucleic acid in Example 1, the nucleoside lipid material DNCA and the cationic lipid material CLD; the mass ratio of the antisense nucleic acid, the nucleoside lipid material DNCA and the cationic lipid material CLD is 1:20:20.

[0046] The preparation method of the antisense nucleic acid pharmaceutical preparation is as follows: the antisense nucleic acid dry powder in Example 1 is dissolved with enzyme-free water to obtain an antisense nucleic acid mother liquor for standby, the nucleoside lipid material DNCA and the cationic lipid material CLD are respectively dissolved in anhydrous ethanol to obtain a 10 mM nucleoside lipid material DNCA anhydrous ethanol mother liquor and a 10 mM cationic lipid material CLD anhydrous ethanol mother liquor for standby; a certain volume of antisense nucleic acid mother liquor is first added to the bottom of an EP tube, half the volume of GenOpti is then added, and then the nucleoside lipid material DNCA anhydrous ethanol mother liquor and the cationic lipid material CLD anhydrous ethanol mother liquor are added, and GenOpti is added to make up the system, the EP tube is tightly covered, and is placed in 50℃ water for ultrasonic treatment for 20 min.

[0047] Example 3

[0048] A group of antisense nucleic acid pharmaceutical preparations targeting KRAS genes, the antisense nucleic acid pharmaceutical preparations comprise the antisense nucleic acid in Example 1, the nucleoside lipid material DNCA, the cationic lipid material CLD and a surfactant; the surfactant is DSPE-PEG 2000; the mass ratio of the antisense nucleic acid, the nucleolipid material DNCA, the cationic lipid material CLD, and the surfactant is 1:20:20:0.28.

[0049] The preparation method of the antisense nucleic acid drug preparation is as follows: the antisense nucleic acid dry powder of Example 1 is dissolved with enzyme-free water to obtain an antisense nucleic acid mother liquor for standby, the nucleolipid material DNCA and the cationic lipid material CLD are respectively dissolved in anhydrous ethanol to obtain 10 mM nucleolipid material DNCA anhydrous ethanol mother liquor and 10 mM cationic lipid material CLD anhydrous ethanol mother liquor for standby; a certain volume of antisense nucleic acid mother liquor is first added to the bottom of an EP tube, half the volume of GenOpti is then added, and the nucleolipid material DNCA anhydrous ethanol mother liquor, the cationic lipid material CLD anhydrous ethanol mother liquor, and the surfactant DSPE-PEG 2000 -cRGD are added, GenOpti is added to make up the system, the EP tube is tightly covered, and ultrasonic treatment is performed in 50℃ water for 20 min.

[0050] Example 4

[0051] A group of antisense nucleic acid drug preparations targeting the KRAS gene, the antisense nucleic acid drug preparation comprising the antisense nucleic acid in Example 1, the nucleolipid material DNCA, the cationic lipid material CLD, and the surfactant; the surfactant is DSPE-PEG 2000 -cRGD; the mass ratio of the antisense nucleic acid, the nucleolipid material DNCA, the cationic lipid material CLD, and the surfactant is 1:20:20:0.4.

[0052] The preparation method of the antisense nucleic acid drug preparation is as follows: the antisense nucleic acid dry powder of Example 1 is dissolved with enzyme-free water to obtain an antisense nucleic acid mother liquor for standby, the nucleolipid material DNCA and the cationic lipid material CLD are respectively dissolved in anhydrous ethanol to obtain 10 mM nucleolipid material DNCA anhydrous ethanol mother liquor and 10 mM cationic lipid material CLD anhydrous ethanol mother liquor for standby; a certain volume of antisense nucleic acid mother liquor is first added to the bottom of an EP tube, half the volume of GenOpti is then added, and the nucleolipid material DNCA anhydrous ethanol mother liquor, the cationic lipid material CLD anhydrous ethanol mother liquor, and the surfactant DSPE-PEG 2000 -cRGD are added, GenOpti is added to make up the system, the EP tube is tightly covered, and ultrasonic treatment is performed in 50℃ water for 20 min.

[0053] Example 5

[0054] This example studies the proliferation inhibition activity of the antisense nucleic acid drug preparation prepared in Example 2 on PANC-1 pancreatic cancer cells. The antisense nucleic acid drug preparation is obtained according to the preparation method of Example 2, and the specific ratio and experimental groups are shown in Table 2.

[0055] Table 2: Ratio relationship and experimental groups of antisense nucleic acid drug preparations

[0056]

[0057]

[0058] Test method: CCK-8 kit was used to test the cytotoxicity of each experimental group and the empty lipid group: A549 cells were plated at 12000 / well in a 96-well plate and incubated in a cell incubator (37℃, 5% CO2) for 24 hours, followed by drug administration (20 μL per well, adherent administration or dropwise administration). 48 hours after drug administration, the culture medium was aspirated, 100 μL of culture medium containing 10% CCK-8 substrate (culture medium was DMEM containing 10% FBS) was added to each well, and incubated at 37℃ in the dark for 0.5 hours. The absorbance at 450 nm was detected using a multifunctional microplate reader (Spark), and the blank culture solution absorbance was corrected. The cell survival rate was calculated according to the following equation:

[0059] Cell survival rate = (R A -R E ) / (R B -R E ) x 100%, where R A , R B and R E represent the absorbance of the experimental group, the group without transfection reagent, and the blank control group, respectively.

[0060] Figure 1 D / C / O, D / C / S, D / C / M1, D / C / M2, D / C / M3, D / C / M4, D / C / M5, D / C / O1, D / C / O2, D / C / O3, D / C / O4, D / C / O5, D / C / K1, D / C / K2, D / C / K3, D / C / K4, D / C / K5, D / C / K6, D / C / K7, D / C / K1-4, D / C group PANC-1 cell proliferation inhibition activity. The nucleic acid administration group was administered at a dose of 100 nM of nucleic acid, and the D / C group was an empty lipid group.

[0061] From Figure 1 it can be seen that K1-4 and other sequences have certain tumor cell proliferation inhibition effect, in addition, the empty lipid group has no significant toxicity, indicating that it is a drug delivery system with high biocompatibility.

[0062] Example 6

[0063] This example studies the antisense nucleic acid drug preparation prepared in Example 2 in PANC-1 pancreatic cancer cells KRAS G12DGene silencing activity, the preparation method of antisense nucleic acid drug preparation according to example 2, specific ratio and experimental group as shown in table 2.

[0064] Test method: PANC-1 cells were plated in 12-well plates (1.2 x 10 5 Each well was given 100 μL of drug (adhesion or dropwise administration), and 24 h after administration, Trizol was added to extract RNA. 500 μL of Trizol was added to each well, and the cells were blown evenly and transferred to a 1.5 mL EP tube. 100 μL of chloroform was added, shaken, and allowed to stand for 3 min. Centrifugation was performed at 13000 rpm for 15 min (4°C), and the supernatant was carefully aspirated. An equal volume of pre-cooled isopropanol was added, shaken, and allowed to stand at 4°C for 15 min. Centrifugation was performed at 13000 rpm for 15 min (4°C), and a small amount of precipitate was visible at the bottom of the tube. The supernatant was discarded, and 800 μL of 70% ethanol was added to blow up the RNA precipitate (without dispersing). Centrifugation was performed at 13000 rpm for 5 min (4°C), and the supernatant was discarded. The RNA was air-dried. The RNA was dissolved in enzyme-free water, and the quantity and quality of the RNA were determined using a Nanodrop. The RNA was diluted to 100 ng / μL (10 μL total) with enzyme-free water, and heated at 70°C for 10 min. The mRNA was reverse transcribed into cDNA using a reverse transcription kit, and gotaq (promega) and primers were added. Real-time fluorescent quantitative PCR was performed using the following program: 30°C for 5 min; 55°C for 15 min; 85°C for 5 min; 40 cycles; and the primer sequences are shown in Table 3:

[0065] Table 3 Primer sequences

[0066] Name Sequence KRAS forward primer GACTGAATATAAACTTGTGGTAGTTGGA (SEQ ID NO: 9) KRAS reverse primer CATATTCGTCCACAAAATGATTCTG (SEQ ID NO: 10) 18S forward primer GTAACCCGTTGAACCCCATT (SEQ ID NO: 11) 18S reverse primer CCATCCAATCGGTAGTAGCG (SEQ ID NO: 12)

[0067] Figure 2 D / C / O, D / C / S, D / C / M1, D / C / M2, D / C / M3, D / C / M4, D / C / M5, D / C / O1, D / C / O2, D / C / O3, D / C / O4, D / C / O5, D / C / K1, D / C / K2, D / C / K3, D / C / K4, D / C / K5, D / C / K6, D / C / K7, D / C / K1-4, D / C group silencing KRAS G12D Gene situation. The dosages of each nucleic acid administration group were 50 nM of antisense nucleic acid, and the D / C group was a blank lipid material group.

[0068] From Figure 2 It can be seen that after D / C loading, whether M4 or K1-4, both showed good KRAS G12D gene silencing activity.

[0069] Example 7

[0070] This embodiment further verifies the in vivo efficacy of the D / C encapsulated antisense nucleic acid M4. The antisense nucleic acid drug preparation M4 is obtained according to the preparation method of Embodiment 2-Embodiment 4, and the specific ratio and experimental groups are shown in Table 4:

[0071] Table 4: Ratio and experimental groups of antisense nucleic acid drug preparation M4

[0072] Name Ratio of the amount of substance Empty lipid group (D / C) DNCA / CLD = 20:20 M4 group M4 + GeneOpti buffer solution corresponding to the dose, without addition of lipids Experimental group 6 (D / C / M4) DNCA / CLD / M4 = 20:20:1 Experimental group 21 (D / C / M4 / 0.7% PEG) DNCA / CLD / M4 / DSPE-PEG 2000 = 20:20:1:0.28 Experimental group 22 (D / C / M4 / 1% cRGD) DNCA / CLD / M4 / DSPE-PEG 2000 -cRGD = 20:20:1:0.4

[0073] Test method:

[0074] Select 4-6 week old female BALB / c-nude mice, inoculate PANC-1 cells 3×10 6 / each in the armpit, and when the tumor volume (volume = length × width 2 × 0.5) grows to about 50mm 3 , randomly divide the tumor-bearing mice into groups (5 mice per group). After grouping, measure the tumor as day 0, and then perform the first administration (preparation containing M4) with a concentration of 2mpk, 100 μL per mouse, tail vein injection, and administer on days 1, 4, 7, 10, 14 and 18, a total of 6 times. Measure the tumor and weigh every two days, record the tumor volume and mouse weight. On day 22, after measuring the tumor and weighing, take blood and sacrifice the mice, dissect out the tumor, liver and kidney. After weighing and taking pictures, divide the tumor into two parts, one part is fixed with 4% paraformaldehyde, and stained with KRAS antibody; the other part is added with Trizol and ground, extract RNA, and investigate KRAS G12D mRNA level by RT-qPCR experiment; wherein the M4 group is M4+GeneOpti buffer solution corresponding to the dose, without adding fat material.

[0075] Figure 3 Tumor growth curve in the blank group, M4, D / C, D / C / M4 / 0.7% PEG, D / C / M4 / 1%cRGD mice; Figure 4 Tumor site KRAS mRNA silencing in the blank group, M4, D / C, D / C / M4 / 0.7% PEG, D / C / M4 / 1%cRGD; G12D Figure 5 Tumor image in the blank group, M4, D / C, D / C / M4 / 0.7% PEG, D / C / M4 / 1%cRGD; Figure 6 Tumor weight statistics in the blank group, M4, D / C, D / C / M4 / 0.7% PEG, D / C / M4 / 1%cRGD; Figure 7 Immunohistochemical section in the blank group, M4, D / C, D / C / M4 / 0.7% PEG, D / C / M4 / 1%cRGD group.

[0076] From​Figures 3-7 It can be seen that compared with the blank group, D / C / M4 / 0.7%PEG and D / C / M4 / 1%cRGD can significantly inhibit tumor growth; there is no significant difference in tumor growth curve between D / C / M4 / 0.7%PEG and D / C / M4 / 1%cRGD groups; the tumor weight of D / C / M4 / 0.7%PEG and D / C / M4 / 1%cRGD groups is lighter, and the tumor inhibition rates of D / C / M4 / 0.7%PEG and D / C / M4 / 1%cRGD groups are 53% and 74%, respectively; KRAS G12S mRNA levels in tumor tissues after tail vein injection compared with the blank group, and the inhibition rates are 34% and 39%, respectively; the immunohistochemical results show that each administration group can reduce the expression of KRAS protein, indicating that D / C / DSPE-PEG or D / C / DSPE-PEG-cRGD loaded with M4 is a kind of in vivo anti-tumor preparation with great potential. G12S mRNA levels in tumor tissues after tail vein injection compared with the blank group, and the inhibition rates are 34% and 39%, respectively; the immunohistochemical results show that each administration group can reduce the expression of KRAS protein, indicating that D / C / DSPE-PEG or D / C / DSPE-PEG-cRGD loaded with M4 is a kind of in vivo anti-tumor preparation with great potential.

[0077] It can be seen from the above examples that the antisense nucleic acid M4 provided by the present application has the best anti-tumor effect, and the remaining sequences also have great anti-tumor potential, M4 is effective in vivo, and can effectively achieve in vivo tumor treatment.

[0078] The above only describes the preferred embodiments of the present application, and it should be pointed out that for ordinary skilled persons in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. An antisense nucleic acid targeting the KRAS gene, characterized in that, The nucleotide sequence of the antisense nucleic acid comprises at least one of SEQ ID NO: 1-7; the nucleotide sequence of the antisense nucleic acid further comprises a modified nucleotide sequence of SEQ ID NO: 1 and a modified nucleotide sequence of SEQ ID NO: 8; the modification comprises one or more of 2'-O-methyl modification, 2'-O-methoxyethyl modification, 5-methylcytosine modification and phosphorothioate modification.

2. An antisense nucleic acid pharmaceutical preparation targeting a KRAS gene, characterized by, The antisense nucleic acid drug preparation comprises the antisense nucleic acid of claim 1, the nucleoside material DNCA and the cationic lipid material CLD.

3. The antisense nucleic acid drug substance according to claim 2, characterized in that, The mass ratio of the antisense nucleic acid, the nucleoside material DNCA and the cationic lipid material CLD is 1:10-30:10-30.

4. The antisense nucleic acid drug substance according to claim 2, characterized in that, The antisense nucleic acid drug preparation further comprises a surfactant.

5. The antisense nucleic acid drug substance according to claim 4, characterized in that, The surfactant comprises DSPE-PEG 2000 or DSPE-PEG 2000 -cRGD.

6. A method for preparing the antisense nucleic acid pharmaceutical preparation according to any one of claims 2 to 5, characterized by, The method comprises the following steps: dissolving the nucleoside material DNCA and the cationic lipid material CLD in anhydrous ethanol to obtain nucleoside material DNCA anhydrous ethanol mother liquor and cationic lipid material CLD anhydrous ethanol mother liquor for standby, dissolving the antisense nucleic acid in enzyme-free water to obtain antisense nucleic acid mother liquor for standby; adding the nucleoside material DNCA anhydrous ethanol mother liquor and the cationic lipid material CLD anhydrous ethanol mother liquor into the antisense nucleic acid mother liquor, and placing in 40-60℃ water for ultrasonic treatment for 15-30 min.

7. The preparation method according to claim 6, characterized in that, The concentration of the antisense nucleic acid mother liquor is 10 μM-10 mM.

8. Use of the antisense nucleic acid of claim 1 or the antisense nucleic acid drug preparation of any one of claims 2-5 in the preparation of a KRAS gene targeting drug.

9. Use of the antisense nucleic acid of claim 1 or the antisense nucleic acid drug preparation of any one of claims 2-5 in the preparation of a drug for preventing and / or treating tumors.

10. Use according to claim 9, characterized in that, The tumors are KRAS gene mutation induced pancreatic cancer, colon cancer, endometrial cancer or lung cancer.

Citation Information

Patent Citations

  • Small interfering RNA entrapped by binding 5'-terminal conjugates and neutral / cationic hybrid lipid and modification method of small interfering RNA

    CN112707943A

  • Nucleic acid drug delivery carrier for carrying mRNA as well as preparation method and application thereof

    CN113797327A